ID: 917962378

View in Genome Browser
Species Human (GRCh38)
Location 1:180155135-180155157
Sequence CGCCCCGACGTGGAAGGCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917962374_917962378 -8 Left 917962374 1:180155120-180155142 CCACTGCATCGCCTTCGCCCCGA 0: 1
1: 0
2: 0
3: 1
4: 64
Right 917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 69
917962368_917962378 26 Left 917962368 1:180155086-180155108 CCTGGGCCGTGGAGTTCTTCGCC 0: 1
1: 0
2: 0
3: 7
4: 50
Right 917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 69
917962373_917962378 2 Left 917962373 1:180155110-180155132 CCTGGTGCGGCCACTGCATCGCC 0: 1
1: 0
2: 0
3: 10
4: 96
Right 917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 69
917962369_917962378 20 Left 917962369 1:180155092-180155114 CCGTGGAGTTCTTCGCCTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 180
Right 917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 69
917962372_917962378 5 Left 917962372 1:180155107-180155129 CCTCCTGGTGCGGCCACTGCATC 0: 1
1: 0
2: 1
3: 11
4: 149
Right 917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917962378 Original CRISPR CGCCCCGACGTGGAAGGCGC TGG Exonic
901483079 1:9539510-9539532 GGCCACGCCGCGGAAGGCGCGGG + Exonic
903693709 1:25192529-25192551 CACCCCAGTGTGGAAGGCGCAGG + Intergenic
906530728 1:46522510-46522532 CTCCCCGGCCTGGAAGGAGCTGG - Intergenic
907268820 1:53278399-53278421 CGCCCCCACGTGGAAAGATCTGG - Intronic
912515091 1:110212067-110212089 GGCCCCCACGAGGGAGGCGCGGG + Exonic
915543160 1:156581603-156581625 AGCCCCCAGGTTGAAGGCGCAGG - Exonic
915797551 1:158752522-158752544 CACCCCAACTCGGAAGGCGCAGG + Intergenic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
923344302 1:233036139-233036161 CGCCATGACGTGGAAGCTGCAGG - Intronic
1064028794 10:11869976-11869998 CCCCGCGGCGGGGAAGGCGCCGG - Exonic
1066437368 10:35406870-35406892 CGCCCCGACGGGGACGGAGGTGG - Intronic
1069445783 10:68472026-68472048 GGGCCCCACGTGGAACGCGCCGG - Intronic
1069942464 10:71964758-71964780 CGCCTGGACGCGGAAGGCGGGGG - Intronic
1074377420 10:112951367-112951389 CGCCCCGACCGGGCCGGCGCAGG - Intronic
1075007601 10:118842110-118842132 CACCCCAACTTGGAAGGGGCTGG - Intergenic
1077416496 11:2426541-2426563 CCCCCAGACGGTGAAGGCGCTGG + Intergenic
1080601976 11:33829335-33829357 CCCCCCGCCTTGGGAGGCGCTGG - Intergenic
1081973321 11:47214915-47214937 CGCCCCTTCCTGGAAGGCGGGGG - Intronic
1082206002 11:49434599-49434621 GGCCACGCCGCGGAAGGCGCGGG - Intergenic
1085100451 11:73796117-73796139 CGCCCCAACTCGGAAGGGGCAGG - Intronic
1091996498 12:4997927-4997949 CGCCCCGAAGCAGAAGGCTCAGG - Intergenic
1092247942 12:6873597-6873619 CGCCCCCACGGCGAAGGCCCGGG + Intronic
1099202467 12:79691336-79691358 CGCCCCGGAGTCGGAGGCGCCGG - Intergenic
1108221084 13:48233553-48233575 CGCCCCGAGGTGGCGGGCGCGGG + Intronic
1121054183 14:90839435-90839457 AGCCCAGACTTGGAAGGGGCAGG - Intergenic
1122905694 14:104800590-104800612 CGCCCCGGCGGGGAGGGCGCGGG - Intronic
1128264137 15:66253149-66253171 GACCCCGGCGGGGAAGGCGCCGG + Intronic
1128638767 15:69320053-69320075 CACCCCAACGGGGAAGGCTCTGG - Intronic
1128847732 15:70916726-70916748 CGCCCCAACTCGGAAGGGGCAGG - Intronic
1132482219 16:172475-172497 CGCCCCGGCCTGGCACGCGCTGG - Intergenic
1132483067 16:176279-176301 CGCCCCGGCCTGGCACGCGCTGG - Intergenic
1138381871 16:56608343-56608365 CGCCTCGGCGCGGAAGGGGCTGG - Exonic
1141959177 16:87392781-87392803 CACCCCGCCGCGGAGGGCGCGGG - Intronic
1146787334 17:35731741-35731763 CGCCCCGACTGGGCAGGCGGGGG + Exonic
1147150342 17:38510475-38510497 CGCCCAGACGGCGAGGGCGCGGG + Exonic
1150950776 17:69800963-69800985 CGCCCCAACTTGGAAGGGGTGGG - Intergenic
1151934506 17:77253823-77253845 GGCCCTGAGGTGGAAGGAGCAGG - Intergenic
1163441573 19:17324716-17324738 CGGCCCGAAGAGGAAGGCTCAGG - Exonic
1168084410 19:54034816-54034838 CGCCCCAACTCGGAAGGGGCAGG - Intergenic
1168335212 19:55593402-55593424 GGCCCCGAGGGGGCAGGCGCGGG - Exonic
944925044 2:204455829-204455851 GCCCCCTACGTGGAAGGCACTGG - Intergenic
1175433148 20:58921486-58921508 TGCCCCCACGAGGAAGGCCCTGG + Intergenic
1182464446 22:30505720-30505742 CGCCCCGACGGGAGAGGCACTGG + Intergenic
1184054528 22:42035451-42035473 CACCCCAACTTGGAAGGGGCGGG + Intronic
1184164707 22:42720567-42720589 CGCCCCGAAGTGGAGCGCGGCGG - Intronic
959863818 3:111243452-111243474 CACCCCAACTTGGAAGGGGCAGG + Intronic
961762761 3:129183769-129183791 CGCTCCGACGCGGAAGGTGAGGG - Exonic
966874452 3:184314528-184314550 CGCCCCCACGTGACCGGCGCAGG - Intronic
968359808 3:198138956-198138978 AGCCCCAACATGGAAGGCTCAGG + Intergenic
976092425 4:81471975-81471997 CGCCCCGCCCCGGCAGGCGCGGG + Intronic
996978280 5:129460327-129460349 CGCCCCGGAGTGGATCGCGCTGG + Exonic
1001576911 5:172770701-172770723 CACCACGGCGTGGTAGGCGCCGG + Exonic
1002384986 5:178860031-178860053 CGCCCAGACGTCGGAGGAGCCGG + Exonic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1005484327 6:26285373-26285395 CGCCGCGACGAGCAAGGCGCCGG + Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1018774328 6:166999290-166999312 CGCCCCGACGCGCAGCGCGCTGG - Exonic
1019260179 7:77692-77714 AGCCCCAACATGGAAGGCTCAGG - Intergenic
1025025369 7:55512340-55512362 CGCCTGGACCTGGAAGGCGGAGG + Intronic
1025078763 7:55964743-55964765 CGCCGCGAGGCGGAGGGCGCGGG + Intronic
1026360413 7:69597984-69598006 CGCCAGGGCGTGGAAGCCGCCGG - Intergenic
1028382222 7:90212013-90212035 CTGCCCGGCGTGGAGGGCGCGGG + Exonic
1028987667 7:97021113-97021135 CGCCGCCCCGGGGAAGGCGCGGG - Intronic
1036767932 8:11560709-11560731 TGCCCCCACGGGGCAGGCGCTGG + Intronic
1048345044 8:133570008-133570030 GGCCCCAAGGTGGAAGGTGCTGG - Intronic
1049693850 8:143974200-143974222 AGCCCCGGCGCGGAAGGTGCTGG + Intronic
1049759712 8:144326506-144326528 GGCCCCGACGTGGGAGCCGCGGG - Exonic
1050130373 9:2406384-2406406 CACCCCAACTTGGAAGGGGCGGG - Intergenic
1062696195 9:137877609-137877631 AGCCCCGGGGTGGGAGGCGCGGG + Intergenic
1062744513 9:138202777-138202799 AGCCCCAACATGGAAGGCTCAGG + Intergenic
1195702675 X:107716648-107716670 CGCCCCGGCTCGGGAGGCGCCGG + Intronic
1201291209 Y:12421643-12421665 CGCCCAGCCCTGGTAGGCGCGGG + Intergenic
1201489447 Y:14524780-14524802 CACCGCGGAGTGGAAGGCGCAGG - Intronic