ID: 917954767

View in Genome Browser
Species Human (GRCh38)
Location 1:180083820-180083842
Sequence GTATGTGGCGGGCGGCGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 1, 1: 0, 2: 7, 3: 56, 4: 500}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917954760_917954767 -10 Left 917954760 1:180083807-180083829 CCAAAAATAAAGTGTATGTGGCG 0: 1
1: 0
2: 0
3: 8
4: 102
Right 917954767 1:180083820-180083842 GTATGTGGCGGGCGGCGGGGAGG 0: 1
1: 0
2: 7
3: 56
4: 500
917954758_917954767 -5 Left 917954758 1:180083802-180083824 CCAAGCCAAAAATAAAGTGTATG 0: 1
1: 0
2: 2
3: 15
4: 317
Right 917954767 1:180083820-180083842 GTATGTGGCGGGCGGCGGGGAGG 0: 1
1: 0
2: 7
3: 56
4: 500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917954767 Original CRISPR GTATGTGGCGGGCGGCGGGG AGG Intronic
900172057 1:1273978-1274000 GGATGGGGCGGGGGGCGGGGCGG + Intergenic
900180144 1:1307693-1307715 CTTTGTGCCCGGCGGCGGGGTGG - Intronic
900592937 1:3467899-3467921 GGGCGTGGCGGGCAGCGGGGAGG + Intronic
900596462 1:3482299-3482321 GTGTGTGTTGGGGGGCGGGGGGG + Intergenic
901179984 1:7335134-7335156 GTGTGTGGGGGGGGGGGGGGGGG + Intronic
901577167 1:10210460-10210482 GTCCGTCGCGGGCGCCGGGGCGG + Intergenic
901705180 1:11067985-11068007 GTATGTGGTGGACGGCGGTGTGG - Intronic
901831796 1:11897298-11897320 GTGTGTGTCGGGGGGAGGGGGGG - Intergenic
901921932 1:12542859-12542881 GTTGGTGGCGGGGGGCGGTGGGG + Intergenic
902513982 1:16980275-16980297 GAATGTGGCGGGTGGGGTGGGGG - Intronic
903007790 1:20309951-20309973 GTGTGTTGCGGGCGTGGGGGTGG + Intronic
903167626 1:21531893-21531915 GTGTGTGTAGGGTGGCGGGGAGG - Intronic
903349989 1:22711413-22711435 GGCCGTGGCGGGGGGCGGGGGGG + Intronic
903607357 1:24584668-24584690 GCATGGGGTGGGCGGTGGGGTGG + Intronic
903622462 1:24707815-24707837 GTGTGTGGGGGGGGGGGGGGGGG + Intergenic
904944248 1:34187776-34187798 GGTGGTGGGGGGCGGCGGGGGGG - Intronic
905670705 1:39788588-39788610 GCGGGCGGCGGGCGGCGGGGCGG + Exonic
905847109 1:41242214-41242236 GGCTGAGGCGGGGGGCGGGGCGG + Intergenic
906243697 1:44258353-44258375 GTATGTGAGGGGTGGCTGGGTGG - Intronic
906565649 1:46799262-46799284 GTATGTGGAGGTCGGGAGGGTGG + Intronic
906715420 1:47965186-47965208 AGATTTGGCGGGGGGCGGGGGGG + Intronic
906942816 1:50271303-50271325 GTGGGGGGCGGGGGGCGGGGTGG - Intergenic
907372624 1:54013049-54013071 GTGTGGGGGAGGCGGCGGGGGGG + Intronic
907663473 1:56414549-56414571 GTGTGTGGTGGGGGGCAGGGTGG - Intergenic
907797182 1:57729390-57729412 GGATGTGGCGGGCAGCGGGGCGG - Intronic
907856152 1:58305979-58306001 GTGTGTGGAGGGGGGTGGGGGGG - Intronic
910498998 1:87867169-87867191 GTCTGTTGCTGGCGGGGGGGCGG - Intergenic
912439509 1:109687753-109687775 GGTTGTGGCGGGCCGAGGGGCGG + Intronic
912442817 1:109712193-109712215 GGTTGTGGCGGGCCGAGGGGCGG + Intergenic
912504042 1:110143446-110143468 GAAGGCGGGGGGCGGCGGGGAGG - Intergenic
913521263 1:119647822-119647844 GTATGTGGCGAGGGGCGGGGAGG - Intergenic
913592379 1:120341631-120341653 GTGTGTGGCTGGGGGTGGGGTGG - Intergenic
913650979 1:120913514-120913536 GTGTGTGGCTGGGGGTGGGGTGG + Intergenic
914170135 1:145215553-145215575 GTGTGTGGCTGGGGGTGGGGTGG - Intergenic
914267701 1:146052259-146052281 GTGTGAGGCTGCCGGCGGGGCGG - Intergenic
914525252 1:148459516-148459538 GTGTGTGGCTGGGGGTGGGGTGG - Intergenic
914598424 1:149176314-149176336 GTGTGTGGCTGGGGGTGGGGTGG + Intergenic
914641150 1:149607618-149607640 GTGTGTGGCTGGGGGTGGGGTGG + Intergenic
914888285 1:151601037-151601059 GGATGGGGCGGCCGGCCGGGCGG - Intergenic
914993099 1:152515469-152515491 GGAGGAGGCGGGCGCCGGGGTGG - Exonic
915157688 1:153891659-153891681 GTATGGGGGGGGGGGAGGGGAGG + Intronic
915309596 1:155000641-155000663 GCAGGGGGCGGGGGGCGGGGGGG - Intergenic
915589231 1:156861151-156861173 GTGTCCGGCGGGCGGTGGGGGGG + Intronic
916123747 1:161551060-161551082 GTGTGTGGCGGGGGGAGGGGTGG - Intergenic
916133633 1:161632423-161632445 GTGTGTGGCAGGGGGAGGGGTGG - Intronic
916240229 1:162632108-162632130 GTGTGGGGTAGGCGGCGGGGGGG + Intronic
916282852 1:163071858-163071880 GTATGTTGGGGGGGGGGGGGGGG - Intronic
916496686 1:165354071-165354093 GTTTGTGGGGGGCGGAGAGGTGG + Intronic
916549866 1:165839926-165839948 GTCTGGGGCGGGGGCCGGGGTGG - Intronic
917418297 1:174834605-174834627 GTTAATGGGGGGCGGCGGGGGGG - Intronic
917954767 1:180083820-180083842 GTATGTGGCGGGCGGCGGGGAGG + Intronic
918964326 1:191321921-191321943 GAATGTTGTGGGCTGCGGGGAGG + Intergenic
919723644 1:200866985-200867007 GTGGGGGGCGGGGGGCGGGGAGG - Intergenic
920066715 1:203274283-203274305 GTAGGTGGCTGGGGGTGGGGTGG + Intergenic
920338899 1:205263070-205263092 GTGTGTTGCGGGAGGCGGTGGGG - Intronic
920795312 1:209131115-209131137 GGTGGTGGCGGGCGGGGGGGGGG + Intergenic
920922633 1:210311127-210311149 GCACGTGGCGGGGGGGGGGGGGG - Intergenic
921389303 1:214603367-214603389 GTAGGCGGCGGGCGGCGTGGGGG + Intronic
922130474 1:222772243-222772265 GTGGGGGGCGGGGGGCGGGGGGG + Intergenic
922434809 1:225593395-225593417 GTGTGTGGGGGGGGGGGGGGGGG + Intronic
922695379 1:227728585-227728607 GGTTGGGGCGGGAGGCGGGGCGG - Intronic
