ID: 917966514

View in Genome Browser
Species Human (GRCh38)
Location 1:180182479-180182501
Sequence CAGGCCCAGGCTCCTGACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 260}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917966514_917966521 16 Left 917966514 1:180182479-180182501 CCACCGTCAGGAGCCTGGGCCTG 0: 1
1: 0
2: 4
3: 30
4: 260
Right 917966521 1:180182518-180182540 CCGCAGCTCAGAGACCTCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917966514 Original CRISPR CAGGCCCAGGCTCCTGACGG TGG (reversed) Intronic
900158159 1:1211798-1211820 CAGGCCCAGGCCCAGGATGGCGG + Exonic
900598192 1:3491869-3491891 CAGCCTCAGGGTCCTGAAGGTGG + Intronic
901199523 1:7458633-7458655 CAGGCCCAGGCTCCCCAAGTGGG - Intronic
901435561 1:9245419-9245441 CAGGCCCGGGCGCCTGGCTGCGG + Exonic
901523943 1:9807648-9807670 CAGGCCCTGCCTCTTCACGGTGG - Intronic
901642847 1:10701781-10701803 TAGGACCAGGCAGCTGACGGGGG + Intronic
901804415 1:11729125-11729147 AGAGCCCAGGCTCCTGACTGTGG - Intergenic
901930288 1:12592752-12592774 CAGCCCCAGGCTCCCGAGGCTGG + Intronic
902226629 1:15000290-15000312 CAGGGCCAGGCTCCCACCGGAGG - Intronic
902561039 1:17277703-17277725 CATGCCCAGGCTCCTGCTGGGGG - Intronic
903418487 1:23201206-23201228 CAGGCCAAGGGTCCTGAGGCTGG + Intergenic
903735084 1:25524708-25524730 CAGGTCCAGCCTCCTTACAGAGG - Intergenic
905150247 1:35921474-35921496 CAAGCCCAGGCTCCTCAAAGAGG - Exonic
905390721 1:37634143-37634165 CAGGCCCAGGCTGCGGACTGGGG + Intronic
905865519 1:41374311-41374333 CAGGGTCAGTCTCCTGAGGGAGG + Intronic
910851280 1:91651766-91651788 GAGGCCCAGGCTCCATGCGGTGG - Intergenic
917966514 1:180182479-180182501 CAGGCCCAGGCTCCTGACGGTGG - Intronic
919667643 1:200307625-200307647 CAGCCCCATTTTCCTGACGGTGG - Intergenic
921313263 1:213866707-213866729 CAGACCCAGGCTCGTGAAGTGGG + Intergenic
922573359 1:226646534-226646556 CACCCCCAGGTTCCTGACAGGGG - Intronic
922773901 1:228206334-228206356 CAGGGCCAAGCTCCTGGTGGGGG + Intronic
923796703 1:237163884-237163906 CTCACCCAGGCTGCTGACGGAGG + Intronic
1062860124 10:804416-804438 CCGGCCCTGGCTCCTCAGGGAGG + Intergenic
1065583951 10:27199601-27199623 CAGGCCCTGGCTTCTGAGGAGGG - Intronic
1067055086 10:43045446-43045468 CAGGCCCTGGATGCTGCCGGGGG - Intergenic
1067064072 10:43093882-43093904 CAGGCGCAGGCTCCTGCTGGTGG + Intronic
1067242081 10:44505811-44505833 AAGGCCCAGGCTCCCCACAGGGG - Intergenic
1067436934 10:46284906-46284928 CAGGCCCAGGAGCCAGAGGGCGG - Intergenic
1067732468 10:48821879-48821901 CAGGTCCAGGCACCTGACTAGGG - Intronic
1071456797 10:85857365-85857387 CAGGCTCAGCCTCCTGAGTGTGG + Intronic
1071876949 10:89852611-89852633 AAGGCCCAGACTCCTGAGGATGG + Intergenic
1073084446 10:100879327-100879349 CAGCCCCAGGCTGCTGATGCAGG - Intergenic
