ID: 917962369

View in Genome Browser
Species Human (GRCh38)
Location 1:180155092-180155114
Sequence CCAGGAGGCGAAGAACTCCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 180}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917962369_917962376 14 Left 917962369 1:180155092-180155114 CCGTGGAGTTCTTCGCCTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 180
Right 917962376 1:180155129-180155151 CGCCTTCGCCCCGACGTGGAAGG 0: 1
1: 0
2: 0
3: 2
4: 22
917962369_917962375 10 Left 917962369 1:180155092-180155114 CCGTGGAGTTCTTCGCCTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 180
Right 917962375 1:180155125-180155147 GCATCGCCTTCGCCCCGACGTGG 0: 1
1: 0
2: 0
3: 0
4: 14
917962369_917962378 20 Left 917962369 1:180155092-180155114 CCGTGGAGTTCTTCGCCTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 180
Right 917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917962369 Original CRISPR CCAGGAGGCGAAGAACTCCA CGG (reversed) Exonic
901001484 1:6150995-6151017 CCAGCAGGCCAAGAACTCTCTGG + Intronic
902471389 1:16649230-16649252 CCAGGAGGAGAAGCACTGCCGGG - Intergenic
902487420 1:16758215-16758237 CCAGGAGGAGAAGCACTGCCGGG + Intronic
902598629 1:17526036-17526058 CCAGGAGGAAAAGAACTAGAGGG + Intergenic
902873643 1:19328497-19328519 CCAGGAGTCGAAGGCCCCCAGGG + Intronic
903322696 1:22552362-22552384 CCAGGAAGCCAAGATATCCAGGG + Intergenic
903952778 1:27005825-27005847 CCAGGAGGCCCAGCACTGCAGGG - Exonic
904025997 1:27504197-27504219 CCAGGAGGAGACGAGCTGCAGGG - Intergenic
904270570 1:29347329-29347351 CCAGGAAGCTGAGTACTCCAAGG - Intergenic
906795857 1:48695946-48695968 CCAGGTGGCGCTGAACTCCCTGG - Intronic
908711341 1:67019015-67019037 ACAGTAGTCCAAGAACTCCATGG - Intronic
911792748 1:102039236-102039258 CCAGGAGGTGCAGATCACCAAGG - Intergenic
917962369 1:180155092-180155114 CCAGGAGGCGAAGAACTCCACGG - Exonic
919666129 1:200294554-200294576 TCAGGAGGTGAAGGAGTCCATGG - Intergenic
920313060 1:205059658-205059680 CCCAAAGGCGAAGCACTCCAGGG - Exonic
920435866 1:205946720-205946742 CCAGGTGGGGAAGGACTCCCAGG + Intergenic
920831775 1:209472038-209472060 TCTGGAGGCTGAGAACTCCAAGG + Intergenic
924498571 1:244614087-244614109 CAAGGAGGCTGAGAAGTCCAAGG - Intronic
924904104 1:248433408-248433430 CCATAAGCCGAAGAACTCCTGGG - Intergenic
924923791 1:248658643-248658665 CCATAAGCCGAAGAACTCCTGGG + Intergenic
1062823273 10:550593-550615 CCAGGAGGAGAAGAGCTTCTGGG - Intronic
1064394808 10:14973372-14973394 GCAAGAGGCAAAGGACTCCAGGG - Intronic
1069383836 10:67866343-67866365 CCATGAGGCAAAGAGCTGCAAGG - Intergenic
1069635402 10:69921905-69921927 CCAGGAGGCCAGGAAGCCCAGGG - Exonic
1074100965 10:110354708-110354730 CAAGCAGGCGCAGACCTCCAGGG - Intergenic
1077305193 11:1865786-1865808 CCAGGATCCGAAGGACCCCACGG - Intronic
1082786080 11:57317658-57317680 CCAGGAGTCGAAAAATCCCAGGG + Intronic
