ID: 917964126

View in Genome Browser
Species Human (GRCh38)
Location 1:180167822-180167844
Sequence CAGGGACATGGTGCTATCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917964118_917964126 3 Left 917964118 1:180167796-180167818 CCCTTTGAAATGAAAGGCCTTCC 0: 1
1: 0
2: 2
3: 17
4: 179
Right 917964126 1:180167822-180167844 CAGGGACATGGTGCTATCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 143
917964119_917964126 2 Left 917964119 1:180167797-180167819 CCTTTGAAATGAAAGGCCTTCCT 0: 1
1: 0
2: 2
3: 21
4: 235
Right 917964126 1:180167822-180167844 CAGGGACATGGTGCTATCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917964126 Original CRISPR CAGGGACATGGTGCTATCTT TGG Intronic
900867558 1:5279262-5279284 CATGGACATGCTGCTATGCTAGG + Intergenic
901931899 1:12601277-12601299 CAAGGAAATGGTGCTCTATTTGG - Intronic
909368925 1:74861696-74861718 CAGGGGCATTGTGCTATGTGGGG - Intergenic
909837289 1:80272778-80272800 CAGAGAGAAGGTGCTAGCTTTGG - Intergenic
910035239 1:82780459-82780481 CAGGGAAAGGGTGCCATCTAAGG - Intergenic
912409346 1:109468841-109468863 CAGGGAAATGATGCAGTCTTGGG + Intronic
915167552 1:153956916-153956938 CAGAGGCATGGTGGGATCTTAGG - Intronic
916896794 1:169171860-169171882 CAGGGACATGCTGCTAGATGAGG + Intronic
917120830 1:171643259-171643281 CAGGGACTTGGTGCTGCCTATGG + Intronic
917964126 1:180167822-180167844 CAGGGACATGGTGCTATCTTTGG + Intronic
919129203 1:193432740-193432762 CAGGTGCATGGTGCTAGCTGTGG + Intergenic
920039070 1:203084384-203084406 CAGGGACATTGTCCTCTCTGTGG + Intronic
921742280 1:218699160-218699182 CTGGGACATAGCTCTATCTTGGG + Intergenic
921759984 1:218902013-218902035 CAGGGTCATGCTGCTTTATTTGG + Intergenic
921998375 1:221447008-221447030 CTAGGACAGGGTGCTATTTTTGG + Intergenic
922619608 1:226981705-226981727 CAGGGCCATGGTGCTGCCTGTGG - Intronic
1063780120 10:9312988-9313010 TAGGGACATGGTGCCACTTTAGG - Intergenic
1064588572 10:16865010-16865032 GAGTGCAATGGTGCTATCTTGGG + Intronic
1065855404 10:29826255-29826277 CAGGGACCGGGTGCTTTCTTGGG - Intergenic
1066611058 10:37248942-37248964 CATGGCCATGCTGCTGTCTTGGG + Intronic
1068119515 10:52771627-52771649 CAGGGACATGGTCCTCACCTTGG + Exonic
1073620165 10:105038395-105038417 CTGGGACATTGTCCTATTTTTGG + Intronic
1073692536 10:105826158-105826180 CATGGATATGGTGTTTTCTTAGG - Intergenic
1073875813 10:107920359-107920381 TAGTGACAGGCTGCTATCTTTGG + Intergenic
1075286560 10:121192131-121192153 CAGGGGAATGGTTCCATCTTGGG - Intergenic
1075697088 10:124444505-124444527 CAGGCACATGCTGCTATGTTTGG - Intergenic
1076101614 10:127784794-127784816 CAGGGACATGGAGGTAGCTGGGG + Intergenic
1077759128 11:5071880-5071902 CAGGAACATGGTGCTAGCCTAGG - Intergenic
1077962021 11:7085641-7085663 CAGGGACTTAGTGGTATCCTTGG - Intergenic
1084632147 11:70360003-70360025 CAGGGGCATGGTCCCATGTTTGG + Intronic
1088882092 11:113980394-113980416 CAAGGACAAGGTGCTAACTATGG + Intronic
1088950933 11:114569164-114569186 CAGGGGCCTGGTGGTATCTGGGG + Intergenic
1089562574 11:119351727-119351749 CAGGTGCATGGTGCTATGTCTGG + Intergenic
1092965980 12:13642841-13642863 CAGGGCCATGGAGCTGGCTTTGG + Intronic
1094425292 12:30310524-30310546 CAGGAACTTGGTCCCATCTTAGG - Intergenic
1095533288 12:43216167-43216189 CAAGCATATGGTGCTATCTGAGG + Intergenic
1096028623 12:48390640-48390662 AAGGAGAATGGTGCTATCTTTGG - Intergenic
1098428690 12:70395315-70395337 CAGGGACTGGGTTCTATGTTAGG - Intronic
1100228728 12:92585714-92585736 CAGGTACATGGTGCTATGAGAGG - Intergenic
1102712849 12:114943561-114943583 CAGGGACAAGGGTCTCTCTTGGG - Intergenic
1105653025 13:22401764-22401786 CAGGTACATGGTGTTACATTTGG - Intergenic
1110035786 13:70681736-70681758 CAAGGAAATGGTTCTATCTAGGG + Intergenic
1110381909 13:74862039-74862061 CAGTGAGAAGGTACTATCTTTGG + Intergenic
1110489484 13:76086774-76086796 CAGGCACATGGTGCAAGCTGTGG + Intergenic
1113584323 13:111453208-111453230 CAGGAACATGCTGCTACATTTGG + Intergenic
1114328145 14:21610536-21610558 CAGAAACATGCTACTATCTTTGG + Intergenic
1118338997 14:64879530-64879552 GAGGCACTTGGTGCTAGCTTTGG - Intronic
1121618594 14:95330967-95330989 CAGGGACCACGTGCTATCCTTGG + Intergenic
1121803087 14:96791742-96791764 CATGGTCATGGTGTTGTCTTGGG - Intergenic
1122884815 14:104706290-104706312 CTGGGCCATGGTGCCAGCTTTGG + Intronic
1124085886 15:26550071-26550093 CAGGGTCATCTTCCTATCTTAGG - Intronic
1126511215 15:49476965-49476987 CAGGGAAATGGTGCAAACCTGGG + Intronic
1127564079 15:60169407-60169429 CAGCGACATGGTGCCATCTATGG - Intergenic
1128682204 15:69660270-69660292 CAGGGACTTGCTGATAGCTTGGG + Intergenic
1129524622 15:76205901-76205923 CAGGGACATGGTGCACTGTCAGG - Intronic
1130041650 15:80410133-80410155 CAGTTAGATGGTGCTAACTTAGG + Intronic
1130539151 15:84809521-84809543 GAGTGAAGTGGTGCTATCTTTGG + Intergenic
1131261755 15:90891328-90891350 CAGGGACAGGGTGGTCTCTGTGG - Intronic
1135244794 16:20846239-20846261 CAGCGCCAGGCTGCTATCTTCGG - Exonic
1141161581 16:81632753-81632775 CAGGCACATGGTGCAAACCTAGG - Intronic
1141201578 16:81902514-81902536 CTGGGACATGGAGATATCTTTGG + Intronic
1141545993 16:84769629-84769651 CAGGGCCAGGGAGCTATCTCTGG - Intronic
1141699945 16:85637820-85637842 CTGGGGCTTGGTGCTCTCTTGGG - Intronic
1143295342 17:5867238-5867260 AAAGGTCTTGGTGCTATCTTGGG + Intronic
1150205594 17:63403623-63403645 CAGTGGCATGGTCCTATCTGAGG - Intronic
1156622458 18:38868908-38868930 CAGGGCCATGATTTTATCTTTGG + Intergenic
1157683176 18:49622769-49622791 CAGGGACCTGGTGCTCTCCCAGG + Intergenic
1159278007 18:66246181-66246203 TAGGGCCATGGTTCTATCATTGG - Intergenic
1160891240 19:1379787-1379809 CAGGGACATGGGGGTCTCTGCGG - Intergenic
1167377430 19:49119481-49119503 CAGGGGCAGGGGGCTATTTTGGG + Exonic
925188064 2:1863089-1863111 CATGGAGATGGTGGTAGCTTTGG + Intronic
929830114 2:45340271-45340293 CAGAGCCATGGTGCTCTTTTTGG + Intergenic
930378467 2:50597193-50597215 GAGGGACATGGCTCTGTCTTAGG + Intronic
937236298 2:120433584-120433606 CAGGGACACGGTGCCACCTCGGG - Intergenic
938747677 2:134295382-134295404 CAGGGAAAATGTGGTATCTTAGG + Intronic
940014935 2:149094356-149094378 CAGGGACATGATATAATCTTGGG + Intronic
940129370 2:150363520-150363542 CAGGGCCATGGTGCTTTTTCAGG + Intergenic
943827569 2:192414751-192414773 CAGGGCCGTGGTGCCCTCTTTGG + Intergenic
946403510 2:219481094-219481116 CAGGGAGGTGGTGCTGCCTTGGG - Intronic
946804179 2:223453404-223453426 CAGGAACATGGTGATATTTTAGG - Intergenic
1170508374 20:17052357-17052379 AAGGGAAATGCTGCTAGCTTTGG + Intergenic
1171445228 20:25197981-25198003 CAGGGCCTTGGTGCTGTCTTAGG + Intronic
1173499007 20:43538976-43538998 CAGGGAGATGGGGCTGTCTGGGG + Intronic
1175427527 20:58878217-58878239 CAAGGCCATGGGGCTCTCTTGGG - Intronic
1176013739 20:62916646-62916668 CATGAACATGGAGCTGTCTTCGG - Intronic
1178108375 21:29347106-29347128 CAGGGAAAGGGTGCTATTTTTGG - Intronic
1178698194 21:34811983-34812005 CAGGGGCATGGAGGTTTCTTGGG - Intronic
1179578572 21:42322976-42322998 CGGGAACATGGTGTTGTCTTTGG + Intergenic
1179926356 21:44536440-44536462 TAGAGACATGGTGCTACCTGAGG - Intronic
1181286499 22:21756234-21756256 CAGGCACATTATGCTATCTGTGG + Exonic
1182700232 22:32230951-32230973 CAGGGACATTTTCCTACCTTGGG + Exonic
1182717074 22:32365569-32365591 CAGGGACACGGTGGTCTCTAAGG - Intronic
1184389774 22:44196587-44196609 CAGGGACATGGTGGGATCCCGGG + Intronic
949901299 3:8816881-8816903 CATGGCCATGGTGCCATCTAAGG + Intronic
950174824 3:10865692-10865714 CCAAGACATGGTGATATCTTTGG + Intronic
951460252 3:22944175-22944197 CTGGGACATGATGCCATCTCTGG + Intergenic
951698386 3:25469349-25469371 CATGAACATGATGCTGTCTTTGG + Intronic
952240663 3:31528805-31528827 CTGGGACATTGCTCTATCTTGGG + Intergenic
952287587 3:31982996-31983018 CCGGGACATGCTGCTCTCCTGGG - Intronic
953349296 3:42202627-42202649 CAGGGACATGATGCTCTCAGTGG - Exonic
953431313 3:42842931-42842953 GAGGGCAATGGTGCAATCTTGGG - Intronic
954696541 3:52430346-52430368 AAGGGATATGGGGCTGTCTTTGG - Intergenic
957659097 3:83123271-83123293 CAGGTACACAGTGATATCTTAGG + Intergenic
958666060 3:97139171-97139193 CAGGGCCCTGGTGCTCTCTGAGG - Intronic
959818494 3:110704054-110704076 CAGGCACATGGTGCAAGCTGTGG + Intergenic
962576954 3:136763607-136763629 CAGGCACATGGTGCATTCTGGGG - Intergenic
963019347 3:140857566-140857588 CAGTGACAAGGTGCCATCTTTGG - Intergenic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
972995101 4:44869966-44869988 CAGGGCCATGGGGCATTCTTGGG + Intergenic
975904173 4:79189540-79189562 CAGGGACATGGTGAGAGCTCAGG - Intergenic
983320675 4:166192074-166192096 CAGGGTCATGGTGCTACTGTTGG - Intergenic
985976360 5:3421264-3421286 CAGGGACATGGTGCCTGCTCTGG - Intergenic
986262626 5:6161613-6161635 CAGGGATGGGGTGCTTTCTTTGG + Intergenic
991019441 5:61964653-61964675 CAGAGACATGGTGGCATTTTGGG - Intergenic
994074892 5:95639640-95639662 TAGTGACATGGAGCTCTCTTGGG + Intergenic
999156279 5:149459689-149459711 GAGTGCAATGGTGCTATCTTGGG - Intergenic
1001178314 5:169493798-169493820 CAGGAACTTGGTGCAATTTTAGG + Intergenic
1004247750 6:13996413-13996435 CAAGGTCAAGGTGCTATATTTGG + Intergenic
1004315279 6:14581508-14581530 CAGAGAGATGCTGCTATCTTTGG + Intergenic
1004436664 6:15601917-15601939 AAGGAAAATGTTGCTATCTTTGG + Intronic
1007893744 6:45324749-45324771 CAGGGAAATGGTGCTAGTTTGGG + Intronic
1008896955 6:56566802-56566824 CAGTTACATGGTGTTATCATGGG + Intronic
1009622050 6:66089979-66090001 CAGGGAAATGGAAATATCTTTGG - Intergenic
1009878392 6:69534901-69534923 CAGGAACAGGAAGCTATCTTTGG - Intergenic
1010647121 6:78403087-78403109 CAGAGACATGGGGTTTTCTTAGG + Intergenic
1019949058 7:4356257-4356279 CAGGTACATGGTGTCCTCTTGGG - Intergenic
1020032223 7:4940975-4940997 CTGGGAGATGGTCCTAGCTTTGG - Intronic
1021067425 7:16194294-16194316 ATGAGACATGGTGCCATCTTTGG + Intronic
1023576771 7:41636262-41636284 CAGAGTCATGCTGCTATCTTGGG - Intergenic
1024736726 7:52312997-52313019 CTGGGGCATGGTGCTATATATGG + Intergenic
1024813284 7:53238204-53238226 CAGGGACACGGTGTCATCTGAGG - Intergenic
1029523194 7:101077517-101077539 CAGGGACATGGTATTGTCATGGG + Intergenic
1029995229 7:105001113-105001135 CAGGGGCATGGTGCCATGCTGGG - Intergenic
1032454086 7:132058643-132058665 CAGGTGCATGGTGCAAGCTTTGG - Intergenic
1033556726 7:142494676-142494698 CAGGGATATGCTGCTATACTGGG - Intergenic
1034073752 7:148212632-148212654 GAGGGAAATGATGCTATTTTGGG + Intronic
1034504887 7:151480734-151480756 GAGGGCAATGGTGCAATCTTGGG + Intronic
1034849745 7:154482379-154482401 CAATGACATGGTGCAAGCTTAGG + Intronic
1036659431 8:10698432-10698454 CAGGGACATGGGGACAGCTTGGG + Intronic
1044873193 8:96640319-96640341 CAGGGACATGGAGCTCCTTTAGG + Intergenic
1046359908 8:113137598-113137620 CAGTAACAAGGTGCCATCTTTGG - Intronic
1051979477 9:22997040-22997062 CAGGCACATGGTGCAAGCTACGG + Intergenic
1057299034 9:93865854-93865876 CAGGGACATGGTGCAGGCATGGG + Intergenic
1059993226 9:119884877-119884899 CAGGGATATAATGTTATCTTGGG + Intergenic
1061023010 9:128028778-128028800 TAAGCACATGCTGCTATCTTTGG + Intergenic
1189003157 X:36966725-36966747 CAGGGACACGTTGCTAGCTAGGG - Intergenic
1189121418 X:38399296-38399318 GAGGGGCAAGGTGCTAGCTTTGG + Intronic
1190008487 X:46761367-46761389 CAGCGACATGGTTCTTGCTTGGG - Intergenic
1191062486 X:56314442-56314464 TATGGACAAGGTGCTATCTGAGG + Intergenic
1192335661 X:70217220-70217242 CAGGTACATGGTGCAAGCTGTGG - Intergenic
1193909662 X:87287050-87287072 CAGCAAGAAGGTGCTATCTTTGG + Intergenic
1194905985 X:99576664-99576686 CAGGCACTTGGTGCAATCTGTGG - Intergenic
1197827236 X:130602787-130602809 CAGGAACATGGTTCTCTCTGGGG + Intergenic
1198347567 X:135773791-135773813 CTGGGACATGGTGCCATATTGGG - Intergenic
1198349472 X:135791052-135791074 CTGGGACATGGTGCCATATTGGG - Intergenic
1198351377 X:135808325-135808347 CTGGGACATGGTGCCATATTGGG - Intergenic
1198353286 X:135825591-135825613 CTGGGACATGGTGCCATATTGGG - Intergenic
1198355193 X:135842845-135842867 CTGGGACATGGTGCCATATTGGG - Intergenic
1198357103 X:135860128-135860150 CTGGGACATGGTGCCATATTGGG - Intergenic
1198359017 X:135877407-135877429 CTGGGACATGGTGCCATATTGGG - Intergenic
1198365487 X:135935638-135935660 CTGGGACATGGTGCTACACTGGG - Intergenic
1198415565 X:136416315-136416337 GAAGGATATGGTGCTTTCTTTGG - Intronic
1199672617 X:150159707-150159729 CAGGGTCAAGATGCTCTCTTTGG - Intergenic