ID: 917962346

View in Genome Browser
Species Human (GRCh38)
Location 1:180154981-180155003
Sequence CCGCGGGGCCGCGTTAGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 51}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917962346_917962358 29 Left 917962346 1:180154981-180155003 CCGGCGCTAACGCGGCCCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 917962358 1:180155033-180155055 GACGCTGCTGCAGGCGGACACGG 0: 1
1: 0
2: 2
3: 16
4: 180
917962346_917962356 23 Left 917962346 1:180154981-180155003 CCGGCGCTAACGCGGCCCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 917962356 1:180155027-180155049 CCCGCTGACGCTGCTGCAGGCGG 0: 1
1: 0
2: 1
3: 33
4: 236
917962346_917962354 20 Left 917962346 1:180154981-180155003 CCGGCGCTAACGCGGCCCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 917962354 1:180155024-180155046 CGACCCGCTGACGCTGCTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917962346 Original CRISPR CCGCGGGGCCGCGTTAGCGC CGG (reversed) Exonic