923016245 1:230128612-230128634 GTGTGTGGCGGGGGCGGGGGTGG + Intronic
923506506 1:234609905-234609927 GTGCGGGGCGGGGGGCGGGGAGG + Intergenic
923631245 1:235650269-235650291 GTCTGGGGGGCGCGGCGGGGGGG + Intronic
924574465 1:245267130-245267152 AGATGTGGCAGGCGGCGAGGAGG - Intronic
924812591 1:247416390-247416412 GTATGTGGCGGGGGGAAGCGGGG + Intronic
924820730 1:247487784-247487806 GTGGGGGGCGGGGGGCGGGGGGG + Intergenic
1062789986 10:297221-297243 GTATGTGGTGGGGTGGGGGGGGG - Intronic
1063357319 10:5412939-5412961 GGATGTGGGGGGCGGCGAGTGGG + Intronic
1063446543 10:6121497-6121519 GAATGGGGCGGGGGGGGGGGGGG + Intergenic
1063624286 10:7675019-7675041 GTGTGGGGGGGGGGGCGGGGGGG - Intergenic
1064146248 10:12828661-12828683 GTTTATGGTGGGGGGCGGGGGGG - Intronic
1064512580 10:16111437-16111459 GAATGAGGGGGGCGGGGGGGGGG + Intergenic
1064513176 10:16117241-16117263 GTTTGTGGCGGGGGGGGGGGGGG + Intergenic
1065021687 10:21507177-21507199 GTGTGTGGGGGGCGGGGGCGGGG - Intergenic
1065594366 10:27296564-27296586 GGATGGGGCGGGTGGCCGGGCGG + Intergenic
1065773937 10:29102177-29102199 GTGTGTGTGGGGCGGCGAGGGGG - Intergenic
1065990698 10:31006763-31006785 GTGGTTGGCGGGGGGCGGGGGGG + Intronic
1067991865 10:51223006-51223028 GTGTGTGGCGGGGGGTGGTGCGG + Intronic
1069019062 10:63465596-63465618 GTGTGTGGCGGTCGGCGACGAGG - Exonic
1069769485 10:70888364-70888386 CTCTGTCGCTGGCGGCGGGGAGG - Intronic
1069912186 10:71766356-71766378 GCAGGTGGCGGGTGGCGGGCGGG - Intronic
1070942192 10:80357334-80357356 GTATGTGGAGGCGCGCGGGGTGG + Intronic
1071306458 10:84303156-84303178 GTGTGTGTGTGGCGGCGGGGGGG + Intergenic
1071306462 10:84303160-84303182 GTGTGTGGCGGCGGGGGGGGGGG + Intergenic
1072602130 10:96940995-96941017 GGATGGGGCGGCCGGCCGGGCGG + Intronic
1072636136 10:97179798-97179820 GGCTGTGCCGGGGGGCGGGGAGG - Intronic
1073732972 10:106312559-106312581 GAATGCGGCGGGGGGGGGGGTGG + Intergenic
1074095107 10:110304751-110304773 GTGTGGGGCTGGGGGCGGGGCGG + Exonic
1074112629 10:110433371-110433393 GTAGGAGTCGGGGGGCGGGGAGG - Intergenic
1074591915 10:114821854-114821876 GGACGCGGCGGGCGGCGAGGAGG - Exonic
1075147297 10:119892968-119892990 GTGTGTGGTGGGAGGCGGGCGGG + Intronic
1076896685 10:133316674-133316696 GTGTGTGGGGGGGGGGGGGGGGG - Intronic
1078246139 11:9574239-9574261 GGACGAGGCGGGCGGTGGGGCGG + Exonic
1078514148 11:12008680-12008702 GCCAGGGGCGGGCGGCGGGGCGG - Intronic
1078801257 11:14645168-14645190 GTGTGTTGCGGGGGGGGGGGGGG + Intronic
1079444992 11:20548926-20548948 GGATGGGGCGGCCGGCCGGGCGG - Intergenic
1080170129 11:29291213-29291235 GTGTGTGAGGGGCGGTGGGGGGG + Intergenic
1080923373 11:36731130-36731152 ATCTGTGGTGGGTGGCGGGGTGG - Intergenic
1081672713 11:44950611-44950633 GCAGGCGGCGGGCGGCGGGAGGG + Intronic
1082073277 11:47956921-47956943 AGAGATGGCGGGCGGCGGGGAGG + Intergenic
1083246225 11:61429990-61430012 GTGTGACGCCGGCGGCGGGGGGG - Intronic
1083315926 11:61815157-61815179 GTGTGGGGCGGGGGCCGGGGCGG + Intronic
1083641005 11:64145291-64145313 GGAGGTGGCGGGAGGCGAGGCGG - Intronic
1084606420 11:70175004-70175026 GCAGGTGGCGGGCGGGGGTGGGG - Intronic
1084980463 11:72826063-72826085 GGATGTGTCGGGGGGTGGGGCGG + Intronic
1085011278 11:73142864-73142886 GTGTGTGTCGGGGGGCGCGGGGG + Intergenic
1085170309 11:74444190-74444212 GTATGAAATGGGCGGCGGGGCGG - Intergenic
1085401709 11:76239642-76239664 GAAGGTGGGGGGCAGCGGGGAGG - Intergenic
1087630212 11:100641473-100641495 CAGTGTGGCGGGTGGCGGGGGGG - Intergenic
1087713130 11:101577557-101577579 GGTTGTGGCGGGAGGTGGGGAGG + Intronic
1090305053 11:125684130-125684152 GTATGTGGCGGCAGGTGGGGCGG + Intergenic
1090327777 11:125904182-125904204 GTGAGCGGCGGGCCGCGGGGCGG + Intronic
1090405895 11:126475677-126475699 GTGTGGGGTGGGCGGCTGGGGGG - Intronic
1090408223 11:126490224-126490246 GTGTGTGGCGGGGGCGGGGGAGG + Intronic
1091117513 11:133027817-133027839 GGATGTGGGGGGAGGTGGGGTGG + Intronic
1091124183 11:133081834-133081856 GTATGCGGAGAGGGGCGGGGAGG - Intronic
1091277543 11:134362686-134362708 GTGTGTGGCAGGTGGAGGGGAGG - Intronic
1092075690 12:5671486-5671508 CTGTGTGGGGGGTGGCGGGGGGG + Intronic
1092229269 12:6767586-6767608 GTATGTGTATGGCGGGGGGGGGG + Intronic
1092266101 12:6981713-6981735 GTGTATGGCGGGGGGCGGAGGGG + Intronic
1092483359 12:8880437-8880459 GTATGTGTGGGGCGGGGTGGGGG + Intronic
1092677366 12:10936138-10936160 GTATGTGTGTGGGGGCGGGGTGG - Intronic
1093662670 12:21774921-21774943 GTAGGGGGCGGGCGGGGAGGGGG + Intronic
1096156775 12:49345489-49345511 GGAAGGGGCGGGTGGCGGGGGGG + Intergenic
1096674527 12:53219421-53219443 GTTTGTGGCGTGAGGCCGGGAGG - Intronic
1096781420 12:53994419-53994441 GGCTGTGGCCGGCGGCGAGGCGG + Intronic
1096788115 12:54029409-54029431 GTGTGTGGTGGGGGGGGGGGCGG - Intronic
1096799974 12:54104024-54104046 CTATGTGGGGGGAGGCTGGGAGG - Intergenic
1096985336 12:55752368-55752390 GTGTGTGGTGGGTGGGGGGGGGG + Exonic
1097046233 12:56189477-56189499 GAGTGGGGCGGGCGGCGGCGGGG - Exonic
1097126957 12:56783514-56783536 GGATGGGGCGGCCGGCCGGGCGG + Intronic