1083346703 11:61998449-61998471 CTAGGAGGAGAAGAAGGCCAGGG + Intergenic
1083707578 11:64526709-64526731 CCAGAACGCGAAGAACTCGGTGG + Intergenic
1088208145 11:107418966-107418988 CCAGGAGTCCAAGAATTCCAAGG + Intronic
1089495903 11:118908622-118908644 CCAGGAGGAGAGAAGCTCCAGGG - Exonic
1091234042 11:134007737-134007759 CCAGGAGGCGAGGATCGTCAGGG + Intergenic
1091275376 11:134346134-134346156 CCAGGAGGAAAAGAAGCCCAGGG - Intronic
1096123406 12:49103091-49103113 CCAGGAGCAGCAGAACCCCAAGG + Exonic
1096469046 12:51864834-51864856 CCGGGAGTGGAAGAGCTCCAGGG + Intergenic
1098337221 12:69416531-69416553 CCAGTAGGCAAAGAGTTCCATGG + Intergenic
1102844619 12:116166152-116166174 CCAGGAGGTGAAGAACAGCCTGG + Intronic
1105412000 13:20178139-20178161 AGAGGAGGCAAAGTACTCCAGGG - Intergenic
1106109097 13:26760967-26760989 CCAGGAGGCTGAGAACTGCATGG + Intergenic
1111636903 13:90916891-90916913 CCAGGAGGTCAAGACCACCATGG + Intergenic
1112253013 13:97801272-97801294 CTAGGAGGTGGAGATCTCCAGGG - Intergenic
1113682409 13:112253637-112253659 CCAGTTAGAGAAGAACTCCAAGG - Intergenic
1116383940 14:44307950-44307972 CAAGAAGGCGCATAACTCCAGGG - Intergenic
1118453730 14:65927027-65927049 CCATGAGTGGAAGAACACCAGGG - Intergenic
1119608917 14:76045299-76045321 GCAGGAGGAGAAGAATTCTAAGG - Intronic
1120187509 14:81409541-81409563 CCAGAATGCAAAGAACTTCATGG + Intronic
1122142650 14:99672131-99672153 CCAGGATTCTAAGAGCTCCAGGG - Intronic
1124141925 15:27084791-27084813 CCAGGAGGCCAGGGTCTCCAGGG + Intronic
1128481869 15:68046446-68046468 CCAGGAACCGAAGGGCTCCAAGG - Intergenic
1128663804 15:69523761-69523783 CCAGGAGACCAAGAAGCCCAAGG - Intergenic
1131483622 15:92802509-92802531 CCATGAAGCAAGGAACTCCAAGG - Intronic
1132032530 15:98450364-98450386 CCAGGGGGGCAAGGACTCCACGG - Intronic
1132703786 16:1232523-1232545 TCACGAGGCGGAGAACTGCACGG + Intergenic
1132707732 16:1253872-1253894 TCACGAGGCGGAGAACTGCACGG - Intergenic
1133828799 16:9302813-9302835 CCAGGAGCCAAAGAACACCTGGG + Intergenic
1133977468 16:10609614-10609636 CCAGGAGCTGAAGAAATCTACGG + Intergenic
1136274856 16:29173448-29173470 CCAGGAGGCTCAGAGCCCCAAGG + Intergenic
1137693811 16:50448000-50448022 CCAGGTGGCCAAGAAGTCCAGGG + Intergenic
1141594405 16:85088612-85088634 GGAGGAGGGGAAGGACTCCATGG + Exonic
1142051583 16:87961913-87961935 TCAGGAGGCTGAGAAGTCCAAGG - Intronic
1142079153 16:88139205-88139227 CCAGGAGGCTCAGAGCCCCAAGG + Intergenic
1142752193 17:1995595-1995617 CCAGAAGGCGTAGAACAACATGG + Intronic
1145035453 17:19537454-19537476 CGAGGAGGGGAAGACCTACAGGG + Intronic
1147574311 17:41589640-41589662 CCAGTAGGCCATGCACTCCAAGG - Intergenic
1149788482 17:59456589-59456611 TCAGGAGGCTTAGAACTCAAAGG + Intergenic
1149881780 17:60299337-60299359 TCGGGAGGCTAAGAAGTCCAAGG + Intronic
