ID: 917962373

View in Genome Browser
Species Human (GRCh38)
Location 1:180155110-180155132
Sequence GGCGATGCAGTGGCCGCACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 96}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917962373_917962384 28 Left 917962373 1:180155110-180155132 CCTGGTGCGGCCACTGCATCGCC 0: 1
1: 0
2: 0
3: 10
4: 96
Right 917962384 1:180155161-180155183 AAGACGTCAAAGGTGAGAAGCGG 0: 1
1: 0
2: 1
3: 25
4: 192
917962373_917962386 30 Left 917962373 1:180155110-180155132 CCTGGTGCGGCCACTGCATCGCC 0: 1
1: 0
2: 0
3: 10
4: 96
Right 917962386 1:180155163-180155185 GACGTCAAAGGTGAGAAGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 88
917962373_917962375 -8 Left 917962373 1:180155110-180155132 CCTGGTGCGGCCACTGCATCGCC 0: 1
1: 0
2: 0
3: 10
4: 96
Right 917962375 1:180155125-180155147 GCATCGCCTTCGCCCCGACGTGG 0: 1
1: 0
2: 0
3: 0
4: 14
917962373_917962382 18 Left 917962373 1:180155110-180155132 CCTGGTGCGGCCACTGCATCGCC 0: 1
1: 0
2: 0
3: 10
4: 96
Right 917962382 1:180155151-180155173 GCGCTGGCCGAAGACGTCAAAGG 0: 1
1: 0
2: 1
3: 0
4: 39
917962373_917962376 -4 Left 917962373 1:180155110-180155132 CCTGGTGCGGCCACTGCATCGCC 0: 1
1: 0
2: 0
3: 10
4: 96
Right 917962376 1:180155129-180155151 CGCCTTCGCCCCGACGTGGAAGG 0: 1
1: 0
2: 0
3: 2
4: 22
917962373_917962385 29 Left 917962373 1:180155110-180155132 CCTGGTGCGGCCACTGCATCGCC 0: 1
1: 0
2: 0
3: 10
4: 96
Right 917962385 1:180155162-180155184 AGACGTCAAAGGTGAGAAGCGGG 0: 1
1: 0
2: 0
3: 14
4: 172
917962373_917962378 2 Left 917962373 1:180155110-180155132 CCTGGTGCGGCCACTGCATCGCC 0: 1
1: 0
2: 0
3: 10
4: 96
Right 917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917962373 Original CRISPR GGCGATGCAGTGGCCGCACC AGG (reversed) Exonic
900140292 1:1136944-1136966 GGCGGGGCAGGGGCTGCACCTGG + Intergenic
901805470 1:11736092-11736114 GGGGTTGGAGTGGCCGCAACGGG + Intronic
902804871 1:18854765-18854787 GGCGATGCAGATGTCGCGCCGGG + Exonic
911024950 1:93426656-93426678 GGCCATGCTGTGACAGCACCTGG - Intergenic
914784263 1:150814124-150814146 GGCGATGCAGTTGGGGCACCAGG + Exonic
915167833 1:153958451-153958473 GCCGAGGCCGTGGCCGAACCAGG + Exonic
915236532 1:154487491-154487513 GGAGATGAAATGGCAGCACCTGG + Intronic
917285248 1:173416199-173416221 GGCTAAGCAGTGGCAGCAGCTGG + Intergenic
917962373 1:180155110-180155132 GGCGATGCAGTGGCCGCACCAGG - Exonic
1064306737 10:14174160-14174182 GGCGGTGCAGAGGCGCCACCCGG - Intronic
1067777716 10:49175408-49175430 GGCCATGCAGAGGCCACCCCAGG + Intronic
1074766086 10:116700975-116700997 GGCCAAGCAGTGGCTGTACCTGG - Exonic
1075807376 10:125199745-125199767 GGCCCTGCAGTGGCCCCACAGGG + Intergenic
1076138004 10:128058221-128058243 GGCAGAGCAGTGGCCTCACCTGG + Intronic
1076922005 10:133459155-133459177 GGCAACGCGGTGGCCGCACCTGG + Intergenic
1077372041 11:2186929-2186951 GGGGTTGCAGTGGCTTCACCTGG - Intergenic
1077413751 11:2415071-2415093 GGCGAGGCTGGGGCCGCAGCAGG - Intronic
1079111778 11:17609350-17609372 GGGGATGCAGAGGCCTCATCCGG + Intronic
1083430967 11:62613299-62613321 GGGGCTGCAGGGGCAGCACCAGG - Exonic