1098350679 12:69556000-69556022 GTGTGTGGCGGGGGGGGGGGCGG + Intronic
1098597805 12:72294364-72294386 GTGTGTGGTGGGGGGCGGTGGGG + Intronic
1098683115 12:73382872-73382894 GTGGGTGGCGGGCGGCATGGGGG - Intergenic
1098898168 12:76085300-76085322 GGATGTGGCGGGGGGTTGGGGGG - Intergenic
1100800009 12:98221295-98221317 GTGGGGGGCGGGCGGCGGAGGGG - Intergenic
1101428362 12:104606160-104606182 CTCTGGGGCGGGGGGCGGGGGGG + Intronic
1101705972 12:107221613-107221635 TTGGGAGGCGGGCGGCGGGGCGG + Intergenic
1101875090 12:108592254-108592276 GGATGTGGCGGGTAGTGGGGAGG - Exonic
1102115965 12:110403302-110403324 GGATGTGGCGAGCGGCGGCTTGG - Intronic
1102259767 12:111436899-111436921 GTGTGTGGCGGGAGGGGGGCGGG - Intronic
1102467374 12:113137812-113137834 GTGTGTGGTGGGGGGCGGTGTGG - Intergenic
1102691314 12:114763245-114763267 GTGTGTGGCGGGGGGCGGCGGGG + Intergenic
1104360556 12:128129143-128129165 GTGTGGGGGGGGCGGGGGGGCGG - Intergenic
1105891476 13:24685434-24685456 GTGTGTGGCGGGGGGCTGTGTGG + Intronic
1106020107 13:25906248-25906270 GGATTGGGCGGGGGGCGGGGAGG - Intronic
1106108704 13:26758952-26758974 GTAGGTGGCGGGCAGGAGGGTGG + Exonic
1106452425 13:29895052-29895074 CTACTTGGCGGGGGGCGGGGGGG + Intergenic
1108541628 13:51452177-51452199 GTGTGTGGGGGACGGCGTGGAGG - Intronic
1109630117 13:65034426-65034448 GGAGGTGGCGGGGGGCGTGGCGG - Intergenic
1111637094 13:90919640-90919662 GTGTGTGGGCGGGGGCGGGGAGG - Intergenic
1113786933 13:113006867-113006889 GTCTGTGGCGGGGTGTGGGGAGG + Intronic
1113956886 13:114103969-114103991 GTCTGTGGCCGGCGGCAGTGTGG - Intronic
1114270762 14:21098524-21098546 GCATGCGGGGGGCGGCGCGGCGG + Exonic
1114326847 14:21598024-21598046 TTGTGTGGGGGGCGGAGGGGAGG - Intergenic
1114405693 14:22453927-22453949 GTGTGTGGCTGGAGGAGGGGAGG + Intergenic
1114454410 14:22845877-22845899 GGACGAGGAGGGCGGCGGGGCGG + Exonic
1114460454 14:22883169-22883191 GTGTGTGTCGGGGGGGGGGGTGG + Exonic
1114663487 14:24365985-24366007 CTCTGAGGCGGGGGGCGGGGGGG - Intronic
1115528192 14:34302087-34302109 GTATTCGGCGGGCGGTGGGTGGG + Intronic
1115835092 14:37393420-37393442 GTGTGTGGCGGGGGTGGGGGTGG + Intronic
1116676520 14:47912697-47912719 GTGTGTGGCGGGGGGTGGGGAGG + Intergenic
1118383049 14:65233399-65233421 GCTTGTGGCGGGGGGCAGGGAGG - Intergenic
1118568787 14:67172243-67172265 GGATGCGGCGGGCGGCGGGCTGG - Intronic
1118720684 14:68591623-68591645 GTGTGTGGCCGGTGGCGTGGGGG + Intronic
1118911022 14:70062102-70062124 CTTTTTGGCGGGGGGCGGGGGGG + Intronic
1119003927 14:70907624-70907646 GGAGGCGGCGAGCGGCGGGGCGG - Exonic
1119046097 14:71320398-71320420 GAATGGGGCGGGAGGCGGGGCGG + Intergenic
1119539229 14:75428015-75428037 GGCTGTGGCGGGCGGCGGGACGG - Intronic
1119899546 14:78248307-78248329 GGAGGTGGCGGGTGGGGGGGGGG - Intronic
1120765393 14:88323426-88323448 GTCTGGGGCGCGCCGCGGGGAGG - Intronic
1121539914 14:94717825-94717847 GTGTGTGGTGGGGGGTGGGGGGG - Intergenic
1122348073 14:101072657-101072679 GGATGTGGCGGGGTGGGGGGTGG - Intergenic
1122724625 14:103742091-103742113 GCCTGTGGCGGGCAGCAGGGTGG + Exonic
1122799074 14:104220912-104220934 CTCTGTGGCGGGCGGCATGGCGG + Intergenic
1123051913 14:105548102-105548124 GGCGGTGGGGGGCGGCGGGGAGG - Intergenic
1124574707 15:30897082-30897104 GGATGTGGGGGGGGGGGGGGGGG - Intergenic
1125260886 15:37823611-37823633 GAATTTGGCTGGTGGCGGGGGGG - Intergenic
1125919560 15:43517589-43517611 GAGTGGGGCGGGCGGTGGGGGGG - Intronic
1127165550 15:56243046-56243068 GTGGGTGGGGGGCGGCGGGCGGG - Intronic
1127236613 15:57059725-57059747 ATATGTGGTGGGGGGCTGGGGGG + Intronic
1128636364 15:69305106-69305128 GTTTGTGGTGGGCGGTGGAGAGG + Intronic
1128947924 15:71842929-71842951 GTATGGGGCGGGGGGTGGTGAGG + Intronic
1129053081 15:72798367-72798389 GTGTTTGGCGGGGGGTGGGGTGG + Intergenic
1129406507 15:75322637-75322659 CTGGGTGGCGGGCGGCGTGGGGG + Intergenic
1129460586 15:75698312-75698334 GTATGTGGTGGGGCGGGGGGTGG + Intronic
1129615826 15:77098192-77098214 ATATGTGTCGGGGGGGGGGGTGG + Intergenic
1129894350 15:79092387-79092409 GTGTGTGGCGGGGGGTGTGGGGG - Intergenic
1130910363 15:88266406-88266428 GCAGGTGGCGGGGGGCGGGTGGG + Intergenic
1131120908 15:89822967-89822989 GTTGGTGGCGGGTGGGGGGGTGG + Intergenic
1131765105 15:95667625-95667647 GTGTGTGGCGGTGGGGGGGGTGG - Intergenic
1132269012 15:100506462-100506484 GTGTGTGTGGGGCGGCGGGGGGG - Intronic
1132501420 16:286210-286232 GTGTGGGGGGGGCGGTGGGGGGG - Intronic
1132577551 16:670957-670979 GAACGTGGCGGGCGGCGTGCGGG + Exonic
1132797012 16:1729579-1729601 GTACGCGGGGCGCGGCGGGGTGG + Intronic
1132797021 16:1729604-1729626 GTACGCGGGGCGCGGCGGGGCGG + Intronic
1135274855 16:21103349-21103371 GTGTGTGGGGGGGGGCAGGGTGG + Intronic
1135325047 16:21520685-21520707 GGATGACGCGGGCGCCGGGGGGG - Intergenic
1135712694 16:24730739-24730761 GTATGGGGGGGGGGGGGGGGCGG - Intronic
1135839408 16:25860954-25860976 GTATGTGGAGGGGGACGGGGAGG + Intronic
1136336529 16:29613953-29613975 GGATGACGCGGGCGCCGGGGGGG - Intergenic
1136470747 16:30478362-30478384 GAAAGTGGGGGGCGGAGGGGAGG + Intronic
1137283974 16:47000518-47000540 GGATGGGGCGGCTGGCGGGGCGG - Intergenic
