ID: 917962970

View in Genome Browser
Species Human (GRCh38)
Location 1:180159004-180159026
Sequence CCCACTCACAAGTGCAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 219}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917962970_917962983 21 Left 917962970 1:180159004-180159026 CCCTCCCTGCACTTGTGAGTGGG 0: 1
1: 0
2: 1
3: 15
4: 219
Right 917962983 1:180159048-180159070 TCCAGACCAAGCCCCCAGTGGGG 0: 1
1: 0
2: 2
3: 20
4: 175
917962970_917962985 22 Left 917962970 1:180159004-180159026 CCCTCCCTGCACTTGTGAGTGGG 0: 1
1: 0
2: 1
3: 15
4: 219
Right 917962985 1:180159049-180159071 CCAGACCAAGCCCCCAGTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 184
917962970_917962981 19 Left 917962970 1:180159004-180159026 CCCTCCCTGCACTTGTGAGTGGG 0: 1
1: 0
2: 1
3: 15
4: 219
Right 917962981 1:180159046-180159068 ACTCCAGACCAAGCCCCCAGTGG 0: 1
1: 0
2: 1
3: 9
4: 152
917962970_917962982 20 Left 917962970 1:180159004-180159026 CCCTCCCTGCACTTGTGAGTGGG 0: 1
1: 0
2: 1
3: 15
4: 219
Right 917962982 1:180159047-180159069 CTCCAGACCAAGCCCCCAGTGGG 0: 1
1: 0
2: 0
3: 16
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917962970 Original CRISPR CCCACTCACAAGTGCAGGGA GGG (reversed) Intronic
900556981 1:3285466-3285488 CCCACTCACAAATCTCGGGACGG + Intronic
901396934 1:8988513-8988535 CCCACCCACAGCTGAAGGGACGG + Intergenic
901443348 1:9292757-9292779 ACCACTCAGCACTGCAGGGAAGG - Intergenic
901714114 1:11139496-11139518 CCCACCCACATGGGCAGGTAGGG - Intronic
902688982 1:18097833-18097855 CTCACTCACTACTTCAGGGAGGG - Intergenic
903172170 1:21561080-21561102 CCCACTCCCCACTGCAGGGATGG + Exonic
903853409 1:26321463-26321485 CACCCCCACAAGTGCAGGGCAGG - Intergenic
905170357 1:36106395-36106417 CCCACTCTCCTGTGCAGGGGAGG + Intronic
907243296 1:53092420-53092442 CCACCTCACAAATGCGGGGACGG - Intronic
907893198 1:58656230-58656252 CCCACTCCTAGGGGCAGGGAAGG + Exonic
911100390 1:94091261-94091283 CCCACTAAAAAGAGCTGGGAAGG - Intronic
916044114 1:160985908-160985930 TACATTCACAAGGGCAGGGAGGG + Intergenic
916604101 1:166324092-166324114 TTCACTCACTACTGCAGGGAGGG - Intergenic
916728493 1:167545068-167545090 CCCACTAAGAAGTGCATGGAAGG - Intronic
917962970 1:180159004-180159026 CCCACTCACAAGTGCAGGGAGGG - Intronic
918169614 1:181984084-181984106 ACCACTCACAGCTGCACGGATGG + Intergenic
918262635 1:182809595-182809617 CCCACACACAGGTGGAGAGAAGG + Intronic
923133757 1:231099515-231099537 TACATTCACAAGGGCAGGGAGGG + Intergenic
923396742 1:233573192-233573214 CCCAGTCAAAAGGGAAGGGAAGG - Intergenic
924066502 1:240228487-240228509 CCACCTCACATGTGCAAGGATGG + Intronic
1063906672 10:10786912-10786934 CACACACAGGAGTGCAGGGAAGG + Intergenic
1067089600 10:43259861-43259883 ACCACTCACAAAGGCAGGAAGGG + Intronic
1067180670 10:43983537-43983559 CCCACTCACCAGGGCATGGCTGG - Intergenic
1067412595 10:46078035-46078057 CTCACTCATTACTGCAGGGAAGG - Intergenic
1068421157 10:56795289-56795311 CACACTCACTACTGAAGGGAGGG - Intergenic
1072015750 10:91344621-91344643 TACATTCACAAGGGCAGGGAGGG - Intergenic
1076910356 10:133384946-133384968 CCCCGTCACAGGTGCAGGGCTGG - Intronic
1077423259 11:2462819-2462841 CCGACTCACCAGCCCAGGGAGGG - Intronic
1078734049 11:14003379-14003401 CCCAGGCACAAATGCAGTGAGGG + Intronic
1082004927 11:47414195-47414217 CACACTCACAGGCGCTGGGAAGG - Intronic
1082665537 11:55971338-55971360 CACACTCACAGTGGCAGGGAAGG - Intergenic
1083036502 11:59642388-59642410 GCCACACCTAAGTGCAGGGAAGG - Intronic
1084795034 11:71499791-71499813 TCCTCTCAAAAGTGCTGGGATGG - Intronic
1085076742 11:73598177-73598199 ACCGCTCAGAAGGGCAGGGAAGG + Exonic
1087903838 11:103672881-103672903 TACATTCACAAGGGCAGGGAGGG - Intergenic
1089605478 11:119638895-119638917 CCCACTCACAAGAGCAGGCCCGG + Intronic
1090805500 11:130199684-130199706 CTCCCTCACAAATGCAGCGAGGG - Intronic
1091115637 11:133010152-133010174 CCAACTCCCAAGTGGAGGGTTGG - Intronic
1092015336 12:5154032-5154054 CCCATTCCCAAGCCCAGGGAAGG - Intergenic
1093013192 12:14129719-14129741 CCCACGCACAAGAGAAGGAAAGG + Intergenic
1094858787 12:34435420-34435442 CCAACTTACAAGTGATGGGAAGG + Intergenic
1097334935 12:58371617-58371639 CCCACCCCAAGGTGCAGGGAAGG + Intergenic
1099304342 12:80936723-80936745 CGCCCTCACAAGCTCAGGGATGG - Intronic
1101809223 12:108093211-108093233 CCCTCTCAGAAATGAAGGGAAGG + Intergenic
1102061723 12:109937664-109937686 TCCCCTCTCAAGTGCAGAGATGG + Intronic
1102898835 12:116620333-116620355 TCCACTCTAAAGTGCTGGGAGGG - Intergenic
1104894730 12:132158601-132158623 CCGCGTCACACGTGCAGGGAGGG - Intergenic
1106187215 13:27420100-27420122 TCCACTCACAGGAGGAGGGAAGG - Intergenic
1107565025 13:41593549-41593571 CCCAATCACTGGTGCAGGGAGGG - Intronic
1108508050 13:51130670-51130692 CCCAGTCAGAAGTGCAGATAAGG - Intergenic
1109255926 13:60082116-60082138 CACACTCAAAAATGCAGTGAGGG + Intronic
1109993322 13:70087754-70087776 CTCACTAAGAAGTTCAGGGAAGG - Intronic
1111456134 13:88486748-88486770 CCCACCCCCACGTGCAAGGAAGG - Intergenic
1111540528 13:89661965-89661987 CCCAGCCCCAAGTGGAGGGAGGG - Intergenic
1112329346 13:98464984-98465006 CCCAATCACAAGGGAAGGGAGGG - Intronic
1113117864 13:106892668-106892690 CCCCCTCACAGATGCCGGGAGGG + Intergenic
1113351189 13:109530787-109530809 ACCACTCACAAGTCCAGCAAAGG + Intergenic
1113535333 13:111062038-111062060 CAACCTCACAAGTGCAGGTATGG - Intergenic
1117049571 14:51846828-51846850 CTCACACAAAAGTGGAGGGAAGG - Intronic
1117399664 14:55347237-55347259 CCCACACACAAAGGCAGGCATGG - Intronic
1122334678 14:100963686-100963708 CCCACGGACCAGGGCAGGGAGGG - Intergenic
1122626519 14:103087954-103087976 CCCAGTCCCCAGGGCAGGGATGG - Intergenic
1124078742 15:26471309-26471331 CCCACCCGCAAGCACAGGGAGGG - Intergenic
1125848764 15:42884625-42884647 CCCACTCACAAGCTCTGGGGAGG + Intronic
1126301642 15:47203246-47203268 CCCACCCCCAATTGCATGGAGGG + Intronic
1127626088 15:60781557-60781579 TCCACGGGCAAGTGCAGGGACGG + Intronic
1127708167 15:61567729-61567751 CTCACTCAATATTGCAGGGAGGG + Intergenic
1130073774 15:80671202-80671224 CCTTATCACAAGGGCAGGGAGGG - Intergenic
1130460071 15:84154023-84154045 TCCTATCACAAGTGCAGGGCAGG + Intergenic
1131077456 15:89504326-89504348 CCCGCTCCCAACTCCAGGGAGGG - Intergenic
1132993206 16:2808102-2808124 CTCACTCATTACTGCAGGGAGGG + Intergenic
1133789292 16:8997061-8997083 CCCACTCCCAGCTCCAGGGATGG + Intergenic
1136028216 16:27483714-27483736 CACACACACAAGGGCAGGGCAGG + Intronic
1138519994 16:57565662-57565684 CACAGTGACAGGTGCAGGGATGG - Intronic
1139364760 16:66426779-66426801 GCCACTGACACGTGCAGAGAAGG - Intergenic
1141733639 16:85838672-85838694 CCTTCTCACGAGAGCAGGGAAGG - Intergenic
1142016428 16:87750672-87750694 CCGACTCAGAGGTGCCGGGAGGG - Intronic
1142022072 16:87790074-87790096 CTAACGCACAAGGGCAGGGAAGG + Intergenic
1142078009 16:88131666-88131688 CCCACGTGCCAGTGCAGGGAGGG + Intergenic
1143273375 17:5692175-5692197 TCCACTTACAAGGTCAGGGAGGG + Intergenic
1150587171 17:66529497-66529519 TCCACCCACAAGTGATGGGAAGG - Intronic
1152278698 17:79372664-79372686 CCCACCCACAGGGGCAGGGCAGG + Intronic
1152465966 17:80466358-80466380 CTCTCAGACAAGTGCAGGGAAGG + Intergenic
1152906452 17:82973105-82973127 CCCACTCACAAGCCCAGGCCTGG + Intronic
1156488631 18:37483142-37483164 GCCACTAGCAAATGCAGGGACGG - Intronic
1157644995 18:49259199-49259221 ACCACTCACAAATGCAGAGGGGG + Intronic
1159205389 18:65244041-65244063 CCCACTCTCAAGTGCTGCCATGG + Intergenic
1162315354 19:9935495-9935517 CACACACACACGTGCATGGATGG + Intronic
1162799835 19:13104348-13104370 CCCACTCTGGAGGGCAGGGAGGG + Intergenic
1164511239 19:28898910-28898932 GCCACTCAAAAGTGCAGACAAGG - Intergenic
1165706765 19:37981860-37981882 ACCACCCATAACTGCAGGGAAGG + Intronic
1167124643 19:47540809-47540831 CCCACTCACTTGTCCAGGGCCGG + Intronic
927951486 2:27172979-27173001 ACCAGTCAGATGTGCAGGGATGG + Intergenic
928142747 2:28744840-28744862 GCCCCTCAGATGTGCAGGGAAGG + Intergenic
929445336 2:41996748-41996770 CCCACACACAACTTCATGGATGG - Intergenic
932297785 2:70641502-70641524 CTCTCTCACAATTACAGGGAAGG - Intronic
932916057 2:75859417-75859439 CTCACTCATCACTGCAGGGAGGG + Intergenic
934124921 2:88879097-88879119 CCCAGTCATAGGAGCAGGGAAGG - Intergenic
934684880 2:96313678-96313700 CACAGTCACCAGTGCATGGAGGG - Intergenic
934686792 2:96327177-96327199 CAAACTCACAGGTGCAGGGCAGG - Exonic
937888940 2:126921047-126921069 CCCACTCATAATTGCAAGAATGG + Intergenic
938065095 2:128277567-128277589 CCCTCTCACAAGTAGCGGGAGGG + Intronic
938218735 2:129546734-129546756 CTCACTCATTACTGCAGGGAGGG + Intergenic
938478542 2:131637101-131637123 CCCACTCAAAGAAGCAGGGATGG + Intergenic
939760269 2:146167590-146167612 CTCACTCACTATTGCAAGGACGG + Intergenic
940416479 2:153428412-153428434 CCCACTCATTACTGCAGGGATGG + Intergenic
940831934 2:158476285-158476307 CCAATTCAAAAGTGCAGGAAAGG - Intronic
942330261 2:174816243-174816265 CCCACTCACAAGCTCAGCAAAGG + Intronic
943554289 2:189382891-189382913 TACATTCACAAGGGCAGGGAGGG + Intergenic
944353936 2:198762882-198762904 CCCTTTCACAAAGGCAGGGAGGG - Intergenic
945023428 2:205596802-205596824 ACCCCTCTCAATTGCAGGGAGGG - Intronic
946032628 2:216717301-216717323 CCCCCAGACAAGTGCAGGAAAGG - Intergenic
946605067 2:221394962-221394984 TCCACACACAGATGCAGGGAGGG - Intergenic
1168849937 20:969602-969624 CTCCCTCACACGTGCCGGGAAGG - Intronic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1172326673 20:34041196-34041218 CCAACTCCAAAGTACAGGGAAGG + Intronic
1173747520 20:45449213-45449235 CACACACACAACTTCAGGGAAGG - Intergenic
1174192842 20:48752492-48752514 CCCGCTCTCATGTGCAGGGCAGG + Intronic
1174293779 20:49529115-49529137 CACACTCACACGTGCATGCATGG + Intronic
1175205145 20:57305516-57305538 CCCACCCCCACGAGCAGGGATGG + Intergenic
1175895079 20:62332548-62332570 CCCACTCACCTGTACAGGCAGGG + Exonic
1176040615 20:63063903-63063925 CCAACTCAAAAATGCATGGAGGG - Intergenic
1176070123 20:63221964-63221986 CACCATCACAGGTGCAGGGAGGG - Intergenic
1178437573 21:32573469-32573491 CCCACTCCCACCTGCTGGGACGG - Intergenic
1178553193 21:33560039-33560061 CCTTCCCACAAGTGCAGGGAGGG - Intronic
1178588863 21:33892639-33892661 CCCCCTCACTAGTGCAGGTTAGG - Exonic
1179097326 21:38327445-38327467 CCCACTCTCAAGTGGAAGAAAGG + Intergenic
1179352944 21:40630699-40630721 CCCACTGACAAGTACAGTGAAGG - Intronic
1179572162 21:42284261-42284283 CCCACTCATCTGGGCAGGGAGGG - Intronic
1180630246 22:17224210-17224232 CATATTCACAAGTGCATGGATGG + Intergenic
1181168993 22:20997856-20997878 CCCACTCACAAGTTCCAGGTGGG - Exonic
1182454362 22:30440347-30440369 CCCACACACTGGGGCAGGGAGGG - Intergenic
949169427 3:980859-980881 CCCACTCATTACTGCAAGGATGG + Intergenic
953233735 3:41087609-41087631 CCCACACACTTGTGCATGGATGG + Intergenic
954278667 3:49560116-49560138 CCTACTCACATATGCAGGGAGGG - Intronic
954711874 3:52509198-52509220 CTCACTCTCTAGTGCAGTGATGG + Exonic
956090298 3:65659466-65659488 CACACTCACCAGTGCCAGGACGG + Intronic
960420887 3:117444249-117444271 CCCTGTCACAAGTCCTGGGAGGG - Intergenic
961084789 3:124057598-124057620 CACGCGCACAAGTGCAGGCAGGG - Intergenic
961727490 3:128942317-128942339 GCCACTCACCAGTGCTAGGAGGG - Intronic
962007559 3:131362960-131362982 ACCACTCCCAAGTTCTGGGAGGG + Intergenic
963405258 3:144855069-144855091 CCCACTCACAAATGCATGCTGGG - Intergenic
966074763 3:175923220-175923242 CCCACTCCCATCTCCAGGGATGG - Intergenic
968055421 3:195687830-195687852 TCCACTGACAAGTGTGGGGATGG - Intergenic
968100374 3:195960768-195960790 TCCACTGACAAGTGTGGGGATGG + Intergenic
968426790 4:529043-529065 TCCACTCAGAAGCCCAGGGATGG + Intronic
969455267 4:7296678-7296700 GCCACTGAGAAGTGCGGGGAGGG + Intronic
969853320 4:9979463-9979485 CCCACTCACACAGGCAGGGCAGG - Intronic
970033865 4:11709381-11709403 CCCACTCACAATTGCTGCAACGG - Intergenic
972865060 4:43221793-43221815 TCAACTCACAAGTGCATGCAGGG - Intergenic
973039142 4:45448938-45448960 CCCACCAACAAGAGCAGTGAAGG + Intergenic
974703785 4:65485888-65485910 ACATCTCACAATTGCAGGGAGGG + Intronic
974816751 4:67014789-67014811 TACATTCACAAGGGCAGGGAGGG - Intergenic
978870917 4:113576526-113576548 CCCACACACAAGTACACAGAAGG + Intronic
980472738 4:133269234-133269256 CCAACTCCCAAGTGCAGAGAGGG - Intergenic
984100716 4:175482116-175482138 CACATTCACAAGTACTGGGAGGG + Intergenic
985023159 4:185712819-185712841 CCCCCTCGCAAGTGCCGTGAAGG + Intronic
985181401 4:187268162-187268184 CTCACTCATTACTGCAGGGAAGG - Intergenic
986091322 5:4511430-4511452 TAAACTCACACGTGCAGGGAGGG - Intergenic
986302023 5:6484790-6484812 AGCACTAACCAGTGCAGGGAGGG - Intronic
986588793 5:9346792-9346814 CCCTATCACAAGTCCTGGGAAGG + Intronic
994275283 5:97829509-97829531 CCAAATCACAAGGTCAGGGATGG - Intergenic
994278810 5:97874991-97875013 CCCACTCACAAGTACTAGAAGGG - Intergenic
994450032 5:99929850-99929872 GACACTCAAGAGTGCAGGGATGG + Intergenic
1000424963 5:161079816-161079838 CTCACTCATTACTGCAGGGACGG - Intergenic
1001182629 5:169534708-169534730 CCCACTTACAAGTCCAGGAAGGG + Intergenic
1001416975 5:171552163-171552185 CCCATTCACTCCTGCAGGGAAGG + Intergenic
1002044634 5:176535022-176535044 CCCACTCCCCAGGGCAGGGAAGG + Intronic
1002300607 5:178255530-178255552 CACACTCACACGTGCACGCATGG + Intronic
1003215574 6:4106398-4106420 TCTTCCCACAAGTGCAGGGAGGG - Intronic
1003296090 6:4830163-4830185 CAGACTCACAGTTGCAGGGATGG - Intronic
1004472649 6:15942869-15942891 CCTACTCAGAAGTCCAGGGCAGG - Intergenic
1004695289 6:18027503-18027525 CCAAGTGACAAGTGCAAGGATGG - Intergenic
1005599019 6:27407339-27407361 CCCACACACAGCTGCAGGGCTGG + Intergenic
1006611839 6:35298713-35298735 CCCACTAACTAGGGTAGGGAAGG - Intronic
1007284919 6:40740763-40740785 CACACTCAGATGTGCAGAGAAGG + Intergenic
1008935194 6:56984176-56984198 CCCAGTCTGAAGTGCAGTGATGG - Intronic
1012874400 6:104709446-104709468 ACCACTCATTACTGCAGGGAGGG - Intergenic
1013701264 6:112772797-112772819 CCCACTCTCCAGTCCAGGTAAGG + Intergenic
1015190314 6:130465087-130465109 CTCACTCATCACTGCAGGGAGGG + Intergenic
1015724144 6:136282785-136282807 CGCACTTACAATTTCAGGGAAGG + Intronic
1017274549 6:152550898-152550920 ATCACACAGAAGTGCAGGGATGG + Intronic
1018160876 6:161041281-161041303 CCCACAGACAGGTGCTGGGAAGG - Intronic
1018377528 6:163227327-163227349 CTCACTCACTAGGGCAGGGATGG + Intronic
1018796209 6:167187259-167187281 CCCACTCCCACCTGCTGGGATGG + Intronic
1018820109 6:167367798-167367820 CCCACTCCCACCTGCTGGGACGG - Intronic
1019713469 7:2527841-2527863 CCCACTCAGAAGAGCTGGGAGGG - Exonic
1023792487 7:43764172-43764194 ACAACTCACAAGTGCGGGGGCGG - Intronic
1024229564 7:47353896-47353918 CCCACTCACACCTGCAGAAAGGG + Intronic
1026439994 7:70435842-70435864 CCCACACACAGCTGCAGGGTAGG + Intronic
1026655194 7:72250633-72250655 CTCACTCATTACTGCAGGGAGGG - Intronic
1028398934 7:90403869-90403891 CCCACTCAGTGTTGCAGGGATGG + Intronic
1028430260 7:90738028-90738050 CCCACTCACAGAAGCAAGGATGG - Intronic
1028755349 7:94427457-94427479 CCCAGGCACACTTGCAGGGATGG - Intronic
1031550219 7:123101456-123101478 CTCACTCATTACTGCAGGGAGGG + Intergenic
1031712585 7:125067859-125067881 CCCAGTCACAAGTCCCGTGAGGG - Intergenic
1034787750 7:153940952-153940974 CCCTCTCCCATGTGCAGAGATGG - Intronic
1035205232 7:157290379-157290401 CCCACTCACAGGTGCATGGACGG - Intergenic
1035599941 8:891484-891506 CGCACACACGGGTGCAGGGAAGG - Intergenic
1036935691 8:13000277-13000299 CCTAATCACATGTCCAGGGAAGG + Intronic
1037389404 8:18377807-18377829 CTCACTCACTATTGCAAGGACGG + Intergenic
1039083721 8:33759244-33759266 CACACTCATTACTGCAGGGAAGG - Intergenic
1040739693 8:50557968-50557990 CCCACTTAGGAGTGAAGGGAAGG - Intronic
1040926294 8:52687424-52687446 CCCACCCTCAAGTGTAGGCAGGG + Intronic
1040991095 8:53350704-53350726 CCTAGACAGAAGTGCAGGGAAGG + Intergenic
1042100306 8:65269312-65269334 CACACTCAAATGTGCAGGAAAGG + Intergenic
1042394915 8:68280669-68280691 CCCATTCACAACTGGGGGGAGGG + Intergenic
1044133503 8:88556688-88556710 CCTACTCACCTGTGCTGGGAGGG + Intergenic
1048305296 8:133279785-133279807 CCCACTCAGGATTGCAGGGTGGG - Intronic
1049365401 8:142234547-142234569 CCCAACCACAAGTTCAGGGAAGG + Intronic
1050617138 9:7413507-7413529 CCTACTCACAGGTGAAGGGTAGG + Intergenic
1050657498 9:7845094-7845116 CTCACTCATTACTGCAGGGAGGG + Intronic
1053267516 9:36726002-36726024 CCCTCTCCCAATTGCAGGAAGGG + Intergenic
1053297268 9:36923796-36923818 CACACTCCTCAGTGCAGGGATGG + Intronic
1053475124 9:38377218-38377240 CCCACTTCCAAGTGCACGCAAGG + Intergenic
1055642446 9:78330743-78330765 CCAACTAACCAGTGCAGAGATGG - Intergenic
1056539205 9:87556915-87556937 CCCACCCACAACTGCAGGACTGG - Intronic
1058321501 9:103636751-103636773 CCCCCTCACAAGTCCTGTGAAGG + Intergenic
1058961059 9:109993466-109993488 CCTACTGACAAGTTTAGGGATGG - Intronic
1059308213 9:113371044-113371066 CCCACTGATAATAGCAGGGACGG + Exonic
1059850386 9:118331688-118331710 CTCAGTCAGAATTGCAGGGAGGG - Intergenic
1060521879 9:124298579-124298601 CCCATTCTCAAGTGGAGAGAGGG + Intronic
1187453118 X:19416698-19416720 ACCACTGACAACTGCAGTGACGG - Intronic
1192344080 X:70286977-70286999 CCAACTCACTATTCCAGGGAGGG + Exonic
1193791187 X:85816748-85816770 CCCAAACAGAAGTGCAGGTAAGG - Intergenic
1194813419 X:98414975-98414997 CCTATTAAGAAGTGCAGGGATGG + Intergenic
1194901842 X:99521192-99521214 CTCACTCACCAGTGCAGACAAGG + Intergenic
1195386799 X:104321229-104321251 CCCACACACAAGGGGAGAGAAGG - Intergenic
1197423683 X:126269076-126269098 CCCATTCACAATTGCAGCAAAGG - Intergenic
1198319881 X:135510283-135510305 CCCACTCTCAAATGTGGGGAAGG - Intergenic
1198797491 X:140414404-140414426 TCCACGGACCAGTGCAGGGATGG + Intergenic
1199990996 X:152987775-152987797 TCCCCACACATGTGCAGGGAGGG + Intergenic
1200034083 X:153317249-153317271 TCCCCACACATGTGCAGGGAGGG + Intergenic
1200988156 Y:9325538-9325560 GGCCCTCACAAGTGCAGGGGTGG + Intergenic
1201772379 Y:17627895-17627917 CCCACTTACTATTGCGGGGAAGG + Intergenic
1201829176 Y:18278091-18278113 CCCACTTACTATTGCGGGGAAGG - Intergenic