1087222584 11:95562486-95562508 GGAGATGCAGTGTGGGCACCAGG + Intergenic
1091311317 11:134577091-134577113 GGTGATGCACTGGCCCCACATGG + Intergenic
1103988955 12:124785429-124785451 GCCTTTGCAGTGGCCGCTCCAGG + Intronic
1104800836 12:131554442-131554464 GGAGGGGCAGTGGCAGCACCGGG + Intergenic
1105011897 12:132761780-132761802 GGCGATGCTGTGGCCGCGGCTGG - Exonic
1112323953 13:98431180-98431202 GCCGGTGCAGTGGCCGCAGGAGG - Exonic
1112660282 13:101499951-101499973 GGCCAGCCAGTGGCCACACCTGG - Intronic
1113511526 13:110859009-110859031 GGGGATACAGAGGCCCCACCTGG - Intergenic
1121311109 14:92935567-92935589 GGCCATGCAGAGGCAGCGCCAGG + Intergenic
1121779962 14:96616003-96616025 GGTGACGCAGTGACAGCACCTGG + Intergenic
1122298200 14:100717304-100717326 GGGGATCCTGTGGCCCCACCTGG - Intergenic
1125509807 15:40286831-40286853 GGCTATGCAGAGGCCTCTCCGGG + Intronic
1125870926 15:43101172-43101194 GGAGATGCAGGGGCTGGACCAGG + Intronic
1129526316 15:76217596-76217618 GGCAGTGCAGTGGCTGCAACTGG + Intronic
1130192552 15:81750518-81750540 GGCGATGCAGCGTCCATACCTGG - Intergenic
1133240600 16:4412098-4412120 GGGTGTGCAGTGGCCGCCCCAGG - Intronic
1135247442 16:20869093-20869115 GGCTCAGCAGTGGCCGCTCCAGG - Intronic
1142850344 17:2701639-2701661 GGGGACACAGTGGCCGCTCCCGG + Exonic
1145058622 17:19718724-19718746 TGCCATGCATTGGCCGCCCCAGG + Intronic
1145304995 17:21669079-21669101 AGCGAGGCAGTGGGCACACCAGG - Intergenic
1147986610 17:44310680-44310702 GGAGATGCAGTGGCTGCTGCAGG - Intronic
1148752111 17:49951398-49951420 GGCCTTGCAGGGGCCGCATCTGG - Intergenic
1151817133 17:76476970-76476992 GGCGATGCGCTTGCCGCGCCGGG + Exonic
1152049170 17:77959028-77959050 GGCGTTGCCGGGGCCGGACCTGG + Intergenic
1152858362 17:82679687-82679709 GGGGCAGCAGTGGCCGCACAGGG - Intronic
1160048315 18:75408022-75408044 GTGGCAGCAGTGGCCGCACCAGG + Exonic
1160229368 18:77034766-77034788 GGAGAGGCAGGGGCTGCACCAGG - Intronic
1160526424 18:79541114-79541136 GGAGAGGCAGTGGCCGAGCCAGG - Intergenic
1161816346 19:6502113-6502135 GGGGAGGCAGTGGCGGCCCCGGG - Intronic
1162316067 19:9938741-9938763 GGCCAAGAAGTGGCAGCACCAGG - Intergenic
1163667891 19:18611678-18611700 GGCGGGGGAGGGGCCGCACCGGG + Intronic
1166069934 19:40381150-40381172 GGCGCTCCAATGGGCGCACCTGG + Exonic
1166092568 19:40519738-40519760 GGCGAGGCGGTGGCGGCAGCAGG + Exonic
1166121738 19:40690805-40690827 GGCGGGGCGGTGGCCGCGCCGGG - Intronic
925406167 2:3606539-3606561 GGGGATGCAGTGGTGGCACCAGG + Intronic
926090036 2:10043646-10043668 GGCGCAGCAGCGGCCGCACGTGG - Exonic
929965273 2:46529925-46529947 GGTGATGCAGTGGCCTGATCAGG + Intronic
933729623 2:85446915-85446937 GGAGCTGAAGTGGCAGCACCAGG + Intergenic
941580935 2:167294160-167294182 GGGGAGGCAGTGGCCCCACCTGG - Intergenic
942448429 2:176093224-176093246 GGCGCTGCAGCGGCCGCTGCAGG - Exonic
944299142 2:198102614-198102636 GGCAATGCAGTGGCCTTGCCTGG + Intronic
946175521 2:217919867-217919889 GGAGATGCCGTGGCAGCCCCTGG + Intronic
1172271903 20:33659694-33659716 CGAGATGCAGTGGCGGCTCCAGG - Exonic
1172962231 20:38807029-38807051 GGTGATTCAGAGGCGGCACCTGG - Intronic
