ID: 917956511

View in Genome Browser
Species Human (GRCh38)
Location 1:180104793-180104815
Sequence CTGAAATAGCTTTAAGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917956511_917956515 21 Left 917956511 1:180104793-180104815 CCTTGCACTTAAAGCTATTTCAG 0: 1
1: 0
2: 0
3: 11
4: 156
Right 917956515 1:180104837-180104859 ACCTGATACAGCATTCTTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917956511 Original CRISPR CTGAAATAGCTTTAAGTGCA AGG (reversed) Intronic
901256083 1:7827724-7827746 CTGAAGTAAGTTTAACTGCAAGG - Exonic
902915910 1:19639251-19639273 CTGAAATAGCTTTCATTTTATGG + Intronic
905275100 1:36812374-36812396 CTGAAAAAGGTCTAAGTGCTTGG + Intronic
905292620 1:36932870-36932892 TTGAAATAGATTTATGTGCCAGG - Intronic
909092895 1:71248530-71248552 CAGAAGTATATTTAAGTGCATGG + Intergenic
912053041 1:105555406-105555428 CTGAAAGATCTTTAATTGTAGGG - Intergenic
914725743 1:150326046-150326068 CTGAACTACCTCTAAGTTCATGG + Intronic
915771070 1:158424789-158424811 TTGAAATAGCTTTATCTGGAAGG - Intergenic
917170525 1:172168163-172168185 GTGCAATAGCTTTCAGTGCTAGG + Intronic
917956511 1:180104793-180104815 CTGAAATAGCTTTAAGTGCAAGG - Intronic
919418960 1:197347337-197347359 CAGATATAGCTGTAACTGCACGG + Exonic
923299385 1:232627642-232627664 CTCAAAGAGCTTTAATTGTATGG - Intergenic
924605798 1:245533855-245533877 ATTCAATGGCTTTAAGTGCAGGG - Intronic
1063801168 10:9579904-9579926 CTGAAATATGTTCTAGTGCAGGG + Intergenic
1064246571 10:13672558-13672580 CTCAAATACCTTCAAGTGGATGG - Intronic
1066058231 10:31700699-31700721 CTGAAATAGCTTTAGGGCCTGGG + Intergenic
1066692888 10:38048644-38048666 ATGAAATAGCTTTCAGAGCCAGG + Intronic
1068018324 10:51545932-51545954 CTGAACTAGCTTTAGCTGCATGG + Intronic
1071002735 10:80849025-80849047 ATGAATTGGCTGTAAGTGCATGG - Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1076572520 10:131441854-131441876 AGGAAAGAGCTTTAATTGCATGG + Intergenic
1077728309 11:4699975-4699997 ATAAAATACCTTTATGTGCAAGG - Intergenic
1078134048 11:8637744-8637766 CTGACAGAGCTTCAAGTCCAGGG + Intronic
1078847396 11:15131804-15131826 CTAAAATAGCTTAAAGTTAAAGG - Intronic
1078999252 11:16737663-16737685 AATAAATAGCTTTAAATGCAGGG + Intronic
1079084548 11:17435939-17435961 CTGGTATTGCTTTGAGTGCAGGG - Intronic
1088908690 11:114174048-114174070 CTATAATAGCTTTAAGTGCTGGG + Intronic
1092484007 12:8885790-8885812 CTGAAATTGCTTTTTGCGCATGG + Intronic
1093493331 12:19728406-19728428 CTACAATAGCATTAAGTACATGG - Intergenic
1093577950 12:20756329-20756351 TTAAAATAGCTTTATGTGTAAGG + Intergenic
1095247270 12:39937504-39937526 TTGAAATAGCATGAAGTCCAGGG - Intronic
1095300476 12:40578697-40578719 CTGAAATAGGTTCAAATACAGGG - Intergenic
1096343476 12:50824087-50824109 CTAAAATTGTTTTAAGTCCAAGG + Intergenic
1097815518 12:64069214-64069236 CTCAAATATCTTTAAGGGCCAGG - Intronic
1097961855 12:65539515-65539537 CTGAAAAAACATTAAGTGCCAGG + Intergenic
1098069486 12:66656770-66656792 CTGAAATACCTTCAAGAGCCAGG - Intronic
1098216449 12:68225365-68225387 CTGAAAAAAATTTAAATGCAGGG + Intronic