1138160399 16:54747790-54747812 GCTTGTGGCGGGGGGGGGGGGGG - Intergenic
1138570295 16:57867135-57867157 GGAAGTGGCGGGGGCCGGGGGGG - Intergenic
1140661450 16:77193913-77193935 GTCAGTGGCGGGAGGTGGGGGGG + Intronic
1140996799 16:80268035-80268057 GTGTGTGGGGGGCTGGGGGGTGG + Intergenic
1141840027 16:86568252-86568274 GTAGGCGGCGGGCGGCGCGGCGG - Exonic
1142141456 16:88474521-88474543 GGAGGAGGCGGGTGGCGGGGAGG - Intronic
1142406365 16:89892376-89892398 GGGGGTGGAGGGCGGCGGGGGGG + Intronic
1142785168 17:2215855-2215877 GTGGGTGGGGGGCGGCGAGGAGG + Intronic
1143028496 17:3954398-3954420 GTATGTGGGGCGGGGCTGGGGGG - Intronic
1143434672 17:6914733-6914755 GTGTGTGGGGGGGGGGGGGGGGG - Intronic
1143840068 17:9724921-9724943 TTCTGTGGCGGGGGGCAGGGGGG + Intronic
1143841682 17:9737224-9737246 GTGTGTGGGGGGTGGGGGGGTGG + Intergenic
1144170983 17:12659760-12659782 GTGTGTGTCGGGGGGTGGGGTGG - Intergenic
1144703243 17:17351915-17351937 CAAGGTGGCGGGGGGCGGGGTGG - Intergenic
1144851169 17:18244710-18244732 GTGTGTGTCCGGCGGGGGGGGGG + Exonic
1145418168 17:22741435-22741457 GGATGAGGCGGCTGGCGGGGCGG - Intergenic
1146214917 17:30971328-30971350 GTATCTCGCGTGCGGCGCGGCGG - Exonic
1147132834 17:38419200-38419222 GGAGGGGGCGGGCGGAGGGGCGG + Intergenic
1147402862 17:40191539-40191561 GTCAGGGGCGGGCGGCGGCGCGG - Intronic
1147419279 17:40314165-40314187 GGATATGGCGGGTGGAGGGGTGG + Intronic
1147791209 17:43015320-43015342 GTGTGTGTGTGGCGGCGGGGAGG - Exonic
1148262128 17:46193167-46193189 GTTTGTGCGGGGCGGGGGGGCGG - Intronic
1148579495 17:48734018-48734040 GTGTGTGGCGGGCGGAGGAAGGG - Intergenic
1148783915 17:50135945-50135967 GTACGTGGCTGGGGGCTGGGCGG - Intronic
1148911349 17:50944716-50944738 GTTCGCAGCGGGCGGCGGGGAGG - Intergenic
1149863352 17:60136695-60136717 GTGTGTGTCGGGGGGGGGGGGGG - Intergenic
1149884477 17:60327403-60327425 GTTGGTGGGGGGCGGGGGGGAGG + Intronic
1149997836 17:61414117-61414139 GTGGGTTGCGGGCGGGGGGGCGG + Intergenic
1150070711 17:62147677-62147699 GGATGGGGCGGCCGGAGGGGGGG - Intergenic
1150313067 17:64145433-64145455 GTTGGGGGGGGGCGGCGGGGGGG + Intergenic
1150661272 17:67081794-67081816 GTATGTGGGGCGGGGCAGGGGGG + Intronic
1151820470 17:76494116-76494138 GTGTGTTGCGGGGGGCTGGGGGG + Intronic
1152110804 17:78356727-78356749 GCACGGGGCGGGGGGCGGGGGGG + Intergenic
1152381519 17:79944803-79944825 GTGGGTGGGGGGCGGCGAGGCGG + Intronic
1152623990 17:81380024-81380046 GGATGTGAGGGGAGGCGGGGGGG - Intergenic
1152759089 17:82098884-82098906 GTGATGGGCGGGCGGCGGGGCGG + Intergenic
1155077043 18:22367799-22367821 GTGTGTGGCGGGAGCTGGGGGGG + Intergenic
1155218273 18:23662436-23662458 GTCTGTGCCCGGCGACGGGGCGG - Intronic
1155388616 18:25308652-25308674 GGCTGTGGCGGGTGGGGGGGGGG - Intronic
1157529559 18:48409580-48409602 GCATGTGCCGCGCGGCGGGGAGG - Intronic
1159582168 18:70245673-70245695 GTGTGGGGTGGGAGGCGGGGTGG - Intergenic
1159988307 18:74872168-74872190 GCCTGTGGAGGGGGGCGGGGCGG - Intronic
1160531182 18:79565655-79565677 GTGTGTGGTGGGGGGCGGGGTGG + Intergenic
1160683997 19:425074-425096 GTATGTGGCAGCCTGGGGGGCGG - Intronic
1161064735 19:2232048-2232070 GTGTGTGGCGGGTGGCAGGGTGG + Exonic
1161250415 19:3276795-3276817 GTGTCTGGTGGGAGGCGGGGGGG + Intronic
1161628071 19:5338496-5338518 CTTTGTGGAGGGCAGCGGGGGGG + Intronic
1161852233 19:6743601-6743623 GTGTGTGGCGGGGGCGGGGGGGG + Intronic
1162562064 19:11422664-11422686 CTCTGGGGAGGGCGGCGGGGCGG - Intronic
1162597322 19:11639581-11639603 GCATGGGGCGGGCGGGGGAGGGG - Intergenic
1162751703 19:12833714-12833736 GGAAGGGGCGGGCGGGGGGGCGG - Intronic
1162860939 19:13505700-13505722 GTTTGTGGGGGGCTGGGGGGTGG - Intronic
1164989590 19:32674724-32674746 GGATCTGGCGGGGCGCGGGGCGG - Intronic
1165061886 19:33208912-33208934 GTCTGTGGCAGGCAGCAGGGAGG + Exonic
1165349651 19:35269013-35269035 GGAGGGGGCGGGCGGCCGGGGGG - Intronic
1166375125 19:42323767-42323789 GGAGGTGGCGGGCGGGGGGATGG - Exonic
1166882945 19:45940219-45940241 GGCCGGGGCGGGCGGCGGGGCGG - Exonic
1167063643 19:47167746-47167768 GTTGGTGGTGGGCGGTGGGGGGG - Intronic
1167466232 19:49652227-49652249 GGAAGTGGCCGGGGGCGGGGAGG - Exonic
1167503942 19:49861730-49861752 GTAGGTGGCCTGCGGCGGGGTGG - Intronic
1167509483 19:49888533-49888555 GTCCGTGGAGGGCGGCGGGGTGG - Exonic
1168311271 19:55461963-55461985 GTGAGTGGCGGCCGACGGGGCGG + Intronic
926107677 2:10162673-10162695 GGGGGTGGGGGGCGGCGGGGGGG - Intronic
927637247 2:24825326-24825348 GGTTGTGGCGGGGGGGGGGGGGG + Intronic
927944018 2:27123859-27123881 GCCTATGGCGGGCGGCGGGTGGG + Exonic
928624113 2:33122022-33122044 GTGTGTGGAGGGGGGCAGGGTGG - Intronic
929026423 2:37607880-37607902 GTGTGTGTGGGGAGGCGGGGCGG - Intergenic
929739861 2:44589022-44589044 GGATGGGGCGGCCGGCCGGGCGG - Intronic
930270831 2:49254601-49254623 CTGTGTGGTGGGTGGCGGGGAGG + Intergenic
931710672 2:64987646-64987668 GTGTGTGGGGGGGGGGGGGGTGG - Intergenic
932030764 2:68182073-68182095 GTGTGTGGTGGGGGGAGGGGGGG - Intronic
932763746 2:74457562-74457584 GCACGGGGCGAGCGGCGGGGAGG + Exonic
