ID: 917962358

View in Genome Browser
Species Human (GRCh38)
Location 1:180155033-180155055
Sequence GACGCTGCTGCAGGCGGACA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 180}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917962346_917962358 29 Left 917962346 1:180154981-180155003 CCGGCGCTAACGCGGCCCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 917962358 1:180155033-180155055 GACGCTGCTGCAGGCGGACACGG 0: 1
1: 0
2: 2
3: 16
4: 180
917962345_917962358 30 Left 917962345 1:180154980-180155002 CCCGGCGCTAACGCGGCCCCGCG 0: 1
1: 0
2: 1
3: 4
4: 50
Right 917962358 1:180155033-180155055 GACGCTGCTGCAGGCGGACACGG 0: 1
1: 0
2: 2
3: 16
4: 180
917962350_917962358 13 Left 917962350 1:180154997-180155019 CCCGCGGTCGGCGCTCTATTCGC 0: 1
1: 0
2: 0
3: 1
4: 7
Right 917962358 1:180155033-180155055 GACGCTGCTGCAGGCGGACACGG 0: 1
1: 0
2: 2
3: 16
4: 180
917962349_917962358 14 Left 917962349 1:180154996-180155018 CCCCGCGGTCGGCGCTCTATTCG 0: 1
1: 0
2: 1
3: 0
4: 7
Right 917962358 1:180155033-180155055 GACGCTGCTGCAGGCGGACACGG 0: 1
1: 0
2: 2
3: 16
4: 180
917962352_917962358 -9 Left 917962352 1:180155019-180155041 CCTTCCGACCCGCTGACGCTGCT 0: 1
1: 0
2: 0
3: 1
4: 55
Right 917962358 1:180155033-180155055 GACGCTGCTGCAGGCGGACACGG 0: 1
1: 0
2: 2
3: 16
4: 180
917962351_917962358 12 Left 917962351 1:180154998-180155020 CCGCGGTCGGCGCTCTATTCGCC 0: 1
1: 0
2: 0
3: 0
4: 10
Right 917962358 1:180155033-180155055 GACGCTGCTGCAGGCGGACACGG 0: 1
1: 0
2: 2
3: 16
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917962358 Original CRISPR GACGCTGCTGCAGGCGGACA CGG Exonic
900195842 1:1375090-1375112 GGCGCTGCGGCAGGCGGGCCCGG - Exonic
900385296 1:2407853-2407875 AACGCTGTGGCAGGTGGACATGG + Intronic
900595860 1:3479867-3479889 CACACTGCAGCAGGCGGACGTGG + Exonic
900857584 1:5198361-5198383 GAAGATGCTGCAGGTGGAGAAGG + Intergenic
902421718 1:16285987-16286009 AAGGCTGATGCAGGCGGGCAGGG - Intronic
903684423 1:25120395-25120417 GAGCCTGATGCAGGCTGACACGG - Intergenic
904355998 1:29940246-29940268 GACCCTGCTCCAGGCTGCCAAGG + Intergenic
906404584 1:45531625-45531647 AACACTGCTGCAGTCGGGCATGG + Intergenic
907268471 1:53276765-53276787 GCCGCTGCGGCAGGCGAACTGGG + Exonic
914704425 1:150159403-150159425 GAGGGTGCTGCAGGAGGTCAGGG + Exonic
915321733 1:155060287-155060309 GTCGCTGGTGCAGGCGGGCACGG - Exonic
917667311 1:177237831-177237853 GACACAGGTGCAGGCCGACAGGG + Intronic
917962358 1:180155033-180155055 GACGCTGCTGCAGGCGGACACGG + Exonic
919162849 1:193853708-193853730 GACACTGCTGCAGGCCCGCATGG + Intergenic