1073326411 10:102646114-102646136 CAGGCCCAGAGGCCTGAGGGGGG - Intronic
1075898599 10:126019786-126019808 CAGGCAGAGGCTTCTGAGGGGGG + Exonic
1076441632 10:130484655-130484677 CTGGCCCAGGCTGCTGAGGGAGG + Intergenic
1076498300 10:130914002-130914024 CAGGCCCAGGCTCCCTGGGGAGG + Intergenic
1076806032 10:132859235-132859257 CAGGCTCAGGCACCTGACGGAGG + Exonic
1076852554 10:133100164-133100186 CAGGCCCAGGCCCAGGCCGGGGG - Intronic
1077130922 11:972156-972178 CAGGGCCAGGCCCATGAAGGTGG - Exonic
1077147212 11:1051660-1051682 CAGGCCCAGCTTCCTGCTGGGGG - Intergenic
1077214988 11:1391458-1391480 CAGGCCCAGGCTCTTGGGGGAGG + Intronic
1077219735 11:1410687-1410709 CAGGCGGGGGCTCCTGAGGGTGG - Intronic
1077441070 11:2569510-2569532 CAGGGCCCGGCTTCTGAGGGAGG + Intronic
1077842025 11:5985873-5985895 CAGTCACAGGCTCCTGGCTGTGG + Exonic
1077919562 11:6632423-6632445 CAGGCCCAAGCACCAGATGGGGG - Exonic
1078338005 11:10478804-10478826 CAGGGCCAGGCTCCAGAGGGAGG - Intronic
1078663971 11:13309343-13309365 CAGGCCCAGCATCCTGGCTGTGG + Intronic
1078800781 11:14643159-14643181 CAGGCCCAGGATCCTTGCAGTGG - Intronic
1079818590 11:25094719-25094741 GAGGCCCAGGGTGCTGAGGGTGG + Intergenic
1081747907 11:45485904-45485926 CAGGCCCAGGCTGCTGGAGGTGG - Intergenic
1083933420 11:65858066-65858088 CAGGCCACGGCGCCTGAGGGAGG - Intronic
1085265412 11:75235310-75235332 CAGGCCCAGGATCCTGATCATGG - Intergenic
1085454908 11:76660243-76660265 CAGGCTCAGGCTGCGGAGGGAGG + Exonic
1085719206 11:78898175-78898197 TAGGCCCAGGCTCCTCAATGGGG + Intronic
1087063297 11:94003874-94003896 CCAGCCTAGGCTCCTGGCGGTGG + Intergenic
1089163492 11:116457480-116457502 CAGGCCCAGCCTCCAGAAGCTGG - Intergenic
1090661473 11:128885221-128885243 CAGGCCCAGGTGCCTGAGAGAGG - Intergenic
1091327614 11:134703009-134703031 CAGGCTCAGGCTGCTGAGGAAGG + Intergenic
1096501111 12:52064262-52064284 CAGGCCAGGGCTCCTGATGGTGG - Intergenic
1096661009 12:53123961-53123983 CAGGCCCTGGTGCCTGACTGTGG - Intronic
1100212997 12:92417486-92417508 CAGTCCTAGGCTCATGGCGGTGG - Intergenic
1103053418 12:117800329-117800351 CAGGGCCAGGTTCCTGTCTGTGG + Intronic
1105805619 13:23950299-23950321 CAGGCCCAGGCTGCCGCCTGGGG - Intergenic
1107880639 13:44829350-44829372 CATGCCCAGGCCACTGACCGTGG + Intergenic
1112508353 13:99988902-99988924 CAGGCCCAGGCTCCTGAGTGTGG - Intergenic
1114265741 14:21071552-21071574 GAGACCCAGCCTCCTGCCGGCGG - Intronic
1114476469 14:22998645-22998667 GAGGCCCAGGCTCCTCAGGTGGG + Exonic
1115853163 14:37603265-37603287 CAGGTCCAGGCTCCTCACTTGGG - Intronic
1121016021 14:90549566-90549588 CAGGCCCTGGCTGCTGCTGGTGG + Intronic
1121332451 14:93058138-93058160 CAGGCCCAGGGCCCTAACAGGGG - Intronic
1121590952 14:95108682-95108704 CAGGACAGGGCTGCTGACGGTGG + Intronic