933893460 2:86790726-86790748 GGATGGGGCGGGCGGGGGGCGGG - Intronic
934710629 2:96511907-96511929 GTAAGTGGGGGGCGGGGGGGTGG - Intergenic
935563652 2:104584320-104584342 GTGGGGGGGGGGCGGCGGGGAGG + Intergenic
936321101 2:111467755-111467777 GTGTGTGGGGGGGGGGGGGGTGG + Intergenic
937956253 2:127423188-127423210 GATGCTGGCGGGCGGCGGGGCGG + Intronic
937991389 2:127664283-127664305 GTAGGTGGCCAGGGGCGGGGCGG - Intronic
938540365 2:132280083-132280105 GGAGGTGGCGGGCCGCGGGCTGG - Intergenic
938928739 2:136067442-136067464 GTAAGTGTGGGGCGGCTGGGTGG + Intergenic
939462177 2:142511328-142511350 GTGGGTGGTGGGGGGCGGGGAGG + Intergenic
939800107 2:146697851-146697873 AAAGGTGGCGGGGGGCGGGGGGG + Intergenic
940453926 2:153872611-153872633 GTTGGTGGCGGGGGGGGGGGGGG + Intronic
942047694 2:172109315-172109337 GTGCTTGGGGGGCGGCGGGGCGG + Intergenic
942970687 2:181954328-181954350 GTATGTGGAGGTCGGGGTGGTGG - Intronic
944743843 2:202635977-202635999 GAATGAGGCGGGCGGGCGGGCGG - Intronic
944973700 2:205023530-205023552 GGATTTGGCGGGGGGTGGGGGGG - Intronic
946306410 2:218859360-218859382 GTTTGGGGCGGGGGGCGGTGCGG - Intergenic
946621900 2:221571327-221571349 GTCTGTGTCGGGAGGTGGGGCGG - Intronic
947119155 2:226798809-226798831 GCATGTGCCGGGCCGCGGCGAGG - Exonic
947510723 2:230752027-230752049 GTATGTGGGGGGGGGGGGGGTGG - Intronic
947685805 2:232083279-232083301 ATATGTGGGGGGGGGGGGGGGGG - Intronic
948248677 2:236507613-236507635 GAATGCGGGGGGCGGGGGGGGGG - Intergenic
948494731 2:238340039-238340061 GTGTGCGGTGGGTGGCGGGGCGG + Intronic
948991676 2:241558863-241558885 GGACGGGGCGGGCGCCGGGGCGG + Exonic
948991692 2:241558961-241558983 GCATGGCGCGGGCGCCGGGGTGG - Exonic
949014063 2:241699672-241699694 GGATGTGGCTGGGGGTGGGGCGG + Intergenic
1169113276 20:3046522-3046544 GCGTGGGGCGGGAGGCGGGGCGG + Intronic
1169218472 20:3806866-3806888 GTGTGTGGGGGGCTGGGGGGAGG - Intergenic
1169465811 20:5837247-5837269 GCAGGTGGTGGGCGGAGGGGAGG - Intronic
1170578597 20:17681891-17681913 GCAGGCGGCGGGCGGCGGGCGGG + Intronic
1172118136 20:32583756-32583778 GGAGGAGGCGGGCGGCCGGGCGG - Intronic
1173571043 20:44076318-44076340 GTAGGTGGCGGGGGGGGGGGGGG - Intergenic
1173653776 20:44684775-44684797 GTGTGTGGGGGGGGGAGGGGAGG + Intergenic
1174080548 20:47968379-47968401 GTGTGTGGGGGGGGGGGGGGAGG - Intergenic
1174130241 20:48339473-48339495 GTGTGTGGCGGGGAGCTGGGGGG - Intergenic
1174429532 20:50457916-50457938 GTAGGTGGGGTGTGGCGGGGTGG + Intergenic
1175340939 20:58228609-58228631 GGATGCGGCGGGCGGCGGCGGGG - Exonic
1175669069 20:60885827-60885849 GTGTGTGGGGGGTGGTGGGGAGG + Intergenic
1175715436 20:61252187-61252209 GCAGGGGCCGGGCGGCGGGGCGG + Intergenic
1176990541 21:15491004-15491026 GGATGGGGTGGGGGGCGGGGAGG + Intergenic
1179675033 21:42975097-42975119 GTCGGGGGCGCGCGGCGGGGCGG + Intronic
1179803375 21:43822423-43822445 GTATGGGGCGGCTGGCCGGGCGG - Intergenic
1179817506 21:43917168-43917190 GTGTGTGGGGGGCGGGGGCGGGG - Intronic
1180109573 21:45641902-45641924 GAATGTGGAGTGGGGCGGGGGGG - Intergenic
1180109897 21:45642965-45642987 GGATTTGGCGGGCGGGCGGGTGG - Intergenic
1181528126 22:23501794-23501816 GGAGGTGGTGGGTGGCGGGGTGG - Intergenic
1182485348 22:30635686-30635708 GTAGGGAGCGGGCGGCGGCGGGG + Exonic
1182693980 22:32184034-32184056 ATAACTGGCGGGGGGCGGGGCGG + Intergenic
1182983564 22:34695792-34695814 AGATGTGGGGGGCGGTGGGGGGG - Intergenic
1183228197 22:36564459-36564481 GTAGGTGGCGGTGGGCGTGGTGG + Exonic
1183535643 22:38398977-38398999 GTCTGTGGCGGGGGGCGGAGCGG - Intergenic
1183731835 22:39622595-39622617 GTGTGGGGGGGGCGGTGGGGGGG + Intronic
1183819566 22:40334488-40334510 GGATGAGGTGGGTGGCGGGGAGG - Exonic
1184408687 22:44314181-44314203 GGATGAGTCGGGCGGTGGGGCGG + Intergenic
1184609407 22:45593158-45593180 GTCAGTGGCGGGGGGTGGGGGGG - Intronic
1184632159 22:45790375-45790397 GTATGTGTGGGGCGGCGGGGGGG - Intronic
1185313725 22:50170183-50170205 CTGCGTGGCGGGGGGCGGGGTGG + Intergenic
1185315667 22:50178208-50178230 GTCAGGGGCGGGCGGCGGGGCGG - Exonic
949534923 3:4988352-4988374 CTATGGGGGGGGCGGTGGGGGGG + Intergenic
949905070 3:8852420-8852442 GAAGGTGGCGGAGGGCGGGGTGG - Intronic
950143397 3:10630834-10630856 GTTTGTGGCGGGGGGGTGGGGGG + Intronic
951080494 3:18445351-18445373 GGGTGTGGGGGGCGGCGGGCCGG + Intronic
951108212 3:18770292-18770314 GAGGGTGGCGGGCGGGGGGGTGG + Intergenic
952430453 3:33218659-33218681 GTGTGCGGGAGGCGGCGGGGCGG - Intronic
953926974 3:46987578-46987600 GGACATGGCGGGCGGCGGGGCGG + Intronic
954054758 3:48012655-48012677 GTGTGTGGCTGGGGGCGGGGTGG - Intronic
954072660 3:48154365-48154387 GTTTGTGGTGGGCGGGGGGGGGG - Intergenic
955066535 3:55537978-55538000 GTGTGTGGGAGGCGGTGGGGAGG + Intronic
956167724 3:66408956-66408978 GTGTGTGGTGGGGGGAGGGGGGG + Intronic
956182116 3:66527288-66527310 GTATGGGGTGGGGGGCGGGGGGG + Intergenic
956322378 3:68011123-68011145 GTGTGTGGGGGGTGGTGGGGGGG + Intronic
956379968 3:68654871-68654893 GTTTGGGGGGGGCGGGGGGGTGG + Intergenic
956638315 3:71389230-71389252 GTAAGCGGCGGGGGGGGGGGGGG + Intronic
956902474 3:73730848-73730870 GTAGATGGCGGGGAGCGGGGAGG + Intergenic
957132035 3:76235277-76235299 GTGTGTGTTGGGCGGTGGGGCGG - Intronic
957961288 3:87256917-87256939 GTTTGGGGATGGCGGCGGGGGGG - Intergenic
960717940 3:120596127-120596149 GTAGGTGGGGAGCGGCGGTGGGG + Intergenic
961472682 3:127126130-127126152 GTGTGTGGAGGGAGGTGGGGTGG + Intergenic
961705645 3:128783204-128783226 GTTTGTGGGGGGCGGGGGGGCGG - Intronic
962134777 3:132722277-132722299 GTACGGGGCGGGCGGCGGCGAGG - Exonic
962222352 3:133574179-133574201 GGGTGCGGCGGGCGGCGGGGCGG + Exonic
962229555 3:133650359-133650381 GTGTGTGGGGGGCGGGGGGAGGG + Intronic
964570569 3:158105035-158105057 GTGTGTTGGGGGCGGGGGGGGGG - Intronic
964943899 3:162194888-162194910 GTATGTGGTGGGGTGTGGGGAGG + Intergenic
965285456 3:166813755-166813777 GTGTGGGGCGGGGGGGGGGGTGG - Intergenic
965285458 3:166813759-166813781 GTGTGTGTGGGGCGGGGGGGGGG - Intergenic
966594880 3:181716978-181717000 GTATGTGGTGGGGGGGGGGTGGG - Intergenic
966905876 3:184525662-184525684 GTGTGTGGCCCGCGGTGGGGTGG - Intronic
967177526 3:186874073-186874095 GGATGGGGCGGCTGGCGGGGCGG - Intergenic
967896545 3:194400488-194400510 GGATGGGGCGGCCGGCCGGGCGG - Intergenic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
969239313 4:5888618-5888640 GTGGGGGGCGGGGGGCGGGGTGG - Intronic
969873326 4:10117713-10117735 GTATTTGGCGGGGTGCGGGCGGG + Intergenic
970754889 4:19413877-19413899 GTGTGTGGCGGGGGGGGGGGGGG - Intergenic
971402059 4:26285260-26285282 GTAAGTGGCGGGGGTGGGGGCGG - Intronic
972380582 4:38516020-38516042 GTGTGTGGCGGGCGGGGGGGGGG - Intergenic
976188053 4:82462653-82462675 GTATTTGGCGGGCGACGGGGCGG - Intergenic
976778382 4:88731275-88731297 GTGTGTGTGGTGCGGCGGGGGGG + Intronic
979347123 4:119601439-119601461 GGAGGTGGCGGGGGGTGGGGTGG - Intronic
981033676 4:140151007-140151029 GCATGGGGGGCGCGGCGGGGCGG + Intronic
981550476 4:145937287-145937309 GTGTGTGGCTGCCGCCGGGGAGG + Intronic
981644280 4:146980809-146980831 GAATATGGCTGGTGGCGGGGTGG + Intergenic
981874944 4:149530797-149530819 GTATGTGGGGGGGGGGTGGGGGG - Intergenic
981937483 4:150251529-150251551 GTATGTGGGGGGTGGGGGTGTGG - Intronic
982273349 4:153614513-153614535 GTTGGTGGGGGGCGGCGGGGTGG + Intronic
982380434 4:154743129-154743151 GTGTGTGTAGGGCGGGGGGGGGG - Intronic
984272121 4:177559725-177559747 TTTTGGGGCGGGTGGCGGGGGGG + Intergenic
985777475 5:1852346-1852368 GTGTGTGGTGGGCGGGGGGGCGG - Intergenic
986835832 5:11636026-11636048 GTGTGTGGCGGGGGTGGGGGGGG - Intronic
987976439 5:25020691-25020713 GTTTGTGGCTGGAGGTGGGGGGG + Intergenic
988643386 5:33066646-33066668 GTGTGTGTGGGGCGGGGGGGTGG + Intergenic
989122973 5:38022511-38022533 GTGTGTGGCGGGGGTTGGGGGGG + Intergenic
989379632 5:40800388-40800410 GGACGTGGCGGCCGGCCGGGCGG - Intergenic
989983238 5:50667250-50667272 GTCTGTGGCTGGGGGTGGGGTGG + Intronic
990431438 5:55738505-55738527 GTTTGTGGCGTGCGTGGGGGCGG - Intronic
992962676 5:81971877-81971899 GGTGGTCGCGGGCGGCGGGGAGG + Intergenic
993173050 5:84445294-84445316 GTATGTGAGGGGCAGTGGGGTGG + Intergenic
994311989 5:98283968-98283990 GTATGTGGTGGGGGTGGGGGTGG - Intergenic
995754824 5:115491624-115491646 GTGTGTGTTGGGTGGCGGGGTGG + Intergenic
995872908 5:116761232-116761254 TTTTGTGGCGGGGGGTGGGGGGG + Intergenic
996376685 5:122816812-122816834 GTATGTGGGGGGGAGGGGGGAGG + Intronic
996772125 5:127097008-127097030 GTGTGTGGGGGGGGGGGGGGCGG + Intergenic
997857733 5:137388392-137388414 GTATGTGGCGGGAGGGAGGGGGG + Intronic
998018763 5:138753165-138753187 TTCTGAGGTGGGCGGCGGGGAGG + Intronic
998432626 5:142079399-142079421 GTGTGTGTGGGGCGGTGGGGGGG + Intergenic
999197320 5:149791197-149791219 GTCTGGGGCGGGGGGCGGGGTGG + Intronic
999603843 5:153296177-153296199 GGATGGGGCGGCTGGCGGGGCGG + Intergenic
999710551 5:154314625-154314647 GTATGTTGTGGGAGGCGGGGAGG - Intronic
1000129631 5:158283688-158283710 GTATGTGGTGGGGGAAGGGGGGG + Intergenic
1001401929 5:171451057-171451079 GGAGGCGGCCGGCGGCGGGGTGG - Intronic
1002799498 6:508203-508225 GTATGTGGTGGCGGGCGGGACGG - Intronic
1003465443 6:6376241-6376263 GTATTTTGCGGGGGGGGGGGGGG - Intergenic
1004114134 6:12749875-12749897 GACTGCGGGGGGCGGCGGGGAGG - Intronic
1004814866 6:19301893-19301915 GTATGTGTGGGGCCGGGGGGAGG + Intergenic
1005452488 6:25987203-25987225 GTGTGTGGCGGGCGGGGGGCGGG - Intergenic
1005715669 6:28544602-28544624 GGAATTGGCGGGGGGCGGGGGGG + Intergenic
1006183298 6:32166715-32166737 TTATGTGGCGGGAGGTGAGGCGG + Exonic
1006466400 6:34197155-34197177 GGAGGTGGGGGGGGGCGGGGGGG - Intergenic
1006599686 6:35217214-35217236 GTGTTTGGCGGGGGGGGGGGGGG + Intronic
1006700459 6:35968777-35968799 GTAAGGGGCTGGGGGCGGGGGGG - Intronic
1007652124 6:43429404-43429426 GTGTGTGGCGGGGGGGAGGGGGG + Intronic
1007804880 6:44435078-44435100 GTATGTGGGGGCAGGGGGGGCGG - Intronic
1012401505 6:98845529-98845551 GTATGTGTTGGGTGGCGGGTCGG + Intergenic
1013219351 6:108063675-108063697 GTGTGTGGCAGGCGGCGGGGTGG - Intronic
1013422682 6:109980050-109980072 GTAGGTGGCGGGCAGCAGGGTGG - Exonic
1014477240 6:121888743-121888765 GCATGGGGCGGGCGTGGGGGGGG - Intergenic
1014802241 6:125790565-125790587 GGAGGTCGCGGGGGGCGGGGAGG + Intronic
1016034468 6:139372509-139372531 GGGTGGGGGGGGCGGCGGGGGGG + Exonic
1016308005 6:142703469-142703491 GCATGTTGCGGGGGGTGGGGGGG - Intergenic
1017704642 6:157110908-157110930 GTGTGTGGCGGTTGGCGGTGGGG + Intronic
1018635407 6:165855297-165855319 GGAAGTGGCGGGGGGGGGGGGGG + Intronic
1019001923 6:168761076-168761098 GTGTGGGGCGGGCGGGGGCGGGG + Intergenic
1019036750 6:169067311-169067333 GTGTGTGGGGGGGGGGGGGGGGG - Intergenic
1019422089 7:955165-955187 GTGGGTGGTGGGCGGCTGGGTGG - Intronic
1019510195 7:1413976-1413998 GGAGGTGGCGGGGGGGGGGGGGG - Intergenic
1019702337 7:2480070-2480092 AGATGTGGCCGGGGGCGGGGAGG - Intergenic
1019739635 7:2666172-2666194 GTATGTGGGCGGGGGGGGGGGGG + Intergenic
1020462577 7:8441929-8441951 GTCTGTGGGGGTGGGCGGGGAGG + Intronic
1020579904 7:9983945-9983967 GTGTGTGGGGGGGGGGGGGGCGG + Intergenic
1021393942 7:20124969-20124991 GAAGGTGGTGGGCGGGGGGGGGG - Intergenic
1021684030 7:23164155-23164177 GTAGTTGGCGGGGGGTGGGGTGG - Intronic
1021710150 7:23407945-23407967 GCAGGGGGCGGGGGGCGGGGGGG + Intronic
1022375555 7:29807575-29807597 GCCCGTGGCGGGCGCCGGGGCGG + Intronic
1022747533 7:33188106-33188128 GTGTGTGGCGGGTGGGGGTGGGG + Intronic
1023259272 7:38341812-38341834 GTGTGTGGCGGGGGGCGGGGGGG + Intergenic
1023849224 7:44140899-44140921 GTATGTGGGGTGGGGTGGGGGGG + Intronic
1024279894 7:47710294-47710316 GACAGTGGCGGGCGGCGGGGTGG - Intronic
1024386452 7:48757412-48757434 GTGTGTGTCGGGGGGTGGGGGGG - Intergenic
1026236937 7:68535126-68535148 GGGGGTGGTGGGCGGCGGGGGGG + Intergenic
1026877590 7:73888319-73888341 GAATGTGGAGGGCTGCTGGGTGG + Intergenic
1027233033 7:76282896-76282918 CGACGGGGCGGGCGGCGGGGTGG + Intronic
1027504835 7:79003188-79003210 GTATGTAGCAGGTGGTGGGGGGG + Intronic
1027519548 7:79188276-79188298 GTCTGTTGGGGGAGGCGGGGTGG - Intronic
1028086845 7:86645972-86645994 CTTTGTGGTGGGCGGGGGGGTGG + Intronic
1028987356 7:97018734-97018756 GTTTGCGGGGGGCGGGGGGGGGG - Intergenic
1029166047 7:98591860-98591882 GTGTGGGGAGGGAGGCGGGGGGG - Intergenic
1029849348 7:103446122-103446144 GGCTGTGGAGCGCGGCGGGGCGG - Exonic
1031406255 7:121390845-121390867 GTGTGGGGCGGGGGGGGGGGGGG + Intronic
1031968320 7:128044625-128044647 GTGTGTGGCGGGGGTGGGGGGGG - Intronic
1032079160 7:128850047-128850069 GTGTGGGGCGGGCGCCGGGCCGG - Exonic
1032663553 7:134012531-134012553 GTGTGTGGAGGGCGGAGAGGGGG + Intronic
1033453614 7:141482910-141482932 GTTTGCGGGGGGCGGTGGGGGGG + Intergenic
1034459844 7:151192213-151192235 GTATGGGGCGGGAGGTGGGCAGG + Intronic
1034620287 7:152451664-152451686 GCCTGCGGCGGGGGGCGGGGGGG - Intergenic
1035082992 7:156233165-156233187 GTCTGTCGCGGGCGGCGGGCGGG + Intergenic
1035487702 7:159240194-159240216 GTGTGTGGCGGGGGGAGGAGTGG + Intergenic
1036263764 8:7259325-7259347 GTGTGTGGCGGCTGGCGGGCAGG - Intergenic
1036265064 8:7266947-7266969 GTGTGTGGCGGCTGGCGGGCAGG - Intergenic
1036266365 8:7274569-7274591 GTGTGTGGCGGCTGGCGGGCAGG - Intergenic
1036267667 8:7282191-7282213 GTGTGTGGCGGCTGGCGGGCAGG - Intergenic
1036268970 8:7289813-7289835 GTGTGTGGCGGCTGGCGGGCAGG - Intergenic
1036273165 8:7325879-7325901 GTGTGTGGCGGGGGGTGGGGGGG - Intergenic
1036297618 8:7549618-7549640 GTGTGTGGCGGCTGGCGGGCAGG + Intergenic
1036298923 8:7557267-7557289 GTGTGTGGCGGCTGGCGGGCAGG + Intergenic
1036300228 8:7564917-7564939 GTGTGTGGCGGCTGGCGGGCAGG + Intergenic
1036301532 8:7572562-7572584 GTGTGTGGCGGCTGGCGGGCAGG + Intergenic
1036302830 8:7580211-7580233 GTGTGTGGCGGCTGGCGGGCAGG + Intergenic
1036315804 8:7717864-7717886 GTGTGTGGCGGCTGGCGGGCAGG - Intergenic
1036317113 8:7725512-7725534 GTGTGTGGCGGCTGGCGGGCAGG - Intergenic
1036318422 8:7733160-7733182 GTGTGTGGCGGCTGGCGGGCAGG - Intergenic
1036319731 8:7740807-7740829 GTGTGTGGCGGCTGGCGGGCAGG - Intergenic
1036321038 8:7748455-7748477 GTGTGTGGCGGCTGGCGGGCAGG - Intergenic
1036322346 8:7756103-7756125 GTGTGTGGCGGCTGGCGGGCAGG - Intergenic
1036323655 8:7763751-7763773 GTGTGTGGCGGCTGGCGGGCAGG - Intergenic
1036324954 8:7771399-7771421 GTGTGTGGCGGCTGGCGGGCAGG - Intergenic
1036351084 8:8012909-8012931 GTGTGTGGCGGCTGGCGGGCAGG + Intergenic
1036352385 8:8020555-8020577 GTGTGTGGCGGCTGGCGGGCAGG + Intergenic
1036353684 8:8028203-8028225 GTGTGTGGCGGCTGGCGGGCAGG + Intergenic
1036754159 8:11461393-11461415 TCATGTGGCGGTTGGCGGGGCGG - Intronic
1036952893 8:13158738-13158760 ATGTGTGGCGGGCGGGGGGGGGG - Intronic
1037306065 8:17505082-17505104 GGATCGGGTGGGCGGCGGGGGGG - Intronic
1037548528 8:19947657-19947679 GTGTGTGTGGGGCGGGGGGGGGG - Intronic
1037670722 8:21013134-21013156 GTGTGTGGGGGGGGGGGGGGGGG - Intergenic
1038554113 8:28494539-28494561 GACTGTGGCGGGCTGCGGAGCGG + Intronic
1038650820 8:29401775-29401797 GTGTGTGGCGGGGGGGCGGGGGG - Intergenic
1038846775 8:31237412-31237434 GTCTGTGGGGGGGGGCGGGGTGG - Intergenic
1039060267 8:33566993-33567015 GAATGTGGGGCGCCGCGGGGCGG + Exonic
1039385506 8:37132074-37132096 GCAGGTGGCGGGGGGTGGGGGGG - Intergenic