1099345955 12:81500001-81500023 CTGAAGTAGTTGTCAGTGCATGG - Intronic
1099603543 12:84772157-84772179 TTGCAATAGTTTTAATTGCAAGG + Intergenic
1099959877 12:89386736-89386758 CTGAAAGAGCATTAAGTTCTTGG - Intergenic
1100655892 12:96644987-96645009 TTGATCTAGCTTTCAGTGCAAGG + Intronic
1101055072 12:100904064-100904086 CTGAAAGGTCTTTAAGGGCAGGG + Intronic
1106263236 13:28087192-28087214 CTGAAGTAGCTTTGACTACAAGG + Intronic
1107837840 13:44426080-44426102 CTAAAATAGCGCTAAGAGCATGG + Intergenic
1109633316 13:65081419-65081441 TGGGAATAGCTTTAAGTGGATGG + Intergenic
1109988284 13:70018391-70018413 CTGAATTAACTCTAAGGGCAAGG - Intronic
1110361865 13:74635089-74635111 CTGAAATAGCTATTAGTTCCAGG - Intergenic
1110842670 13:80160360-80160382 CTGAAATCCCTTTAACTCCATGG - Intergenic
1115334591 14:32232137-32232159 CTTATATAGCATTAAGTGCCAGG - Intergenic
1116437450 14:44911307-44911329 CGTAATTAGCTTTAAGGGCAGGG + Intergenic
1117327827 14:54685037-54685059 CTGAAAAAGATTTAGGTGAATGG + Intronic
1120052072 14:79878259-79878281 CTGAAATCTCTTTAAGGACAAGG + Intergenic
1122403605 14:101482450-101482472 CTGAAATATCTTTAATTTTATGG - Intergenic
1124111008 15:26787355-26787377 CTAAAATAGCTTTAGGTTAAAGG - Intronic
1124830179 15:33141303-33141325 CTGAAATAGATTTTTGTGCATGG + Intronic
1125172611 15:36783164-36783186 CTAAAATAGGTTTAAGTGTGGGG + Intronic
1129949155 15:79570890-79570912 CTGATATCGCTTTAGGTGAACGG - Intergenic
1131552267 15:93367252-93367274 CAGAAATGTCTTTAAGTGCTGGG - Intergenic
1134481939 16:14627310-14627332 CTGAAATAGCAAAAAGTCCATGG + Exonic
1136910164 16:34138546-34138568 CTTAGATGGCTGTAAGTGCAGGG - Intergenic
1140194766 16:72847116-72847138 CTGAAATACATTTAGGTGCAGGG - Intronic
1142731105 17:1858306-1858328 CTGGTATTGCTTTGAGTGCAGGG - Intronic
1143076693 17:4350082-4350104 CTGAAAAAGTTTTAAGCGCTGGG - Intronic
1143934777 17:10472142-10472164 CTGAAATTGCCATAAGGGCAGGG - Intergenic
1144720831 17:17468773-17468795 CAGAGATTGCTTTAACTGCAGGG - Intergenic
1148919076 17:51013341-51013363 CTGAAGTTCCTTTCAGTGCAAGG - Intronic
1154203553 18:12318017-12318039 CTGAGCTAGCTGTAAGTGGACGG - Intronic
1158760890 18:60385322-60385344 CTCAAATTACTTCAAGTGCAAGG + Intergenic
1159471742 18:68866738-68866760 CTGGTATTGCTTTGAGTGCACGG + Intronic
1163709252 19:18836009-18836031 CTGAACCAGCTCTGAGTGCAGGG - Intronic
1165640752 19:37383850-37383872 TTAAAATAACTTTAAGTGTAGGG + Intronic
1165834902 19:38748356-38748378 CTGAAGTAGCTTAAAATGAAAGG + Intronic
1167025504 19:46914036-46914058 AGGAAATAACTTTAAGTGCTTGG - Intergenic
1202641461 1_KI270706v1_random:93447-93469 ATGAAATAGCTGGAAGTACAAGG + Intergenic
927918799 2:26955283-26955305 CTTAAATAGCTTTAAGGTAATGG - Intergenic
928283590 2:29969988-29970010 CTGAAATGACTTTAAATCCAGGG - Intergenic
929735104 2:44539403-44539425 CTGAAATACTTTTAAGTAAAGGG - Intronic
931892008 2:66683620-66683642 CTGAAAGAGCTCTAACTGCTGGG + Intergenic
935069411 2:99680880-99680902 CTGGTATAGCTTAAAGTGCATGG - Intronic
937839287 2:126509641-126509663 CTGAAATGGCTATAAGAGAATGG - Intergenic
938998411 2:136705214-136705236 CTTAAACACTTTTAAGTGCATGG + Intergenic