920104100 1:203538361-203538383 GCCTCTGCTGAAGGCGCACAGGG + Intergenic
921166947 1:212514514-212514536 GAGGCTGCTGCAGGTAGAGAGGG - Intergenic
921890406 1:220347723-220347745 GAAGTTGCTGCAGGCCCACATGG - Intergenic
922822335 1:228493205-228493227 GTCACTGCTGCAGGCGGTCTCGG + Exonic
923028907 1:230231079-230231101 GCCGCTGCTGCATGTGGACTTGG + Intronic
924598113 1:245464924-245464946 GACACTGCTGCAGGCTGCCCGGG + Intronic
1064131271 10:12712349-12712371 GGCGCTGCTGCAGGCTGGCTTGG - Intronic
1069698258 10:70403925-70403947 GAGCCTGGTGAAGGCGGACAAGG - Intergenic
1071021395 10:81061188-81061210 GATGCTGCCGGAGGCAGACATGG + Intergenic
1071492375 10:86144541-86144563 GAGGCTGATGCAGGGGGAGAGGG - Intronic
1072069106 10:91899499-91899521 GAAGTTGCTGCTGCCGGACATGG - Intergenic
1077018258 11:406433-406455 GACGCAGCTGCAGGACGACAAGG - Exonic
1077154640 11:1085858-1085880 GGCGCTGCTGTGGGCGGGCAGGG + Intergenic
1077584549 11:3440705-3440727 GACACTGCTGGAGGAGGAGAGGG - Intergenic
1078161800 11:8846522-8846544 GACGCGGCTGCTTGCGGACAGGG + Intronic
1081952196 11:47054017-47054039 GACCCTGTTGCAGCCGGGCACGG + Intronic
1084069600 11:66725767-66725789 GGCGCTGCTGGAGGCAGACTAGG + Intronic
1084241448 11:67823358-67823380 GACACTGCTGGAGGAGGAGAGGG - Intergenic
1084830991 11:71769282-71769304 GACACTGCTGGAGGAGGAGAGGG + Intergenic
1086054119 11:82627590-82627612 GGCGCTGCTGCAGGCGGTCCAGG - Intergenic
1086892187 11:92271055-92271077 GAGGCTGCTGCAGGAACACAAGG - Intergenic
1087682581 11:101233016-101233038 GGCGCTGCTGCAGGGGGTCCAGG + Intergenic
1089194870 11:116688319-116688341 GACCCTGCTGCAGGGGCACTAGG - Intergenic
1089435528 11:118462242-118462264 GAGGGTGCTGCAGCCGGGCATGG - Intronic
1091799902 12:3318329-3318351 GAGGCAGCGGGAGGCGGACATGG - Intergenic
1092285722 12:7128368-7128390 GCTGCTGCTGAAGCCGGACAAGG - Exonic
1092411702 12:8257993-8258015 GACACTGCTGGAGGAGGAGAGGG - Intergenic
1099133517 12:78864783-78864805 GCCGCTGCTGCAGGAGGAGGTGG - Exonic
1111948709 13:94692528-94692550 GAGGCTGCTGCAGACAGAAATGG + Intergenic
1113550705 13:111191066-111191088 GGCGCTGCTGCAGGGGGTCCAGG + Intronic
1118752440 14:68816737-68816759 GACGCTGCTGCAGGAGGCTGCGG + Intergenic
1122446488 14:101773373-101773395 GAGGCTGCTTCAGGTGGTCAAGG + Intronic
1122529828 14:102417908-102417930 GAGGCTGCTGCAGGAGTCCAGGG + Intronic
1122629751 14:103102191-103102213 GACGCTGCTGGTGGCCGAGAAGG + Exonic
1124239552 15:28018507-28018529 CACGCTGCTGCAGGTGGACCTGG - Exonic
1127327776 15:57912195-57912217 GACACTCCTGCAGGAGGAAAAGG - Intergenic
1129728402 15:77915737-77915759 GACTCTCCTGCAAGAGGACACGG + Intergenic