1122352331 14:101103364-101103386 CAGGCCCAGGCTGCTGGTGCAGG + Intergenic
1122479894 14:102040304-102040326 CAGGCCCTGGATCCTGGGGGTGG - Exonic
1123813866 15:23956398-23956420 CAGTCTCAGGCTCCTGAGGCCGG - Intergenic
1123886038 15:24729147-24729169 CAAGCCCTGACTCCTGAAGGAGG + Intergenic
1123968373 15:25481110-25481132 GAAGCCCATACTCCTGACGGTGG + Intergenic
1124720361 15:32106174-32106196 CAGGGCCAGGGTTCTGAGGGGGG + Intronic
1125396379 15:39252580-39252602 CAGGCTCATGCTGCTGACAGGGG + Exonic
1127931842 15:63601993-63602015 CAGGACCAGGCGGCTGCCGGGGG - Exonic
1127982567 15:64045809-64045831 CAGGCCGGGGCGCCTGACGGCGG + Intronic
1129111869 15:73341889-73341911 GAGGCCCAGGCTGCTGCTGGGGG + Intronic
1129784371 15:78299415-78299437 CAGGCCCTGGGGCCTGAGGGTGG - Intronic
1131508050 15:93033435-93033457 CAGGCCCAGGCTCTGCACTGCGG + Intergenic
1132675853 16:1120975-1120997 CAGGCCCGGGGTCCTGTCAGGGG + Intergenic
1132697127 16:1206991-1207013 CATGCCCAGGATGCTGAGGGTGG - Exonic
1132710440 16:1263892-1263914 CAGGCCCAGGCTCCAGTCCTTGG + Intergenic
1133024101 16:2980250-2980272 CACGCCGAGGCCCCTCACGGCGG + Intronic
1133317854 16:4895161-4895183 CAGGCACAGGCTCCTGAGAACGG + Intronic
1134089974 16:11386319-11386341 CAGTCCCAGCATCCTGAGGGAGG + Intronic
1135424235 16:22324436-22324458 GAGGCCCAGGCTGCTGCTGGAGG + Intronic
1136070657 16:27785073-27785095 CTGGGCCAGGCTCCTGTCTGGGG - Intergenic
1136297430 16:29311673-29311695 CAGGCCCATGCTCCACACGGAGG - Intergenic
1136370914 16:29835560-29835582 CAGGCTCAAGTTCCTGACTGCGG - Intronic
1136424823 16:30162763-30162785 CAGGCCCAGGCTGGGCACGGTGG + Intergenic
1136579611 16:31143435-31143457 CAGGGCCAGGCCCCTGGCCGCGG + Exonic
1137057284 16:35751781-35751803 GAGGCCCAGGATCGTGGCGGAGG - Intergenic
1137590957 16:49693402-49693424 CAGGACCAGGAGCCTGACTGTGG - Intronic
1137780464 16:51094047-51094069 GAGGCCCAGGCTCAGGACAGGGG + Intergenic
1139395040 16:66632274-66632296 CCGTCCCAGGCTCCTGACCAGGG + Intronic
1139551077 16:67673425-67673447 CAGGCCGAGGCTCCTGCCACAGG + Intergenic
1141617873 16:85220499-85220521 CTGCCCCAGGCTCCTGGCCGCGG - Intergenic
1141725836 16:85787787-85787809 CAGGCACAGGATCCTGAGGGAGG - Intronic
1141744021 16:85913900-85913922 CAGGCCCAGGCTTCTGCAGCCGG + Intronic
1141879490 16:86848324-86848346 CAGGCCCTGGCTCCTCGGGGAGG - Intergenic
1144660149 17:17062833-17062855 CAGGCCCAGGCTCTGGACATGGG + Intronic
1144671651 17:17136209-17136231 CAGGCCCAGGCTCCTGGAGGAGG - Exonic
1145252709 17:21305100-21305122 GATGCCCAGGCTCCAGACGTCGG - Exonic
1145773317 17:27509016-27509038 CAGGCCCAGGCTGGGAACGGTGG - Intronic
1146322593 17:31858764-31858786 CTCGCCCAGGCTCCTGGCAGCGG + Intronic
1146457288 17:33017782-33017804 AAGGCCCAGGCTCCCCATGGAGG - Intronic
1148793551 17:50186734-50186756 CTGGCTCAGGCTCTTGAGGGTGG + Exonic
1149770373 17:59316184-59316206 GAGGCCCAGGCTCCCAACAGAGG - Intergenic
1150632660 17:66890869-66890891 CAGCCCCTGCCTCCTGATGGAGG + Intergenic
1151597555 17:75087788-75087810 CAGGGCCGGGCTCCGGACGCAGG - Intronic
1151915589 17:77115545-77115567 CAGACCCTTGCTCCTGACTGTGG + Intronic
1151918085 17:77133463-77133485 CAGACTCAGGCTCCTAATGGGGG + Intronic
1151946681 17:77323513-77323535 CAGGCCCGGGGTCCTGGAGGGGG + Intronic
1151952889 17:77364881-77364903 CAGGCCCAGGCCGCTGAGGCTGG + Intronic
1152509367 17:80774986-80775008 CAGGCCCAGGAGCCCGAGGGAGG - Intronic
1152573011 17:81128691-81128713 GAGACCCTGGCTCCTGATGGTGG - Intronic
1153174827 18:2359214-2359236 CAGGTCCAGGCACATGAGGGTGG - Intergenic
1153769204 18:8401699-8401721 AAGGCTCGGGCCCCTGACGGAGG + Intronic
1156483562 18:37450853-37450875 CAGGCCAAGGCTAGTGACAGAGG - Intronic
1156494965 18:37519696-37519718 AAGGCCCAGGCCACTGAGGGGGG - Intronic
1157745744 18:50133763-50133785 GAGTCCCAGGCTCCTGGAGGTGG - Intronic
1160277156 18:77447814-77447836 CAGGTCCAGGCAGCTGAGGGAGG + Intergenic
1160364572 18:78313255-78313277 CAGGCCCAGGCTCCTGGGGACGG + Intergenic
1160502940 18:79411234-79411256 CAGGTCCAGGCTGCTGTCGGTGG - Exonic
1160806317 19:993722-993744 CTGGCCCAGGCCCCTGTCTGTGG + Intronic
1160870230 19:1274599-1274621 CAGGCGCGGGCTCCAGGCGGGGG - Intronic
1160946449 19:1646102-1646124 CAGACCCAGGCTCCAGGCGCGGG + Intronic
1161233690 19:3187797-3187819 AAGGCCCAGGCTCTGGAGGGTGG + Intronic
1161762682 19:6185856-6185878 CAGGTCCATCCTCCTGAGGGTGG - Intronic
1162028780 19:7908628-7908650 CAGGCCCCAGCTCCTGTGGGAGG + Intronic
1162040678 19:7969090-7969112 CAGGCCAAGGCTCATGCCTGTGG + Intronic
1162067768 19:8136577-8136599 GAAGCCCAGGCTCCAGACTGGGG - Intronic
1162874405 19:13610141-13610163 CAGGCGCAGGCACCTGGCTGGGG - Intronic
1163034839 19:14564482-14564504 CAGGCCTAGGGGCCCGACGGGGG - Intronic
1163122441 19:15226055-15226077 CAGGCCTGGGGTCATGACGGGGG + Intergenic
1164402443 19:27911279-27911301 CAGTCCCTGGCTCCCGGCGGTGG - Intergenic
1164605343 19:29593926-29593948 CAGGCTCAGCCTCCTGCCGCTGG + Intergenic
1164917778 19:32065845-32065867 CAGGGCCAGGCTCCTGGGGCAGG + Intergenic
1165325144 19:35110050-35110072 CAGCCCCAGCCCCCTAACGGTGG - Intergenic
1165455711 19:35909428-35909450 CAGCCCCAGGCTCCAGCTGGGGG - Intergenic
1166046346 19:40233070-40233092 CAGGCCCAGGGTCCAGCGGGAGG + Exonic
1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG + Exonic
1166140724 19:40803802-40803824 CAGTCACAGGCTTCTGACTGGGG + Intronic
1166663283 19:44661401-44661423 AAGACCCAGGCTCCTGAGGCCGG - Intronic
1166720924 19:44995380-44995402 AAAGCCCAGGCTCCTTACTGGGG + Intergenic
1166728210 19:45041726-45041748 AAAGCCCAGGCTCCTCACTGTGG + Intronic
1167489351 19:49782625-49782647 CAGGGCCAGGCACATGAAGGTGG - Exonic
1167709851 19:51103953-51103975 CAGGCGCATGCTCCAGAAGGCGG - Intronic
1167818381 19:51904430-51904452 CAAGCCCAGGCCCCTGGCTGGGG - Intronic
1168571747 19:57476481-57476503 CAAGCCCAGGGTCCTGACTCCGG - Intronic
925318290 2:2941480-2941502 CAGGGCCAGGCTCCTGGTGTCGG - Intergenic
925640324 2:5980921-5980943 CAGGCACAGGCTCCTCACGTGGG + Intergenic
928307274 2:30180505-30180527 AAGGGCCAGGCTCCTGAAAGAGG + Intergenic
930744754 2:54870781-54870803 GAGGCCCAGTCTCCTGCAGGTGG - Intronic
931701573 2:64913451-64913473 AAGCCCCAGACTCCTGAGGGAGG + Intergenic
931948809 2:67338110-67338132 CAGGCCCAGGCTCCTCCTGGAGG + Intergenic
932621133 2:73265497-73265519 CGGGCCCAGGCTGCCAACGGGGG - Exonic
936377539 2:111954781-111954803 GGGGCCCAGGCTGCTGACTGTGG + Intronic
936933589 2:117815464-117815486 CAGTCCCAGTGTCCTGACAGTGG + Intronic
937289944 2:120776108-120776130 CCTGCCCAGGCACCTGATGGGGG - Intronic
941903203 2:170697115-170697137 CAGACCCTGGCTTCTGACCGAGG + Intergenic
941930082 2:170929832-170929854 CAGGCCCCGCCTCCGGACTGCGG - Intronic
942148474 2:173050551-173050573 CAGACCCTGGCTCCTGACCGGGG - Intronic
943849482 2:192699100-192699122 CTGGCCCAGGATCCTGAGAGAGG - Intergenic
946164853 2:217857743-217857765 CAGACCCAGCCTCCTGACTCCGG + Intronic
946921278 2:224584726-224584748 CAGGCCCGGGCTCCCGGCGCGGG + Intronic
947992484 2:234497711-234497733 CAGGCCTGGGCTCCGGAGGGCGG - Intergenic
1168768166 20:396338-396360 CACGCCCAGGCTCCAGACATCGG - Exonic
1169641475 20:7757215-7757237 CAGGCCCAGGCTTCTTGAGGTGG + Intergenic
1170603556 20:17859667-17859689 CGCGCCCAGGCTCCTGAGGGAGG + Intergenic
1171079160 20:22160497-22160519 CAGCCCCAGGATCCTGCGGGAGG - Intergenic
1172773697 20:37395624-37395646 CAGGCCCAGGCTCAGGCGGGAGG - Intronic
1174445046 20:50585353-50585375 CAGGCCCAGGCTCATGAGACTGG + Intergenic
1175418681 20:58817704-58817726 CAGGCCCAGCCTCATGTGGGAGG - Intergenic
1176059935 20:63168108-63168130 CAGGCCCAGACGCCTGCCAGGGG - Intergenic
1176115821 20:63431584-63431606 CAGGGCCAGGCTCCTAAGGTCGG + Intronic
1178922582 21:36748104-36748126 CGGGTCCAGGCTCCTGGCGCGGG - Exonic
1179176872 21:39014246-39014268 CAGTGCCAGGCACCTGACAGTGG - Intergenic
1180199487 21:46215877-46215899 CTGGCCCAGGGCCCTGAGGGCGG - Intronic
1182696415 22:32202027-32202049 CAGGGCCGGGCTCCTTCCGGGGG + Intronic
1183345770 22:37306951-37306973 CAGCCCCAGGCTCCAGGAGGGGG - Intronic
1183530675 22:38351725-38351747 CGGGCCCAGGCTCGAGGCGGGGG + Intronic
1183662900 22:39231844-39231866 CAGGCCTACGCTCCTGACCCAGG - Intronic
1185032162 22:48449827-48449849 CGGGCCCAGGCTCTGGTCGGCGG + Intergenic
1185125883 22:49010627-49010649 CAGGCCCAGACTCCCGACTCCGG - Intergenic