1175240674 20:57545976-57545998 GGTGATGCAGTGGCTTCAGCAGG - Intergenic
1176113969 20:63423025-63423047 GGGGAGGCAGTGGCAGCACTGGG + Intronic
1176656313 21:9591529-9591551 AGCGAGGCAGTGGGCACACCAGG - Intergenic
1178702696 21:34846652-34846674 GGCGAGGGAGTGGCCTGACCTGG - Intronic
1181591977 22:23890961-23890983 GGAGATGAGGTGGCCACACCTGG + Intronic
1182715656 22:32354561-32354583 GGGGATGCAGTGGCCGTGGCCGG - Intergenic
1182780003 22:32859900-32859922 GGACATGCAGTGGCAGCTCCTGG - Exonic
1183184287 22:36282830-36282852 GGCTGTGCTGTGGCCGCCCCTGG - Intronic
950435379 3:12976258-12976280 GGGGCAGCAGTGGCCGCCCCAGG + Intronic
950562497 3:13742814-13742836 GGTGAGGCAGGGGCAGCACCAGG + Intergenic
953405904 3:42659577-42659599 GCCGATGCAGAGGCCACTCCAGG - Exonic
954291866 3:49654117-49654139 GGTGATGGAGTGGGGGCACCAGG - Exonic
954898353 3:53996715-53996737 GGGAATGCTGTGGCCACACCTGG - Intergenic
956080190 3:65549249-65549271 GGCGAGGAAGTGGCCGCGCCGGG - Intronic
960940311 3:122928961-122928983 GGCGGTCCAGGGGCCCCACCTGG - Intronic
961541831 3:127605319-127605341 GGCTATGCAGTGACCACATCTGG + Intronic
963321538 3:143814416-143814438 GGGGATGCAGTGGCCCTACCAGG + Intronic
968573267 4:1353502-1353524 GGGGATGCAGGGGCCTCCCCTGG + Intronic
968647064 4:1746424-1746446 GGCCATGCAGGGACCGGACCAGG + Intergenic
969295967 4:6270608-6270630 GGGGTTTCAGTGGCAGCACCTGG + Intronic
985979931 5:3454097-3454119 GGCGTTGCAGAGGCCTCACTGGG - Intergenic
997984146 5:138490226-138490248 GGCCGTGGAGTGGCAGCACCAGG - Intergenic
1003827798 6:9971853-9971875 GGCGAGGCATTTGCCTCACCTGG - Intronic
1004870835 6:19902168-19902190 GGGGATGCAGTGCCAGGACCTGG + Intergenic
1012895468 6:104941359-104941381 GGCAACGCAGTGCCCACACCGGG - Intergenic
1013225677 6:108118207-108118229 GGAGATGCTGCGGCCGCGCCGGG + Intronic
1019998505 7:4740916-4740938 GGGGGTACAGTGGCCGCAGCGGG - Exonic
1022113695 7:27245930-27245952 GGCCATGACGTGGCCGCACCCGG + Exonic
1023128867 7:36982833-36982855 GGAGATGCAGTGGCTGAACCAGG + Intronic
1030061289 7:105623335-105623357 GGCTCTGCAATGGCAGCACCAGG + Intronic
1036482502 8:9151141-9151163 GGCGATCCAGGGACCGCAGCTGG - Intronic
1037527656 8:19742525-19742547 GGGGATGCATTGGCTGCAGCTGG - Intronic
1037963299 8:23115752-23115774 GGGTCTGCAGTGGCCGCTCCTGG + Intronic
1040994707 8:53389976-53389998 CTCAATGCAGTGGCTGCACCTGG - Intergenic
1041786527 8:61640079-61640101 GGCGCTGCAGTGGCCTCAACGGG - Intronic
1049697979 8:143993014-143993036 GGCCATGCTGTGGCCACAGCGGG - Exonic
1049751309 8:144285597-144285619 TGCCCTGCAGTGGGCGCACCTGG - Intronic
1056436195 9:86577885-86577907 GGCCATGAAGCGGCCGCTCCCGG + Intergenic
1059191712 9:112333437-112333459 GGCGGCGCGGCGGCCGCACCGGG - Intronic
1203634029 Un_KI270750v1:95011-95033 AGCGAGGCAGTGGGCACACCAGG - Intergenic
1187034420 X:15522728-15522750 GGGGAAGCAGTGGCCCCACTGGG + Intronic
1187826217 X:23334919-23334941 GGCAATGAAGTGGCCGAGCCGGG - Exonic
1189856432 X:45229318-45229340 GGCCAGGCTGTGGCAGCACCTGG + Intergenic
1200076186 X:153552357-153552379 TCCCATGCAGTGGCAGCACCTGG + Intronic