1131117570 15:89804298-89804320 GTTGCTGCTGGAGGAGGACAGGG + Exonic
1131411736 15:92213206-92213228 GGCGCTGCTGCAGGGGGTCCAGG - Intergenic
1132622718 16:875335-875357 GGCCCTGGTGCAGGCAGACAGGG - Intronic
1132756158 16:1486467-1486489 GACCCAGCTGCAGAAGGACAGGG + Exonic
1132945298 16:2528882-2528904 GACTCTGCAGCAGGCTAACAAGG - Intronic
1133352943 16:5114299-5114321 GACACTGCTGGAGGAGGAGAGGG - Intergenic
1133765134 16:8832618-8832640 GAGGCTCCTGCAGCCGGCCAGGG - Intronic
1134490612 16:14693210-14693232 GAGGCTGCAGCGGGCAGACAGGG - Intronic
1134495993 16:14732327-14732349 GAGGCTGCAGCGGGCAGACAGGG - Intronic
1134678432 16:16106837-16106859 GAAGCTGATGGAGGCTGACAAGG + Exonic
1135374665 16:21935044-21935066 GAGGCTGCAGCGGGCAGACAGGG - Intergenic
1136154803 16:28375479-28375501 GAGGCTGCAGCGGGCAGACAGGG + Intergenic
1136208289 16:28739779-28739801 GAGGCTGCAGCGGGCAGACAGGG - Intergenic
1136264374 16:29106416-29106438 GAGGCTGCAGCGGGCAGACAGGG - Intergenic
1138494073 16:57396579-57396601 GGCGCTGCTGCAGGGGGTCCAGG + Intergenic
1139849035 16:69939758-69939780 GGCCCTGCTGCAGGCAGGCATGG + Intronic
1142154451 16:88526825-88526847 GACCCTGCTGCTGGTGGACGAGG + Exonic
1142209539 16:88802295-88802317 GACGCGGGTGGAGGCGGCCAGGG - Intergenic
1143464783 17:7129466-7129488 GGCGCTGCTGCAGGTGGTCTTGG - Intergenic
1143519412 17:7437119-7437141 GCCGCTGCTGCAGGCGCACGCGG + Exonic
1145804853 17:27719323-27719345 GGCGCTGCTGCAGGGGGTCCAGG - Intergenic
1146440065 17:32886042-32886064 GATTCTGCTGCAGGTGGACAGGG + Intergenic
1146530500 17:33604082-33604104 GTCTCTGCTGCAGGCTGAAAGGG + Intronic
1146789114 17:35741695-35741717 GACGCTGGGGTGGGCGGACACGG - Exonic
1146823338 17:36001952-36001974 GAGGCTGCTGCAGACTGATATGG - Exonic
1149607553 17:57935735-57935757 GAGGCTGCTCCAGGCGGGCCTGG - Intronic
1151275170 17:73028825-73028847 AACACTGCTGCAGCCGGGCACGG + Intronic
1155152774 18:23135788-23135810 GCCGCTGCTGCAGGCGGCCGTGG - Exonic
1156859630 18:41820596-41820618 GCCGCTGCTGCAGGCATACTAGG + Intergenic
1160191798 18:76720834-76720856 GAAGCTGCTGAATGAGGACAGGG + Intergenic
1161333558 19:3699504-3699526 GACGCTGCTGCTGGCTGCCTGGG + Intronic
1162474928 19:10894134-10894156 GAAGCTGATGCATGCGGACCAGG - Intronic
1163777824 19:19228242-19228264 GACCCTGGAGCAGGGGGACAAGG + Exonic
1166807998 19:45498481-45498503 GACGCTGCAGCTGGCGGGCCAGG - Exonic
1167432393 19:49461955-49461977 GCTGCTGCTGCTGACGGACACGG + Exonic
1167531795 19:50022360-50022382 GAGGCTGCTGCAGTAGCACAAGG - Intronic
1168594467 19:57664327-57664349 GACGCTGCTGGCGGCGGGCGAGG + Intergenic
