ID: 917962368

View in Genome Browser
Species Human (GRCh38)
Location 1:180155086-180155108
Sequence GGCGAAGAACTCCACGGCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 50}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917962368_917962378 26 Left 917962368 1:180155086-180155108 CCTGGGCCGTGGAGTTCTTCGCC 0: 1
1: 0
2: 0
3: 7
4: 50
Right 917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 69
917962368_917962375 16 Left 917962368 1:180155086-180155108 CCTGGGCCGTGGAGTTCTTCGCC 0: 1
1: 0
2: 0
3: 7
4: 50
Right 917962375 1:180155125-180155147 GCATCGCCTTCGCCCCGACGTGG 0: 1
1: 0
2: 0
3: 0
4: 14
917962368_917962376 20 Left 917962368 1:180155086-180155108 CCTGGGCCGTGGAGTTCTTCGCC 0: 1
1: 0
2: 0
3: 7
4: 50
Right 917962376 1:180155129-180155151 CGCCTTCGCCCCGACGTGGAAGG 0: 1
1: 0
2: 0
3: 2
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917962368 Original CRISPR GGCGAAGAACTCCACGGCCC AGG (reversed) Exonic
902093340 1:13922135-13922157 GGCAGAGAAATCCAGGGCCCAGG - Intergenic
903044068 1:20552877-20552899 CGCGCAGAAGTCCACCGCCCTGG - Exonic
904091979 1:27951542-27951564 GGCAAACAAATCCAGGGCCCTGG + Intronic
905412685 1:37782631-37782653 GGCCATGCACCCCACGGCCCCGG + Intergenic
912468730 1:109892268-109892290 GGCCAAGAACTCCAGGGACCAGG + Intergenic
917962368 1:180155086-180155108 GGCGAAGAACTCCACGGCCCAGG - Exonic
920818684 1:209360029-209360051 AGCCAAGAACTCCATGGGCCTGG - Intergenic
921701637 1:218275021-218275043 GGCTGAGAAGTCCACGGCCAAGG - Intergenic
1073105742 10:101031282-101031304 GGTAAAGAACTCCGCTGCCCGGG - Exonic
1075085562 10:119412328-119412350 GGCGATGGACTGCACGGCCCGGG - Intronic
1090419493 11:126564411-126564433 GTGGCAGAACGCCACGGCCCAGG + Intronic
1091063834 11:132490410-132490432 GGTGAAGAGCTCCAGGGCTCAGG + Intronic
1100619614 12:96258640-96258662 GGAGACAAACTCCCCGGCCCAGG - Intronic
1103229932 12:119320853-119320875 GGAGAAGAAATCCACAACCCAGG - Intergenic
1117353427 14:54902346-54902368 GGTGAAGAACTGCATGGCCGAGG + Exonic
1118982005 14:70724747-70724769 GGCAAGGAACACCACGGCCCTGG + Intronic
1122532730 14:102440183-102440205 GGAGATGATCCCCACGGCCCAGG + Intronic
1127207153 15:56733188-56733210 GGCGAAGGCCTGCGCGGCCCAGG + Intronic
1135745863 16:25015509-25015531 GGCGAAGAGCTAGAAGGCCCCGG + Intronic
1142361908 16:89631295-89631317 GGCGGAGATCCCCACTGCCCGGG + Intronic
1143147367 17:4785504-4785526 GGCGAGGAACTGCAGGGGCCTGG - Exonic
1144095235 17:11894450-11894472 GGAGAGGAACTCCACGGGGCTGG - Exonic
1144762362 17:17714574-17714596 GGGGAAGAACAGCAGGGCCCGGG - Intronic
1147896983 17:43757483-43757505 GGCAGAGAAGTCCACTGCCCAGG - Intronic
1148850988 17:50555255-50555277 GGCCAAGGACACCAAGGCCCTGG + Exonic
1151249858 17:72825666-72825688 GGCGGAGATGTCCAAGGCCCTGG + Intronic
1151660749 17:75516742-75516764 GGCGAAGAGCTCCCGGGCGCTGG - Exonic
1152804628 17:82349382-82349404 TGTGCAGAGCTCCACGGCCCCGG - Intergenic
1155741094 18:29288838-29288860 GGGGAAGAACTCCACGACATTGG + Intergenic
1157191950 18:45589151-45589173 TGGGAAGAACTCCACAGTCCTGG - Intronic
1164617263 19:29674624-29674646 GGCGTAGAACTCCACGCTGCTGG - Exonic
1168724930 19:58575827-58575849 GCCAAAGAACTCCTCGACCCAGG - Intergenic
935160617 2:100526697-100526719 GGTGAAGAAATCCAGGGCCCTGG - Intergenic
935665068 2:105504045-105504067 GGCAAAGCCCTCCAAGGCCCTGG - Intergenic
948883521 2:240871943-240871965 GGAGAGAAACTCCACGGCCAGGG + Intronic
1172903389 20:38350956-38350978 GGCCAAGAGCTCCAGGGCCTGGG - Intronic
1175956858 20:62615492-62615514 GGCTACGAACTGCACGGCCCCGG + Intergenic
1181349183 22:22243326-22243348 GGCCAACAGCTCCACTGCCCAGG - Intergenic
968662842 4:1805909-1805931 GGCCAAGTACTCCATGCCCCGGG - Exonic
969277898 4:6149353-6149375 GGAGAAGAACTGCTTGGCCCAGG + Intronic
976054722 4:81050140-81050162 GGAGTAAAACTCCATGGCCCAGG + Intronic
985707755 5:1411273-1411295 GATGAAGAAGACCACGGCCCAGG + Exonic
989209609 5:38846098-38846120 GGCGAAGGGCTCCACGAGCCGGG - Exonic
1014696678 6:124629961-124629983 AGCGAAGGACTACAAGGCCCAGG + Intronic
1015830442 6:137363192-137363214 GCCGAAGATCTGCACGGCCCTGG + Intergenic
1026769753 7:73188105-73188127 GGCGATGAACTCCGTGGCCTTGG + Intergenic
1027010621 7:74741487-74741509 GGCGATGAACTCCGTGGCCTTGG + Intronic
1027077421 7:75204553-75204575 GGCGATGAACTCCGTGGCCTTGG - Intergenic
1037935978 8:22915332-22915354 AGCCAAGAACTTCATGGCCCTGG - Intronic
1043169048 8:76941182-76941204 GGCTGAGAAGTCCAAGGCCCAGG + Intergenic
1049256325 8:141615843-141615865 GGCGAATAAATCCACAGCACTGG - Intergenic
1049641985 8:143719958-143719980 GGCGCCCACCTCCACGGCCCAGG - Intronic
1053186586 9:36021701-36021723 GGCCAAGAACTCCTCTGCTCTGG - Intergenic
1056658244 9:88526332-88526354 GGAGATAAACCCCACGGCCCAGG - Intergenic
1062284995 9:135768851-135768873 GGCGAAGTCCTTCACGGCCCAGG - Exonic
1189491310 X:41473515-41473537 GGCGCAGGCCCCCACGGCCCAGG - Exonic
1195780675 X:108460361-108460383 GGCAAGGAAATCCACGGCCTAGG - Intronic
1202019962 Y:20453891-20453913 GGGGAAGAACTCCAGGACACAGG + Intergenic