1150463461 17:65372001-65372023 CCAGGAGGCCAAGGACTGCCTGG - Intergenic
1151415062 17:73956779-73956801 CCAGGAGGCCAAGGCCTGCAGGG - Intergenic
1155361092 18:25003649-25003671 CAAGGAGCCTGAGAACTCCAAGG + Intergenic
1155707088 18:28829419-28829441 CCTGGAGGCGTAGTACTACAAGG - Intergenic
1155880340 18:31140087-31140109 CCAGCTGGCCAAGAACTCCTTGG - Exonic
1158395597 18:57076623-57076645 CCAGGAGGCCATGTACACCATGG - Intergenic
1160340368 18:78084240-78084262 TCCGGAGGTGAAGAACCCCAGGG - Intergenic
1160350176 18:78171621-78171643 GCAGCAGGTGAAGCACTCCAGGG + Intergenic
1161281175 19:3446512-3446534 CCTGGAGGTAAGGAACTCCAAGG + Intronic
1161798248 19:6400185-6400207 CCAGGAGGTGAAGCAGGCCATGG + Intergenic
1162301425 19:9847293-9847315 CCAGGAGGCGGAGGAGGCCAGGG - Intronic
1163014496 19:14445937-14445959 TCAGGAGGCTGAGGACTCCATGG + Intronic
1163226346 19:15964040-15964062 CCGTCAGGCGATGAACTCCAGGG + Intergenic
1163294143 19:16401427-16401449 CCAGGAGCAGAAGGGCTCCAGGG + Intronic
1166369725 19:42294067-42294089 CAAGAAGAGGAAGAACTCCACGG + Exonic
1166375722 19:42325844-42325866 CCAGGGGGCGAAGGGCTCTACGG - Intronic
1166931544 19:46304268-46304290 CCAGCAGGCCAGGAACTCAAAGG - Intronic
1167035544 19:46993203-46993225 CCAGGTGGTAAACAACTCCAAGG - Intronic
1167605838 19:50480929-50480951 CCAGAAGGCCAAGAACCCCCAGG + Exonic
1167622027 19:50566053-50566075 CCAGGAGGAGAGGAGCCCCAGGG + Intronic
1168048285 19:53809808-53809830 CAAGCAGCTGAAGAACTCCAAGG + Exonic
1202703787 1_KI270713v1_random:6025-6047 CCAGGAGGAGAAGCACTGCCGGG - Intergenic
925307670 2:2861728-2861750 CTAGGAGGCAAAGGACTGCAGGG - Intergenic
928308994 2:30194273-30194295 CAAGGATGCGAAGAATTCGAAGG + Intergenic
928317187 2:30255435-30255457 CCAGGAGGAAAACAAGTCCAGGG - Intronic
929575833 2:43051119-43051141 CCAGGAAGCAAAGAAGTCAAGGG - Intergenic
930398189 2:50848798-50848820 CTTGGAGGGAAAGAACTCCAGGG + Intronic
933628696 2:84632204-84632226 CCAGGATGCAAAAACCTCCAGGG - Intronic
933980812 2:87549481-87549503 TCTGGAGGCCAAGAAATCCAAGG - Intergenic
936313016 2:111401304-111401326 TCTGGAGGCCAAGAAATCCAAGG + Intergenic
937993861 2:127679044-127679066 CCCGGAGGGAAAGAGCTCCAGGG + Intronic
938571721 2:132567553-132567575 TCAGGAGGCCGAGAAATCCAAGG - Intronic
938804022 2:134789378-134789400 CCAGGTGGCGAGGGAGTCCAGGG + Intergenic
940292042 2:152086788-152086810 CCAGGAAGACAAGAAGTCCAGGG + Intronic
942215893 2:173718675-173718697 CCAGGAAGGGAAGAAGTCCTGGG + Intergenic
944127182 2:196307359-196307381 GCAGGTGGCCAAGAAGTCCAGGG - Intronic
945897849 2:215504652-215504674 ACAGGTGGCGAAGAACTTGAAGG - Intergenic
946546890 2:220753674-220753696 CAAGGAAGAGAAGATCTCCAGGG - Intergenic
947873699 2:233454117-233454139 CCAGCAGGCGCAGAACTGCCGGG + Intronic
1172947924 20:38702973-38702995 CCTGGAGGAGGAGAAATCCAAGG - Intergenic
1173270819 20:41533183-41533205 CAAGGAGCCGAAGAAGGCCAAGG - Exonic