1039457470 8:37717050-37717072 GTGTGTGGGGGGCGGGGGGGTGG + Intergenic
1040821166 8:51559331-51559353 GAAGGTGGCGGGGGGGGGGGGGG - Intronic
1041172265 8:55156203-55156225 GTATTTGGTGGGGGGCGGGGAGG + Intronic
1041552740 8:59119447-59119469 GGATGTGGGGGGTGGGGGGGTGG + Intergenic
1041923823 8:63215215-63215237 GTATGTGGGGGGTGGGGGGGGGG - Intergenic
1042043066 8:64615414-64615436 GTATGGGGGGGGCGGTGTGGTGG + Intronic
1042670260 8:71254837-71254859 GTGTGTGGTGGGGGGCGGGGTGG - Intronic
1043463833 8:80486507-80486529 GAAGGGGGCGGGCGGCGGAGAGG - Exonic
1044646488 8:94449185-94449207 GTGTGTGGTGGGGGGCGGGGGGG - Intronic
1045235808 8:100351525-100351547 GGATGGGGCGGCTGGCGGGGCGG - Intronic
1045301187 8:100911569-100911591 GTAGGTTGGGGGCGGGGGGGCGG + Intergenic
1045323240 8:101097703-101097725 GTGTGTAGGGGGCGGTGGGGGGG + Intergenic
1047987283 8:130248206-130248228 GAATGTGGCGGGTGCCGGGGGGG + Intronic
1048553887 8:135457315-135457337 GGAGGCGGCGGGCGGCGGGGCGG + Intergenic
1048677569 8:136800617-136800639 GTGTGTGGCGGGGGTTGGGGGGG + Intergenic
1049740796 8:144239973-144239995 GCAGGTGGGGGGCAGCGGGGCGG + Intronic
1050651847 9:7785311-7785333 GTGTGGGGCGGGGGGGGGGGGGG - Intergenic
1050651851 9:7785315-7785337 GTGTGTGTGGGGCGGGGGGGGGG - Intergenic
1051115251 9:13687077-13687099 GTATTTGGCGGGGGTTGGGGGGG - Intergenic
1052659270 9:31407241-31407263 ATATGGGGCGGGGGGTGGGGGGG - Intergenic
1052977069 9:34419208-34419230 GTGTGTGGTGGGCAGTGGGGAGG + Intronic
1053379315 9:37636076-37636098 GTATATCGAGGGCGGCTGGGCGG - Intronic
1053475519 9:38379435-38379457 GTGTGTGGGGGGTGGGGGGGAGG + Intergenic
1053874974 9:42534861-42534883 GTCTGGGGCGGGGGGTGGGGGGG + Intergenic
1054246889 9:62675590-62675612 GTGTGTGGGGGGGGGGGGGGTGG + Intergenic
1055406280 9:75977376-75977398 ATATGTGGCGGGTGGGGGGCGGG - Intronic
1056038530 9:82635572-82635594 GTGTGTGGCGGCGGGGGGGGGGG + Intergenic
1056585335 9:87924274-87924296 GTAGGTGGGGGGCGGGGGGCTGG + Intergenic
1056611546 9:88128666-88128688 GTAGGTGGGGGGCGGGGGGCTGG - Intergenic
1057054180 9:91949084-91949106 GTAGGAGGCTGGCGGCGGGAGGG - Intronic
1058739981 9:107933353-107933375 GAATGTGGGGGGCGGGGTGGGGG - Intergenic
1059043702 9:110841980-110842002 GTATGTTGCGGGGTGGGGGGCGG - Intergenic
1059795335 9:117688748-117688770 GTGTGTGGCGGGGGTGGGGGGGG - Intergenic
1060520041 9:124289172-124289194 GTGTGTGGCGGGGGGGGGCGGGG - Intronic
1060682506 9:125577696-125577718 GGATGGGGCGGCCGGCCGGGTGG - Intronic
1060855799 9:126914557-126914579 GGGCGTGGCGGGCGGCGGGCCGG + Intergenic
1061015240 9:127977550-127977572 GTCTTTGGTGGGCGGTGGGGTGG - Intronic
1061251163 9:129427327-129427349 GAGACTGGCGGGCGGCGGGGGGG + Intergenic
1061261384 9:129482673-129482695 GGGAGAGGCGGGCGGCGGGGAGG + Intergenic
1061299894 9:129698249-129698271 GGATGGGGCGGGGGGGGGGGGGG + Intronic
1062008813 9:134256180-134256202 GTAGGGGTTGGGCGGCGGGGGGG + Intergenic
1062342399 9:136099622-136099644 GTGTGTGCGGGGCGGCGGGTGGG + Intergenic
1062342445 9:136099738-136099760 GTGTGTGCGGGTCGGCGGGGGGG + Intergenic
1062476891 9:136732752-136732774 GGGTGTGGCGGGGGGTGGGGGGG - Intergenic
1062577480 9:137215386-137215408 GTCTGGGGAGGACGGCGGGGTGG - Exonic
1062686063 9:137814065-137814087 TTGTGGGGCGGGGGGCGGGGGGG - Intronic
1185742860 X:2547758-2547780 GTATGTGGGGGGTGGGGTGGGGG + Intergenic
1186442786 X:9600457-9600479 GAATTTGGTGGGCGGGGGGGGGG + Intronic
1186730411 X:12403551-12403573 GTTTGTGGTGGGCGGCGGGCAGG - Intronic
1186808234 X:13161486-13161508 GTGTGTGGCGGGTGGGGGGGTGG + Intergenic
1187502450 X:19851031-19851053 GAATGGGGCGGGGGGCAGGGTGG + Intronic
1189309542 X:40009843-40009865 GTGTGTTGGGGGCGGTGGGGTGG - Intergenic
1189310474 X:40014295-40014317 GTAGGCGAGGGGCGGCGGGGTGG - Intergenic
1189658978 X:43277863-43277885 GACTGGGGCGGGCGGCGGAGGGG + Intergenic
1190957264 X:55207926-55207948 GCAGGGGGCGGGGGGCGGGGGGG + Intronic
1191010015 X:55748976-55748998 GGATGGGGCGGCCGGCCGGGCGG - Intronic
1192317589 X:70065300-70065322 GCCTGTTGCGGGTGGCGGGGTGG + Intergenic
1193123987 X:77851895-77851917 TCAGGGGGCGGGCGGCGGGGCGG - Intronic
1193148935 X:78104907-78104929 TTTAGTGGCGGGGGGCGGGGGGG - Intronic
1193782605 X:85722220-85722242 TTAGGTGGCCGGGGGCGGGGGGG - Intergenic
1195086108 X:101416157-101416179 GGACGAGGCGGGGGGCGGGGGGG - Intergenic
1195113019 X:101666144-101666166 GTGGGTGGCGGGCGGTGGGGCGG + Intergenic
1196005776 X:110835599-110835621 GCATGTGTCGGGGGGTGGGGGGG + Intergenic
1197147337 X:123184782-123184804 GTGCGGGGCGGGGGGCGGGGCGG + Intronic
1197279500 X:124518397-124518419 GTTTGTTGGGGGCGGAGGGGTGG + Intronic
1197754444 X:129984125-129984147 GGCTCCGGCGGGCGGCGGGGCGG + Intronic
1198001541 X:132443989-132444011 GTAGGTGGGGGGGGGGGGGGGGG - Intronic
1198435506 X:136613102-136613124 GTGTGTGTTGGGGGGCGGGGGGG + Intergenic
1198683174 X:139203492-139203514 GGAGGTGTCGGGTGGCGGGGGGG + Intronic
1198972118 X:142293441-142293463 GTGTGTGGGGGGGGGCCGGGGGG + Intergenic
1200135304 X:153871863-153871885 GAAGGTGGCGGGGGGAGGGGGGG - Intronic