941411606 2:165163627-165163649 CTGAAATTGTTTTCAGTGCTCGG + Exonic
941440151 2:165524832-165524854 CCTAAATATCTTTAAGTGGATGG - Intronic
941464851 2:165813895-165813917 CAGAAATAGCTCTGAGTGCTAGG - Intergenic
941873279 2:170407867-170407889 TTGCAAAAGCTTTAAGAGCAGGG - Intronic
942761871 2:179408864-179408886 CTTAAATAGCCTTAATGGCATGG - Intergenic
945522681 2:210847880-210847902 CTAAACTACCTTAAAGTGCATGG - Intergenic
945785584 2:214232098-214232120 CAAAAATAGCTGTTAGTGCAGGG - Intronic
947139216 2:227005738-227005760 CTCAATTATTTTTAAGTGCACGG + Exonic
1168935010 20:1657563-1657585 CTGAAATTGCTGCAAGTCCAGGG + Intronic
1172351916 20:34249725-34249747 TTTAAATGGCTTTCAGTGCAGGG - Intronic
1175867880 20:62191030-62191052 CATAAATATCTTAAAGTGCATGG + Intronic
1177868096 21:26537008-26537030 ATGGAAAAGCATTAAGTGCAGGG + Intronic
1181170713 22:21008164-21008186 CTGAGATAGCTTTAGGTGTCTGG - Intergenic
1181949913 22:26546414-26546436 CTGGAAGAGCTTCAAGTGCCTGG - Intronic
1184305381 22:43596944-43596966 ATGAATTTGCTGTAAGTGCATGG - Intronic
1184790972 22:46699731-46699753 ATGAAATATCTTTAACTGAAAGG + Intronic
953170102 3:40499387-40499409 CTGAAATAGCCTTAAGTCCTAGG - Intergenic
955251970 3:57292274-57292296 CTGAATAAGCTTTAAGTCAATGG - Intronic
956748611 3:72329177-72329199 ATAAAATAGCTTTAGTTGCAAGG + Intergenic
958125953 3:89355158-89355180 AGGAAATAGCTTTAAAGGCAAGG + Intronic
959979562 3:112500433-112500455 CTTCAATAGTTTTAAGTTCAAGG + Intergenic
963309890 3:143698569-143698591 ATAACATAGCTTTAAGTGTAGGG - Intronic
964056435 3:152466046-152466068 TTGAAATAGTTTTAAGTGTCAGG + Intergenic
966029262 3:175324699-175324721 CTGTAATAACTTTAAGTCCAGGG + Intronic
969038880 4:4278061-4278083 TTGAAATTGCTTCAACTGCAGGG - Intronic
969197417 4:5573968-5573990 CTGCAATAACTTTCAGAGCAAGG - Intronic
971717425 4:30197040-30197062 CTGAAATAACTTTAAAATCAAGG + Intergenic
971782946 4:31061562-31061584 CAGAAATCAATTTAAGTGCATGG - Intronic
974865962 4:67581016-67581038 TTGAATTAGCTTTTAGTGCAAGG + Intronic
978699072 4:111621138-111621160 CTAAACTAGCTTTAAATGCAAGG - Intergenic
978774166 4:112489337-112489359 ATGAAATAATTTTAAGTACAAGG + Intergenic
980628098 4:135401654-135401676 CTGACCTAGTTTTTAGTGCAAGG + Intergenic
980962406 4:139488642-139488664 AGGAGATAGCTTTCAGTGCATGG - Intergenic
982800429 4:159698722-159698744 ATCAATTAGCTATAAGTGCATGG + Intergenic
984061940 4:175000167-175000189 ATCAAATAGTTGTAAGTGCATGG + Intergenic
984233378 4:177127560-177127582 CAGAAATACCTTTAATTACATGG - Intergenic
987562664 5:19543793-19543815 CTGAAATTTCCTTAAGAGCAGGG - Intronic
987691876 5:21277620-21277642 TTAAAATAGCTTTAAGAGAATGG + Intergenic
988358571 5:30207071-30207093 CTCCAATGGCTTTAATTGCAGGG - Intergenic
989238765 5:39179777-39179799 AAGTAAAAGCTTTAAGTGCAGGG - Intronic
990631518 5:57675530-57675552 CTGAAATTGCTAGAAGTGGAGGG - Intergenic
991077857 5:62562071-62562093 TTGAAATTTCTTTTAGTGCATGG + Intronic
993754582 5:91712351-91712373 CTGGAACATCTTTAAGTACAGGG - Intergenic