925905172 2:8535853-8535875 AACTCTGCTGCAGGTGGTCACGG + Intergenic
927970656 2:27304350-27304372 GAGGCTGAGGCAGGAGGACAAGG + Intronic
929107321 2:38377473-38377495 GACGGATCTGCAGGCGGGCAGGG - Intergenic
931791319 2:65666608-65666630 GAAGCTGGTGGAGGGGGACATGG - Intergenic
932283962 2:70517399-70517421 GACCCTGGAGCAGGAGGACAGGG + Intronic
932409785 2:71538849-71538871 GACGCATCTGCAGGCTGACAGGG - Intronic
934719547 2:96564111-96564133 GACCCTGCTTCAGAGGGACAGGG - Intergenic
936521195 2:113213020-113213042 GAAGCTGGAGCAGGCAGACAGGG - Intergenic
937884507 2:126890664-126890686 GTCGCTCCTGCAGGCAAACAAGG - Intergenic
946166747 2:217869170-217869192 GCCTCTGCTGCAGGAAGACAGGG + Intronic
946400775 2:219467301-219467323 CAGGCTGCAGCAGGCGGCCACGG - Exonic
948644770 2:239397604-239397626 GAGGCTGCAGCAAGGGGACATGG + Intronic
1172509617 20:35491253-35491275 GACACTGCTGCAGACGCAGAAGG + Exonic
1173054620 20:39599048-39599070 GAAGCTCCTGCAGGTGAACAGGG + Intergenic
1173221771 20:41137505-41137527 GCGGCTCCTGCAGGCGGACACGG - Exonic
1173813588 20:45971288-45971310 GTCGCTGCTGTCGGCGGACACGG + Exonic
1175802641 20:61809930-61809952 GAGGCTGTTGCAGGCAGTCAGGG + Intronic
1175910044 20:62400771-62400793 GACGCTGCTGCCGGCTGGCCTGG + Intronic
1176021720 20:62965555-62965577 GGCCCTGCTGCAGGCGGGCTGGG + Intronic
1178840611 21:36135191-36135213 CACGCGGCTGCAGGACGACATGG - Exonic
1179931480 21:44573757-44573779 GTCGCTGGAGCAGACGGACATGG - Exonic
1179934269 21:44592449-44592471 GTCGCTGGAGCAGACGGACATGG + Exonic
1179948599 21:44697200-44697222 GTCGCTGGAGCAGACGGACATGG - Exonic
1180183554 21:46128609-46128631 GACGCAGCTGAAGGCAGTCAGGG + Intronic
1180875976 22:19175464-19175486 GACACTGCAGTAGGGGGACAGGG - Intergenic
1184398639 22:44260756-44260778 TTTGCTGCTGCAGGCTGACATGG + Intronic
1184715494 22:46279591-46279613 GAGGATGCTGCAGGCCGACTAGG - Intronic
951422972 3:22509818-22509840 GTTGCTGCTGCAGGCGGATGAGG - Intergenic
951756937 3:26101428-26101450 GAGGTTGCTGCAGGCCCACAGGG - Intergenic
952945341 3:38475128-38475150 GGTGCTGCTGCAGGCAGACAGGG + Intronic
953387687 3:42515717-42515739 GACGCAGCTCCAGACAGACATGG - Intronic
953404363 3:42653336-42653358 GATACTGCTGCAGCTGGACATGG + Intergenic
953800756 3:46020905-46020927 GGCGCAGGTGCAGGTGGACAGGG - Exonic
955328443 3:58027376-58027398 GAGGCTGAGGCAGGCGGACCGGG - Intronic
956368359 3:68531219-68531241 GAGGCTGCTGCAGACCCACATGG - Intronic
957056923 3:75450266-75450288 GACACTGCTGGAGGAGGAGAGGG - Intergenic
958168910 3:89914574-89914596 GATGCTGCTGCAGGCCCACAGGG - Intergenic
961296547 3:125889450-125889472 GACACTGCTGGAGGAGGAGAGGG + Intergenic
961417655 3:126772333-126772355 GAGGCTGAAGCAGGCGGACGAGG - Intronic
964505580 3:157395373-157395395 GTCTCTGCTGCTGGCAGACAGGG + Intronic
968489938 4:884536-884558 GACGCCGCTGGAGGCAGAGAGGG + Intronic
968999739 4:3970551-3970573 GACACTGCTGGAGGAGGAGAGGG - Intergenic
969288414 4:6222468-6222490 GCCGCTGCTCCGGGCGGACGGGG + Intergenic
969619326 4:8271021-8271043 GACTCTGCTGTGGCCGGACAGGG + Intronic
969754271 4:9138084-9138106 GACACTGCTGGAGGAGGAGAGGG + Intergenic
969814166 4:9674360-9674382 GACACTGCTGGAGGAGGAGAGGG + Intergenic
977884924 4:102243726-102243748 GGCGCTGCTGCAGGGGGTCTGGG - Intergenic
979228376 4:118318311-118318333 GAAGCTGTGGCAGGCCGACATGG + Intronic
982548560 4:156766466-156766488 GATGCTGCTGGAGGAGGAGATGG - Intronic
984063347 4:175019553-175019575 GCCGCTGCTGCAGGAGGAGGTGG - Intergenic
986297146 5:6448980-6449002 GAAGCTGCACCAGGTGGACAAGG + Exonic
986408681 5:7453472-7453494 GAGGCTGCTGCAGACACACAGGG - Intronic
989178820 5:38556511-38556533 GAGGCTGCTTGAGGCGGCCACGG + Intronic
992494593 5:77280339-77280361 CACCCTCCTGCAGGAGGACAGGG - Intronic
995707167 5:114998028-114998050 GACACTGCTGCAGGGGGTCCAGG - Intergenic
998713118 5:144849153-144849175 GGCGCTGCTGCAGGGGGTCCAGG + Intergenic
999398251 5:151244551-151244573 GGCTCTGCTCCAGGTGGACATGG - Intronic
1001774168 5:174316202-174316224 GCCCCTGCTGCAGCTGGACATGG + Intergenic
1001881296 5:175246527-175246549 GATGCTCCTGCAGGCTGGCAAGG + Intergenic
1005279880 6:24262125-24262147 GAGGCTGCTGCTGGGGGACGGGG - Intronic
1006022282 6:31124326-31124348 CTGCCTGCTGCAGGCGGACACGG + Intronic
1006209383 6:32382437-32382459 GAGGCTGAAGCAGGAGGACAAGG - Intergenic
1006891513 6:37433241-37433263 GACGGTGCGGCTGGCGGACCCGG + Exonic
1007553162 6:42745701-42745723 GGCGCGGCTGCAGGCGGCCTTGG - Exonic
1009305446 6:62083584-62083606 GACTCTGTTGCAGGCCCACATGG + Intronic
1011413263 6:87088201-87088223 GGCGCTCCTGCAGACAGACATGG + Exonic
1014515424 6:122372287-122372309 GAAGCTGCCACAGGAGGACAGGG - Intergenic
1017146771 6:151241251-151241273 GCCGCTGCCGCAGGAGGACTGGG - Intronic
1020781263 7:12519127-12519149 GACCATACTGCAGGGGGACAGGG + Intergenic
1022106237 7:27199754-27199776 GGCGCTGCTGTAGGCGGACGCGG + Exonic
1023862708 7:44225679-44225701 GGGGCTGCTGCAGGCGGCCAGGG - Intronic
1023939472 7:44760483-44760505 GACGCTGCTGCTTGGGGTCATGG - Exonic
1025798122 7:64758784-64758806 GGCGCTGCTGCAGGGGGTCCAGG + Intergenic
1027791775 7:82644185-82644207 GGCGCTGCTGCAGGGGGTCCAGG - Intergenic
1035278115 7:157760047-157760069 GAGGGTGCTGCAGGCCGCCAGGG + Intronic
1035749579 8:1986933-1986955 GAGGCTGATGCAGGAGGACCAGG + Intronic
1035829846 8:2683595-2683617 GACGCCACTGCAGGTAGACAAGG - Intergenic
1035923296 8:3701428-3701450 GAAGCTGCTGCTGGCGGTTATGG + Intronic
1036377492 8:8213408-8213430 GACACTGCTGGAGGAGGAGAGGG + Intergenic
1036873433 8:12452262-12452284 GACACTGCTGGAGGAGGAGAGGG - Intergenic
1037678221 8:21070802-21070824 GAGGCTGCTGCTGGGGGAAAGGG + Intergenic
1038430217 8:27493992-27494014 GGCGCTGCTGCAGGGGGTCCAGG + Intronic
1038900831 8:31841918-31841940 GAAGCTTCTGCAGGAGAACATGG - Intronic
1039640912 8:39219613-39219635 GAAGCTGCTGCTGGGGGATAAGG + Intronic
1039959204 8:42232778-42232800 GAGGTTGCTGCAGACGGGCATGG - Intergenic
1040342411 8:46447602-46447624 GACGTTGATGCAGGCAGAAAGGG - Intergenic
1041648964 8:60282106-60282128 GGCGCTGCTGCAGGCTCACCTGG + Intergenic
1043847309 8:85177609-85177631 GTCGCTGCTGCAGGAGGCCAAGG + Exonic
1044004798 8:86927320-86927342 GGCGCTGCTGCAGGGGGTCCAGG + Intronic
1045327466 8:101127428-101127450 GGCGCTGCAGCAGATGGACAGGG + Intergenic
1047961704 8:130016197-130016219 GGCGCTGCGGCGGGTGGACAGGG - Intronic
1049337817 8:142095877-142095899 GACGGGGCTGCAGGAGGGCAGGG + Intergenic
1049681926 8:143922878-143922900 GCGGCGGCTGCAGGAGGACAAGG - Exonic
1049724214 8:144138021-144138043 GGCGCTGCTGCAGGCGCTGATGG + Exonic
1049801521 8:144519941-144519963 GCCGCTCCTGCAGGAGGGCACGG - Exonic
1049896165 9:113617-113639 GACGCCGCTGCCGGCGGAACCGG - Intergenic
1052355769 9:27503510-27503532 GAGGCTGCTGCTGACGGAGAAGG - Intronic
1052610961 9:30773583-30773605 GAAGCTGCTGGAGTGGGACACGG - Intergenic
1056392044 9:86149572-86149594 GGCGCTGCTGCAGGGGGTCCAGG + Intergenic
1057251273 9:93504821-93504843 GCCTCTGCTGCTGCCGGACACGG + Intronic
1059268336 9:113056668-113056690 GACGCCGCTGGAGACCGACATGG + Exonic
1061117639 9:128624716-128624738 AACGCTGCTGCACGCAGAGATGG + Intronic
1061747300 9:132749861-132749883 GACGCTGCTGCAGGAGGCCATGG + Intronic
1062375876 9:136261718-136261740 GACGCTCCCCCAGGCAGACAGGG + Intergenic
1062613145 9:137383896-137383918 GACGCTGCCCCACACGGACAGGG + Intronic
1185778411 X:2824598-2824620 GACGCTGATGCTGCCGGACTAGG + Intergenic
1189095069 X:38129905-38129927 CACGCTGGTGCAGGAAGACATGG - Intronic
1190324867 X:49200165-49200187 GATGCTGCTGCTGGCGGACATGG - Exonic
1192209500 X:69118788-69118810 GCCACTGCTGCTGGTGGACAGGG + Intergenic
1201192982 Y:11464463-11464485 GACGATACTGCAGGCTGAAAAGG + Intergenic
1201911674 Y:19139153-19139175 GACACTGCTGCAGGGGGTCCAGG - Intergenic