ID: 917962346

View in Genome Browser
Species Human (GRCh38)
Location 1:180154981-180155003
Sequence CCGCGGGGCCGCGTTAGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 51}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917962346_917962356 23 Left 917962346 1:180154981-180155003 CCGGCGCTAACGCGGCCCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 917962356 1:180155027-180155049 CCCGCTGACGCTGCTGCAGGCGG 0: 1
1: 0
2: 1
3: 33
4: 236
917962346_917962358 29 Left 917962346 1:180154981-180155003 CCGGCGCTAACGCGGCCCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 917962358 1:180155033-180155055 GACGCTGCTGCAGGCGGACACGG 0: 1
1: 0
2: 2
3: 16
4: 180
917962346_917962354 20 Left 917962346 1:180154981-180155003 CCGGCGCTAACGCGGCCCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 917962354 1:180155024-180155046 CGACCCGCTGACGCTGCTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917962346 Original CRISPR CCGCGGGGCCGCGTTAGCGC CGG (reversed) Exonic
900513199 1:3069864-3069886 CCGCGGAGCCGGGTGGGCGCCGG - Intronic
901512674 1:9725220-9725242 CTAGGGGGCCGCGTGAGCGCTGG + Intronic
903455431 1:23484010-23484032 CCGAGGGGCGGCGCTGGCGCGGG - Exonic
905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG + Exonic
917359311 1:174159306-174159328 CTGCGTGGCCGCGGTTGCGCCGG - Intergenic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
1062975969 10:1682956-1682978 CCGCGGTGCTGTGTTACCGCCGG - Intronic
1069761834 10:70816321-70816343 GCGCGGGGCCGCGGTGGGGCGGG + Intronic
1075738247 10:124677428-124677450 CCACGGGGCCGGGCTTGCGCAGG + Intronic
1096791393 12:54047350-54047372 CCGCGGGGCCGCTGCAGAGCCGG + Intronic
1098275685 12:68808787-68808809 CTGCGGGGCCGCTTCGGCGCGGG + Intronic
1098342958 12:69470561-69470583 CCGCGGGCCCGCGTCGGAGCTGG + Intronic
1105031495 12:132887432-132887454 CTGCGGGGCTGCGTGGGCGCGGG - Intronic
1106422574 13:29595758-29595780 CCGCTCGGCCGCGTCACCGCCGG + Intergenic
1115545455 14:34462026-34462048 CCGCGGGGCCGCATTTCCCCAGG - Intronic
1117875775 14:60249206-60249228 GCGCGGGGCCGCGCTAGAGGCGG + Intronic
1123053292 14:105557918-105557940 CCGCGGGGCTGCGCTCGGGCTGG + Intergenic
1123077868 14:105678332-105678354 CCGCGGGGCTGCGCTCGGGCTGG + Intergenic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1129827104 15:78641197-78641219 CCGCGCGGTCGAGTGAGCGCCGG + Exonic
1132893179 16:2214507-2214529 CCGCGGGGCCGCCGAAGCCCAGG + Exonic
1135607364 16:23836117-23836139 CCCCGGGGCCGCGGGACCGCGGG - Exonic
1137555042 16:49465120-49465142 CCCCGGGGCAGCCTGAGCGCGGG + Intergenic
1146008412 17:29176826-29176848 CCGCGCGGCGGCGTGAGGGCTGG - Intronic
1146008434 17:29176886-29176908 CCGCGGGGCTGCGGCTGCGCCGG - Intronic
1148744402 17:49910366-49910388 CCGCGGTGCCGCGTTTGAGCCGG + Intergenic
1149994810 17:61400844-61400866 CCGCGGGGCCTCCTCTGCGCTGG - Intronic
1152049225 17:77959215-77959237 CCGCGGGGCTCCGGTGGCGCGGG - Intergenic
1152467827 17:80475849-80475871 CCGCGGGGCCTCGCAGGCGCGGG + Intronic
1162798519 19:13098808-13098830 CCGCACGGTCGCGTTAGCGAAGG - Intergenic
1163282333 19:16325383-16325405 CCGCGGGGGCGCTGTAGGGCGGG - Exonic
1165767942 19:38362339-38362361 GCGCGGGGCAGAGTCAGCGCCGG - Intronic
1167577901 19:50326495-50326517 CCGCAGTGCCGCATTCGCGCCGG - Intronic
927945851 2:27134709-27134731 CCGCGGGGCCGCGTTTCCCGGGG + Intergenic
927964972 2:27262833-27262855 CCCCGGGACCGCGGTGGCGCCGG - Exonic
930222103 2:48755527-48755549 CCGTGGGGCCGGGGCAGCGCAGG + Exonic
933752437 2:85611703-85611725 TTGCGGGGCCGCGTCGGCGCGGG + Exonic
940009522 2:149038949-149038971 CCGCGGGGCCGCGGGGCCGCGGG + Intronic
941463062 2:165793959-165793981 CCCCTGGGCTGCGTTAGAGCAGG - Intronic
946843087 2:223837229-223837251 CCGCGGCGCCGCGTTGCCGCAGG + Intronic
1171810638 20:29742744-29742766 GCGCGGGGCCGCCTTGGTGCTGG - Intergenic
1172408144 20:34704380-34704402 CGGCGGGGCCGCGGTCGCTCCGG - Exonic
950420961 3:12899281-12899303 CCGCGGGGCCGCGTTCCCAGTGG - Exonic
963061953 3:141232536-141232558 CCACGGGGCCGCCCGAGCGCAGG + Intronic
968545149 4:1194480-1194502 AAGCCGGGCCGCGGTAGCGCAGG + Intronic
971457369 4:26857687-26857709 GCGCGGGGCTGCGGTGGCGCAGG + Intronic
999188914 5:149731917-149731939 CCGCGGGGCCGCGTGGTCGGTGG + Intronic
1003062832 6:2876089-2876111 CCGCGGGGCAGCGCGGGCGCGGG + Intergenic
1003911491 6:10747768-10747790 CCCCGGGGCCGCGGCAGGGCGGG - Exonic
1006860961 6:37171093-37171115 CGAGGGGGCCGCGTTAGGGCGGG - Intronic
1034222896 7:149459867-149459889 CCTCGGGGCCGCGTGTGTGCCGG + Intronic
1034440516 7:151083446-151083468 CCGAGGGGCCGCGATGGAGCTGG - Intronic
1039873646 8:41567510-41567532 CTGCGGGGCACCGTGAGCGCAGG + Intergenic
1053163472 9:35829254-35829276 CCGCGGGGCCTGGTTATCGCCGG + Intronic
1059176731 9:112175142-112175164 CCGCGGCGCCGCGGGAGCGCCGG - Exonic
1059191862 9:112333938-112333960 CCGCGGGGCCGCGGGAGGGCGGG - Intergenic
1062560470 9:137139385-137139407 CCGCGGGGCCGGGCGAGCGCAGG + Intronic
1185877728 X:3713669-3713691 CCCCGCGGCCGGGTTAGGGCGGG - Intergenic