995404641 5:111781011-111781033 CTTAAAAAACTTTAAGTTCAAGG + Intronic
997823784 5:137088682-137088704 CTCAAATCTCTTTAAGGGCAGGG - Intronic
1003033368 6:2621969-2621991 CTGAACTATTTTTAAGTGTACGG + Exonic
1003465614 6:6377160-6377182 CTGAAATAGATTTATGTGTCTGG + Intergenic
1007859502 6:44892882-44892904 CTGAAAGAGATTTTAGTGGAAGG - Intronic
1008322514 6:50134235-50134257 TGGATATAGCTTTAAGTGCAAGG + Intergenic
1012853808 6:104477243-104477265 CTGAAAAAACTTTAACTGAATGG - Intergenic
1015040593 6:128713357-128713379 ATTTAATAGCTTTAAATGCATGG - Intergenic
1015148244 6:130011333-130011355 CTGAAATAGAACCAAGTGCAAGG + Intergenic
1015657618 6:135537329-135537351 ATGAGATAACTTTAAGTGGAGGG + Intergenic
1016030908 6:139336878-139336900 CTCTAATAGCTTTAATTACAAGG - Intergenic
1016484247 6:144518314-144518336 CAGAAAAAGCTTTAAATGCAAGG + Intronic
1017530660 6:155289084-155289106 CTAAAATAATTTTAAGTACAAGG + Intronic
1020645889 7:10813440-10813462 ATGAAACAGCTTTGATTGCATGG - Intergenic
1024257107 7:47547424-47547446 CTGAAATTGCTGAAATTGCAGGG + Intronic
1027704871 7:81517588-81517610 GTGAAACAGCTTTGAGAGCATGG - Intergenic
1027822092 7:83059894-83059916 CTGAAGTAGTTTGTAGTGCAAGG + Intronic
1028240882 7:88418964-88418986 GTCCAATAGATTTAAGTGCAAGG + Intergenic
1033831590 7:145260620-145260642 CTCAAATAGGTTTAAGTAAATGG - Intergenic
1035833544 8:2724780-2724802 CTGAGAGAGATTTAATTGCAAGG + Intergenic
1036013934 8:4759407-4759429 CTGAAAAAATTTTAAGTTCAAGG + Intronic
1040642975 8:49362188-49362210 ATGAATTCGCTATAAGTGCATGG + Intergenic
1046587664 8:116167665-116167687 CTGAGATAGCTTTAAGATGAAGG + Intergenic
1046714646 8:117554304-117554326 CAGAAATAGATCTAAGTTCAGGG - Intergenic
1048175820 8:132151295-132151317 TGGAAATAGATTTATGTGCAAGG + Intronic
1052151921 9:25127716-25127738 CTGAAATAGCACTGAGTTCATGG + Intergenic
1053026642 9:34734855-34734877 CTGAAATACCATCAAGAGCATGG + Intergenic
1053036135 9:34827905-34827927 CAGAAAAAGCTCTAAATGCATGG - Intergenic
1053105408 9:35404140-35404162 CTTAAATATCTTTAACTGAAGGG - Exonic
1053508973 9:38670769-38670791 CTGATACAGCGTTAAGTGCTTGG - Intergenic
1055850789 9:80627207-80627229 ATGAAAAAACTTAAAGTGCAAGG + Intergenic
1055900822 9:81234736-81234758 CTAAAAAAGCTTTTAGTTCAGGG + Intergenic
1057710294 9:97435299-97435321 CTGAAATACCTATAAATTCATGG - Intronic
1188384587 X:29540541-29540563 CTGCAGTAGCTTAAACTGCATGG + Intronic
1188411671 X:29880093-29880115 CTGAAATACCTGTGAGTGGATGG - Intronic
1189250378 X:39596519-39596541 CTTAAATAGCCTTGAGAGCAGGG - Intergenic
1190373091 X:49762043-49762065 CTGAAATAGGTTTAAGTTAGTGG + Intergenic
1190540920 X:51477838-51477860 AAGAAACAGCTTTATGTGCAAGG - Intergenic
1194163468 X:90484359-90484381 CTGCTATATCTTTAAGTTCATGG + Intergenic
1194270972 X:91815333-91815355 TTGCAATAGCTTTAAATGAATGG + Intronic
1195413872 X:104599107-104599129 CTGAAATGACTTTGAGGGCAGGG + Intronic
1196608617 X:117685245-117685267 TTGAACTACCTTTAAGTACAAGG - Intergenic
1199964057 X:152804120-152804142 ATGAAATAGATTTCAGAGCAAGG - Intergenic
1200509735 Y:4062084-4062106 CTGCTATATCTTTAAGTTCATGG + Intergenic