ID: 917961045

View in Genome Browser
Species Human (GRCh38)
Location 1:180144924-180144946
Sequence GGCAATGTGCTCATTCCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917961045_917961054 17 Left 917961045 1:180144924-180144946 CCTATAGGAATGAGCACATTGCC No data
Right 917961054 1:180144964-180144986 CTGACTATAGCGACTGATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917961045 Original CRISPR GGCAATGTGCTCATTCCTAT AGG (reversed) Intergenic
No off target data available for this crispr