1174735606 20:52962919-52962941 CCAGGAGGCTAAGGAACCCATGG - Intergenic
1178985995 21:37303625-37303647 CCAGGAGGTTAAGAACACCCTGG - Intergenic
1180052619 21:45338620-45338642 CCAGGAGGGATAAAACTCCAGGG - Intergenic
1183657236 22:39194030-39194052 CCAGGAGGTGGAGAACTCCTGGG - Intergenic
1184014124 22:41772794-41772816 CCAGGAGGCAAACAAAGCCATGG - Intronic
1185242596 22:49754697-49754719 ACAGGAGGGGAAGGACTCCTGGG + Intergenic
949731938 3:7123737-7123759 CCAGGAAGCGTTGACCTCCAAGG - Intronic
950536552 3:13582281-13582303 TCAGGAGGCCAAGGACTCCTAGG - Intronic
952056612 3:29454174-29454196 CCAGGAGGGGAATACCTACAGGG - Intronic
952413571 3:33070632-33070654 CCAGGAGTTGAAGACCACCATGG + Intronic
954298042 3:49685011-49685033 CCAGGAGGAGAAGCACTGCCGGG + Exonic
954453651 3:50585418-50585440 CCAGGAGGTTGAGAACCCCAGGG - Intergenic
955889570 3:63635667-63635689 TCAGGATGCCAAGAACTTCATGG + Intergenic
955912526 3:63872510-63872532 CCAGGAGGGTGAGAACTGCAAGG + Intronic
958454009 3:94307492-94307514 TCAGGAGGCCAAAAACTACAAGG - Intergenic
960011954 3:112843066-112843088 CCAGGAGGCCCACAACTCCTTGG - Intronic
960536551 3:118821928-118821950 GGAGGAGGGGAAGAACTACAGGG - Intergenic
961863090 3:129933692-129933714 GCAGGAGGCCAAGGACCCCAAGG - Intergenic
965863743 3:173179459-173179481 CCATGAGTCGAAGAAATCAAAGG - Intergenic
969130145 4:4985155-4985177 ACAGGAGGCCAGGAACCCCAGGG + Intergenic
969414590 4:7050277-7050299 CCAGGAGGCAATGGAATCCATGG - Intronic
969515000 4:7642208-7642230 CCAGGAGGCTGAGAAATGCAGGG - Intronic
971255243 4:25008341-25008363 TCAGGAGTTCAAGAACTCCAAGG + Intronic
972390368 4:38607666-38607688 CCAGGAATGGAAAAACTCCAAGG - Intergenic
974716062 4:65669844-65669866 CCAGAAGGCGTAGGACCCCAAGG - Exonic
982278267 4:153658825-153658847 CCGGGAGGGCAAGGACTCCAAGG + Intergenic
982869150 4:160553793-160553815 CCAGGGGCAGATGAACTCCAGGG - Intergenic
984934383 4:184877505-184877527 CCATGAGACCAAGAGCTCCATGG - Intergenic
985790769 5:1925942-1925964 CCAGAAGGCACAGAGCTCCAGGG - Intergenic
986128215 5:4903253-4903275 ACAGAAGGTGAAAAACTCCAAGG + Intergenic
988857983 5:35247605-35247627 CCAGGAGGCGATGCAGGCCATGG - Intergenic
989068646 5:37488398-37488420 CCAGGAGGTGAAGAGATCAATGG - Intronic
991629941 5:68646317-68646339 CCAGGATGGAAAGAACTTCAGGG + Intergenic
991982350 5:72245709-72245731 CCAGGAGATGAAGCACACCAGGG + Intronic
992026334 5:72673169-72673191 CCAGGAGTTTATGAACTCCAAGG - Intergenic
992812667 5:80405713-80405735 CCAGAAGACGAAGATCTCTATGG - Intergenic
993338130 5:86687227-86687249 CCATGAAGCTAAGAGCTCCAGGG - Intergenic
995274531 5:110263052-110263074 CAAAGAGGGGAAGAAGTCCAAGG - Intergenic
995545448 5:113225599-113225621 CAAGGAGGTGAAGGACTCCATGG - Intronic
1008939841 6:57034735-57034757 CCTGGAGGCTAAGAAGTCCAAGG - Intergenic
1012549856 6:100456272-100456294 GCAGGAGGCGAGGGGCTCCAGGG - Intronic
