ID: 917962358

View in Genome Browser
Species Human (GRCh38)
Location 1:180155033-180155055
Sequence GACGCTGCTGCAGGCGGACA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 180}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917962349_917962358 14 Left 917962349 1:180154996-180155018 CCCCGCGGTCGGCGCTCTATTCG 0: 1
1: 0
2: 1
3: 0
4: 7
Right 917962358 1:180155033-180155055 GACGCTGCTGCAGGCGGACACGG 0: 1
1: 0
2: 2
3: 16
4: 180
917962352_917962358 -9 Left 917962352 1:180155019-180155041 CCTTCCGACCCGCTGACGCTGCT 0: 1
1: 0
2: 0
3: 1
4: 55
Right 917962358 1:180155033-180155055 GACGCTGCTGCAGGCGGACACGG 0: 1
1: 0
2: 2
3: 16
4: 180
917962350_917962358 13 Left 917962350 1:180154997-180155019 CCCGCGGTCGGCGCTCTATTCGC 0: 1
1: 0
2: 0
3: 1
4: 7
Right 917962358 1:180155033-180155055 GACGCTGCTGCAGGCGGACACGG 0: 1
1: 0
2: 2
3: 16
4: 180
917962345_917962358 30 Left 917962345 1:180154980-180155002 CCCGGCGCTAACGCGGCCCCGCG 0: 1
1: 0
2: 1
3: 4
4: 50
Right 917962358 1:180155033-180155055 GACGCTGCTGCAGGCGGACACGG 0: 1
1: 0
2: 2
3: 16
4: 180
917962351_917962358 12 Left 917962351 1:180154998-180155020 CCGCGGTCGGCGCTCTATTCGCC 0: 1
1: 0
2: 0
3: 0
4: 10
Right 917962358 1:180155033-180155055 GACGCTGCTGCAGGCGGACACGG 0: 1
1: 0
2: 2
3: 16
4: 180
917962346_917962358 29 Left 917962346 1:180154981-180155003 CCGGCGCTAACGCGGCCCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 917962358 1:180155033-180155055 GACGCTGCTGCAGGCGGACACGG 0: 1
1: 0
2: 2
3: 16
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917962358 Original CRISPR GACGCTGCTGCAGGCGGACA CGG Exonic