ID: 917961597

View in Genome Browser
Species Human (GRCh38)
Location 1:180149948-180149970
Sequence ATGTGTGTGTGGAGGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917961597_917961603 28 Left 917961597 1:180149948-180149970 CCCTTCTCCCTCCACACACACAT No data
Right 917961603 1:180149999-180150021 ACATTATTACCTTCTCTTCAGGG No data
917961597_917961602 27 Left 917961597 1:180149948-180149970 CCCTTCTCCCTCCACACACACAT No data
Right 917961602 1:180149998-180150020 AACATTATTACCTTCTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917961597 Original CRISPR ATGTGTGTGTGGAGGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr