ID: 917966362

View in Genome Browser
Species Human (GRCh38)
Location 1:180181465-180181487
Sequence CAGTAGTCAGAGGGGCCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917966362 Original CRISPR CAGTAGTCAGAGGGGCCCTT TGG (reversed) Intronic
900382955 1:2394223-2394245 AAGGAGACCGAGGGGCCCTTTGG - Intronic
900783012 1:4630110-4630132 CAGAAGTGAGAGGAGACCTTTGG - Intergenic
900928496 1:5720844-5720866 TGGCAGTCACAGGGGCCCTTTGG - Intergenic
902817237 1:18923260-18923282 CATTCCCCAGAGGGGCCCTTGGG + Intronic
903189964 1:21650967-21650989 CAGTGGTCATAGGGACCCATGGG - Intronic
905034565 1:34909159-34909181 CAGGAGACAGAGGGGCACCTGGG - Intronic
905459652 1:38114230-38114252 CTGTCTTCAGAGGGGCCCTAGGG + Intergenic
906293963 1:44637693-44637715 CAGCAGTGTGAGGGGCTCTTAGG + Intronic
906787197 1:48626566-48626588 CTGGAGCCAGAGGGGCTCTTTGG + Intronic
912801503 1:112722590-112722612 CTGTAGTGAGAGAGGCCCTCGGG + Intronic
913435431 1:118842658-118842680 CAGAAGCCAGAGGGGCCGATGGG + Intergenic
915309838 1:155001405-155001427 CACTAGTGGGAGGGGCCCTTTGG + Intergenic
916769048 1:167890533-167890555 TAGTAGTCACAGTGGGCCTTGGG - Intronic
917496886 1:175548597-175548619 CAGCAGAAAGAGGGGCCCTGAGG - Intronic
917704300 1:177616111-177616133 CAGCAGTAAGAGGGGCACTGTGG - Intergenic
917966362 1:180181465-180181487 CAGTAGTCAGAGGGGCCCTTTGG - Intronic
919207580 1:194437299-194437321 CAGCAGACAGAGGGGTCCTAGGG - Intergenic
920352418 1:205346046-205346068 AAGTAGTAAGATGGGCCCGTTGG - Intronic
922778329 1:228228087-228228109 CAGTATTAAGAGGGGGCCTTTGG + Intronic
923706386 1:236348061-236348083 CAGTGGTCCGAGGTGACCTTCGG + Intergenic
924358666 1:243212446-243212468 CAGTTGTCATATGGGTCCTTTGG + Intronic
924391820 1:243568992-243569014 CAGTAGTCATCGGAGCCCTTAGG - Intronic
1064650942 10:17508641-17508663 CAGTCATCAGAGGGGCGCTGGGG + Intergenic
1067045198 10:42981486-42981508 CTGAGGTCAGACGGGCCCTTGGG - Intergenic
1071831026 10:89372277-89372299 GAGTAGCCACAGGGACCCTTTGG + Intronic
1075532969 10:123245744-123245766 CAATAGTAAGAGGCGGCCTTTGG - Intergenic
1075533340 10:123249083-123249105 GAGAAATCAGAGGGGCCCGTGGG + Intergenic
1076035838 10:127197427-127197449 CAGGCATCAGAGGGGCCCCTGGG - Intronic
1077320043 11:1937031-1937053 CACTGGGCACAGGGGCCCTTGGG + Intronic
1083889552 11:65589077-65589099 CAGAAGTCAGAGGTGGCCTGAGG + Intronic
1084309445 11:68308214-68308236 CTGTGGTCAGAGGCGCCCCTGGG - Intergenic
1085048777 11:73368709-73368731 CAGTGGTCAGAGGGGCTCCTAGG - Exonic
1085236815 11:75021649-75021671 GAGTAGTCAGAGGAGACCATGGG + Intergenic
1085385381 11:76154695-76154717 CAGAAGTCAGAGGGGGCATTTGG - Intergenic
1085764909 11:79274222-79274244 CAGAAGGCAGAAGGTCCCTTTGG + Intronic
1085980615 11:81719204-81719226 GAGTAGTTAGAGTGGGCCTTGGG + Intergenic
1088683500 11:112265463-112265485 CACTAGTCTGAGGAGCCCTGGGG + Intronic
1088720505 11:112587986-112588008 CAGTAGCCAGACTGGTCCTTGGG - Intergenic
1091178903 11:133585627-133585649 CAGTATTCTGAGGGGGCCCTAGG - Intergenic
1093588523 12:20871855-20871877 CAGTAGTTAAAGAGGGCCTTGGG - Intronic
1095367000 12:41419398-41419420 CAGCTGTCTGAGGGGCACTTGGG - Intronic
1100011022 12:89953143-89953165 CAGTAATCAAAGGACCCCTTTGG - Intergenic
1101835681 12:108293541-108293563 CAGTGGTCACTGGTGCCCTTTGG + Intronic
1104012102 12:124939141-124939163 CTGTAGACATAGGGGGCCTTTGG - Intergenic
1105806048 13:23952094-23952116 CAGGAGGCAGCAGGGCCCTTCGG - Intergenic
1111748537 13:92298144-92298166 CAGGAGTGAGACTGGCCCTTCGG - Intronic
1119082881 14:71712877-71712899 CAGGTGTCTGAGGGGGCCTTAGG - Intronic
1119206213 14:72795670-72795692 CAGGAATCAGAGGGGCTGTTTGG + Intronic
1122827476 14:104377240-104377262 CAGCACCCACAGGGGCCCTTGGG + Intergenic
1126285712 15:47008687-47008709 CAGTAGTCACTGTGGGCCTTGGG - Intergenic
1130119397 15:81034282-81034304 CAGTAGTCACACTGGCCCTCTGG - Intronic
1132576293 16:665902-665924 CAGCACTCACAGGGGCCCTGAGG - Intronic
1132663173 16:1070538-1070560 CAGTGGGCAGCGGGGCCCTTTGG + Intergenic
1132880796 16:2160927-2160949 CAGTAGGGAGAGGACCCCTTGGG - Intronic
1133305324 16:4804687-4804709 CTCCAGACAGAGGGGCCCTTGGG - Exonic
1137835217 16:51585688-51585710 CAGTAGCCAGAGTGGTCTTTTGG + Intergenic
1138129942 16:54471116-54471138 TAGAAGTCAGATGTGCCCTTTGG + Intergenic
1139429336 16:66902888-66902910 AGGTAGACAGAGGAGCCCTTAGG + Intergenic
1139505819 16:67397611-67397633 CAGTCGTCAAAGGAGCCCCTAGG - Intronic
1141029098 16:80572257-80572279 ATGTAATCAGAGGGGTCCTTAGG + Intergenic
1141364065 16:83426089-83426111 CAGTATTCCCAGGGACCCTTTGG + Intronic
1141720513 16:85752767-85752789 CAGGAGTCAGCGGGTCCCTGGGG + Intergenic
1141954724 16:87363010-87363032 TGGTTGTCAGAGCGGCCCTTGGG - Intronic
1144576675 17:16433986-16434008 AAGAAGTCAGAGGGACCCTTGGG + Intronic
1147911467 17:43858553-43858575 CAGCAGGCAGAGGGGCTCTAGGG + Intronic
1148913714 17:50957105-50957127 TAGTTGCCAAAGGGGCCCTTGGG + Intergenic
1149298494 17:55283207-55283229 CAGTGGCCAGAGGGGGCCTTTGG + Intronic
1151366124 17:73617443-73617465 CAGGAGCCAGAAGGGCCCCTGGG - Intronic
1152590087 17:81207369-81207391 CAGTGGTCAGATGGGGGCTTTGG - Intronic
1152864253 17:82712839-82712861 CAGGAGGCAGAGAGGCTCTTGGG - Intergenic
1155443517 18:25885712-25885734 CAGTAGTCACTGTGGGCCTTGGG + Intergenic
1156110947 18:33726730-33726752 CAGCAGTCAGAGCTACCCTTTGG + Intronic
1157454868 18:47817212-47817234 CAGTACTCACAGGAGCCCTTTGG + Exonic
1158851183 18:61496569-61496591 CAGGAGTCAGGGGCGCCCTGTGG + Intronic
1159292423 18:66439879-66439901 CAGGAGGCAGATGGGCTCTTGGG + Intergenic
1159700626 18:71622227-71622249 CAGTAGTGAGGAGGGGCCTTTGG + Intergenic
1160047602 18:75401140-75401162 CCTGAGTCATAGGGGCCCTTGGG - Intergenic
1160505458 18:79423968-79423990 CAGGAGTCAGAGGGGGGCCTGGG - Intronic
1161162297 19:2768166-2768188 CAGCAGAGAGAGGGGCCCTGTGG - Intronic
1166010526 19:39937655-39937677 GACTAGTCAGAGGGGCCCAGGGG - Intergenic
1167658772 19:50783476-50783498 CAGTCCTCAGAGGGGTCCTCCGG - Intergenic
1168666580 19:58209415-58209437 CCGTGGTTACAGGGGCCCTTGGG + Intronic
925185801 2:1845538-1845560 CAGGAGTGGGAGGGGCCCCTGGG - Intronic
925328206 2:3038976-3038998 CAGCAGCCAGAGGAGCCCATTGG - Intergenic
926588918 2:14718985-14719007 CGGTAGTCAGGGAGTCCCTTGGG + Intergenic
927085857 2:19673413-19673435 CATCGGTCAGAGGGGCCCTGAGG - Intergenic
927266933 2:21162300-21162322 CAGTAGGCAGATGGGCTCCTGGG - Intergenic
928022720 2:27716302-27716324 GAGAAAACAGAGGGGCCCTTGGG - Intergenic
928204364 2:29273469-29273491 CATTAGTCTGAGTGGCCATTGGG + Intronic
936147159 2:109987598-109987620 CTGTAGTCAGAGAGGCCAGTGGG + Intergenic
936197533 2:110383885-110383907 CTGTAGTCAGAGAGGCCAGTGGG - Intergenic
938598287 2:132811572-132811594 TAGTAGTGAGACCGGCCCTTAGG - Intronic
938610695 2:132944934-132944956 CAGGAGTTAGAGAGGCTCTTTGG + Intronic
946324818 2:218979950-218979972 CAGTATTCAGAAGGGCCTCTAGG + Intergenic
946994229 2:225372754-225372776 CAGTGGACAGCAGGGCCCTTTGG - Intergenic
1170163356 20:13338086-13338108 CTGTAGGCAGAGCAGCCCTTAGG + Intergenic
1171220513 20:23392950-23392972 CAGTGGTCAGAAGGGCACTCTGG - Intronic
1172288576 20:33758639-33758661 CAGTAGTCAGAGGCTGCCCTTGG + Intronic
1176428038 21:6560725-6560747 CAGGAGTCAGCGGGGCCTCTGGG - Intergenic
1178137407 21:29642782-29642804 CAGTGCTCAGAAGGGCCCCTGGG + Intronic
1178507202 21:33171706-33171728 TAGTAGTCTGAGGGCCCCTGGGG + Intergenic
1179703529 21:43169042-43169064 CAGGAGTCAGCGGGGCCTCTGGG - Exonic
1180021583 21:45131764-45131786 CACTTTTCAGAGGGGCTCTTGGG + Intronic
1181048506 22:20227803-20227825 CATCAGTCAGAGGTGCCCTGTGG + Intergenic
1181812068 22:25409442-25409464 CTGTGGTCAGAGGTGCCCCTGGG + Intergenic
1182086282 22:27563406-27563428 CAGCAGCCAGAGGGACCCTAAGG - Intergenic
1183430251 22:37761660-37761682 CGGAAGGCAGAGGGGCCTTTGGG + Intronic
1183983624 22:41557265-41557287 CAGTAGTCGCAGGGGCTATTTGG + Intergenic
1184186071 22:42866317-42866339 CAGCAAGCAGAGGGGCCCTCAGG - Intronic
951529719 3:23686938-23686960 AAGAAGTCAGGGGGGGCCTTTGG + Intergenic
955525928 3:59819807-59819829 CAGTATTAAGAGGAGCCTTTGGG + Intronic
957482488 3:80816405-80816427 CAGCATACAGAGGGGCCCTCAGG - Intergenic
962910210 3:139841557-139841579 CAGTTTTTAGAAGGGCCCTTGGG + Intergenic
963763318 3:149307679-149307701 AAGTTGACAGAGGAGCCCTTGGG - Intergenic
965087184 3:164113924-164113946 CAGAAGTCAGACAGGCCCCTGGG + Intergenic
965872657 3:173279873-173279895 CAGTAGCCAGAGGGAGCCCTGGG - Intergenic
966437493 3:179904948-179904970 CAGTAGCCAAAGGGGCTATTAGG - Intronic
967209047 3:187150454-187150476 CAGGAGTGAGACTGGCCCTTTGG + Intronic
967936830 3:194735326-194735348 CAAAAGACAGAGGGGCCCATTGG - Intergenic
967982436 3:195073689-195073711 CAGAAGTCAAGGAGGCCCTTTGG + Intronic
969059806 4:4425695-4425717 CTGAAGTCAGAGGGGCCCAGAGG - Intronic
969153116 4:5187122-5187144 CAGTAGTCAGAGAAGCCATGGGG + Intronic
969272338 4:6111274-6111296 CAGGAGCCAGAGGGCACCTTCGG + Intronic
969566832 4:7983718-7983740 CTGCAGGCAGAGGGGCCCTGAGG + Intronic
974746396 4:66083808-66083830 CAGAGTTCAGAGGGGCACTTCGG + Intergenic
980287159 4:130795377-130795399 TAGGAGTCTGAAGGGCCCTTTGG + Intergenic
980306315 4:131065229-131065251 CAGGAGTCAGACAGGCTCTTGGG - Intergenic
983968390 4:173842563-173842585 ATGTTGTGAGAGGGGCCCTTTGG + Intergenic
985969726 5:3365637-3365659 CAGTAGGTAGAGTGGCCCTTAGG - Intergenic
988039759 5:25874264-25874286 TAGTAGTTATAGGGGGCCTTGGG - Intergenic
992162028 5:74013385-74013407 CATGACTCAGTGGGGCCCTTGGG + Intergenic
992309656 5:75482552-75482574 CAGTAGTCACTGTGGGCCTTGGG + Intronic
993192239 5:84696905-84696927 CAGTGGCCACAGGGGTCCTTGGG + Intergenic
996331732 5:122337063-122337085 CAGGAGTCAGAGGTGAACTTGGG + Intronic
1001006789 5:168059090-168059112 CAGTAGTCACAGTGCCCCTTAGG - Intronic
1001701521 5:173710032-173710054 CAGCAGTCAGAGGTGACCCTAGG - Intergenic
1006732567 6:36247211-36247233 CAGTAGTCTGTGGGGCCCTGAGG - Intronic
1012974483 6:105765422-105765444 CAGTAGGCAGTTGGGCCCTAGGG - Intergenic
1017588101 6:155948408-155948430 CAGTAGTCAGAGAGCCCTCTTGG + Intergenic
1020129303 7:5550532-5550554 AAGAAGTCAGAGGGGACCCTGGG + Intronic
1023820096 7:43975824-43975846 CAGTGTTAAGATGGGCCCTTGGG - Intergenic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1029436803 7:100568265-100568287 CAGCAGGGACAGGGGCCCTTTGG + Intergenic
1029748374 7:102529277-102529299 CAGTGTTAAGATGGGCCCTTGGG - Intergenic
1029766321 7:102628364-102628386 CAGTGTTAAGATGGGCCCTTGGG - Intronic
1031074579 7:117200269-117200291 CTGTATGCAGAGGGGGCCTTGGG - Intronic
1031164867 7:118215714-118215736 CAGTATTAAGAGGGGCCTTTTGG - Intronic
1031543943 7:123029422-123029444 AAGTAGGTAAAGGGGCCCTTTGG + Intergenic
1034474170 7:151273346-151273368 CAGCAGTCGGAGGGAGCCTTGGG - Intronic
1034544215 7:151779354-151779376 CTGCAGGCAGAGGGTCCCTTTGG - Intronic
1036528411 8:9556469-9556491 CAGCAGTGAGCGGGGCCCTACGG + Exonic
1036574999 8:10019180-10019202 CAGTAGGAAGTGGGGCCTTTGGG - Intergenic
1036916089 8:12805515-12805537 TAGTAGAAAGAGTGGCCCTTTGG + Intergenic
1043042165 8:75276591-75276613 CAGTGGTCACTGGGGGCCTTGGG + Intergenic
1048635470 8:136290764-136290786 CAGTAGTGGGAGGGGACCTGGGG + Intergenic
1056736560 9:89214911-89214933 CAGCACTCAGAGGGACCCTCTGG - Intergenic
1057272167 9:93657496-93657518 CAGTAGTCAGGCTGGCCCTGTGG - Intronic
1061467354 9:130792142-130792164 AAGTAGACACAGGGTCCCTTGGG + Intronic
1062447126 9:136599710-136599732 CAGGAGTCAGAGGTGGCCTGGGG + Intergenic
1062516757 9:136940705-136940727 CAGGAGGCCGAGGGGGCCTTGGG + Exonic
1192154038 X:68730235-68730257 CAAAATTCAAAGGGGCCCTTGGG + Intergenic
1192170494 X:68851623-68851645 TATTAATCAGAGGGGCCCTTGGG - Intergenic
1199965271 X:152814760-152814782 CAGTAGTTCCAGGGGCCCCTAGG - Intergenic