1018085315 6:160296395-160296417 CCATGAGGTGAAGGTCTCCAAGG + Intergenic
1022140268 7:27487411-27487433 CCAGGCCCCGAAGAAATCCATGG - Intergenic
1022579596 7:31537351-31537373 AAAGGAGGAGAAAAACTCCATGG - Intronic
1024157106 7:46637355-46637377 CCATAAGCCGAAGAGCTCCAAGG + Intergenic
1024241615 7:47440336-47440358 TCAGAAGGCTAAGAGCTCCATGG + Intronic
1026313095 7:69205199-69205221 CCAGGAGGTGAAGAGCTGAAAGG + Intergenic
1026627936 7:72012734-72012756 CCAGGAGGAAAAGAACTCACTGG - Intronic
1026674393 7:72416889-72416911 CCAGGAGGCAGAGAAGTGCAGGG + Intronic
1026832338 7:73617936-73617958 CCAGGAGGCCAAGACATTCAGGG + Intronic
1027396570 7:77761437-77761459 CCAGACTGCGAAGAACTCAAGGG - Intronic
1028481660 7:91313299-91313321 CCAGGGGCCGGAGGACTCCAGGG - Intergenic
1034437961 7:151072069-151072091 CAAGAAGGCGAAGATCTCCTGGG - Exonic
1036297017 8:7545469-7545491 CAGGGAGACGAAGAACTGCAAGG + Intergenic
1036325552 8:7775550-7775572 CAGGGAGACGAAGAACTGCAAGG - Intergenic
1036445768 8:8820723-8820745 TCAGGATGGGAAAAACTCCAGGG + Intronic
1036451351 8:8870695-8870717 CCAGGAGAAAAAGATCTCCAGGG - Intronic
1036586965 8:10133339-10133361 CCAGGAGGCAGAGCACCCCACGG - Intronic
1038158817 8:25017163-25017185 ACAGGAGGCTGAGAAGTCCAGGG + Intergenic
1038285948 8:26206698-26206720 GCAGGAGGCAAAGAAATCCTAGG + Intergenic
1042479405 8:69286508-69286530 CCAGGAGTTGAAGAACAGCATGG + Intergenic
1042601817 8:70506356-70506378 TGAGGAAGGGAAGAACTCCAAGG - Intergenic
1042819680 8:72916451-72916473 CCAGCAGGAGCAAAACTCCATGG + Intronic
1045320147 8:101076244-101076266 ACAGGAGGCGGAGATCACCAGGG - Intergenic
1045500042 8:102738165-102738187 CCAGGAGGATAAGCCCTCCAGGG + Intergenic
1046862171 8:119105846-119105868 GCAGGAAGAGAAGAACTACAGGG + Exonic
1047324657 8:123824815-123824837 CCAGGAGCCAAGGAACGCCAGGG + Intergenic
1048882974 8:138885400-138885422 CCAGCAGGCGCATTACTCCAAGG + Intronic
1049731866 8:144182263-144182285 CCAGGAGGCGAGGAGCCTCAGGG + Intronic
1050364319 9:4860186-4860208 CCATGTGGTGAAGAACTCAAGGG + Exonic
1056935225 9:90911112-90911134 AAAGGGGGCGAAGGACTCCAGGG + Intergenic
1058075280 9:100644445-100644467 TCAGGAGGTGAACAACTCTAGGG + Intergenic
1059781352 9:117531319-117531341 CCAGGAGGGGCAGTCCTCCATGG + Intergenic
1061230694 9:129314128-129314150 CAAGGTGGCTCAGAACTCCAGGG - Intergenic
1061669960 9:132183072-132183094 CCAGGAGGAAGAGAATTCCATGG + Intronic
1061725183 9:132578686-132578708 CCAGGTGGCGAAGAAGGACATGG + Intergenic
1187268570 X:17759619-17759641 CCAGGAGTCCAAGGACCCCAAGG - Intergenic
1187891723 X:23942394-23942416 GCTGGAGGCAAAGAACTCCATGG + Intergenic
1189025916 X:37394325-37394347 CGAGGAGGGAATGAACTCCAGGG + Intronic
1190304969 X:49076709-49076731 CCGGGAGGGCAAGGACTCCAAGG - Exonic
1190509914 X:51164378-51164400 CCAGGATGAGAAGAAGCCCACGG - Intergenic