1185341709 22:50293928-50293950 CAGGCCCAGGCTTTTCAGGGTGG + Intronic
950884053 3:16347419-16347441 CAGGCCCATGCTCCTTTTGGAGG + Intronic
952652106 3:35739022-35739044 AAGGCACAGGCTCCTCAGGGTGG - Intronic
953070513 3:39515153-39515175 CAAGGCCAGGCCCCTGAAGGGGG - Exonic
954456910 3:50604626-50604648 CAGGGCCCGGCTCCTGTCTGGGG - Intergenic
959653909 3:108779294-108779316 CAGGTCCAGGCAGCTGACTGAGG + Intergenic
961633075 3:128315542-128315564 CAGGCCCTGGCTTCTGGCAGAGG - Intronic
962352522 3:134666241-134666263 TGGGCCCAGGGTCCTGACAGTGG + Intronic
962368600 3:134802618-134802640 CAGGCCCAGGCTTGTGCAGGTGG + Intronic
962581837 3:136804997-136805019 TAGGCACAGGCTCCTAAGGGGGG - Intergenic
966853893 3:184181018-184181040 CAGGCCCAGGATCCTGCCCTGGG - Intronic
967001652 3:185341403-185341425 CAGGCCCATGCTCCTGCTGAAGG - Intronic
968428341 4:537622-537644 CAGGCCCTGGCTCCTTAGGCGGG - Intronic
968483606 4:848378-848400 GAGGCTCAGGCCCCTGACGGAGG + Intergenic
969057925 4:4413698-4413720 CAGGCACAGGCCCCTGGAGGAGG + Intronic
969468487 4:7371800-7371822 CACGCCCAGGCCTCTGACGGAGG + Intronic
969712143 4:8850465-8850487 TAAGCCCAGGCTCCTGGCTGGGG + Intronic
969758917 4:9168563-9168585 CAGGCCCAGGCCACTGGAGGAGG + Intergenic
971066138 4:23035440-23035462 CAGGCCCAGGCTGCTGATTTAGG + Intergenic
973637111 4:52870576-52870598 CAGACCCAGGCCCCAGACAGGGG + Intergenic
974701944 4:65462541-65462563 AAGCCCCAGACTCCTGAAGGAGG - Intronic
974916245 4:68182356-68182378 GTGGACCAGGCTGCTGACGGCGG - Intergenic
978713835 4:111817675-111817697 CATGCCCAGACTCCTGACACAGG + Intergenic
981163092 4:141522302-141522324 CACACCCAGGCTCCTGAAAGAGG + Intergenic
983649760 4:170026415-170026437 CCGGCCCAGGCTCCTGTAGGTGG - Intronic
984845454 4:184104355-184104377 CAGGCCCAAGCTTCTAAAGGAGG - Intronic
984873896 4:184350504-184350526 CTGGCCCAGCCTCCTGAAGAGGG + Intergenic
985883526 5:2658255-2658277 CTTGCCAAGGCCCCTGACGGGGG - Intergenic
985931776 5:3064085-3064107 CAGGCTCAGCCTCCTGGTGGAGG - Intergenic
986206731 5:5631524-5631546 CAAGCCTAGGCTCCAGACGAAGG - Intergenic
988604221 5:32666321-32666343 CAGGCCCAGTGTCCAGAAGGAGG + Intergenic
990586391 5:57215542-57215564 GAGGCCCAGTCTCCTGAGGTTGG + Intronic
992616616 5:78551666-78551688 CAGTCCCAGTCTCCTGAGGCAGG + Intronic
994619149 5:102142311-102142333 CAAGCCCAGACTCCTGAATGTGG + Intergenic
996339718 5:122423082-122423104 CAGGGCCAAGCTCCTGAGGCTGG - Exonic
997475824 5:134141875-134141897 CAGCCACAGGCTCCTGAGGCTGG + Intronic
997479762 5:134176523-134176545 AAGGCCCAGGCTGCGGCCGGGGG - Intronic
998106168 5:139470848-139470870 CACACCCAGGCTCCTGAAGCTGG + Intergenic
998442709 5:142175598-142175620 CAGGGCCAGGGACCTGAAGGTGG + Intergenic
998527549 5:142856507-142856529 AAGGCCCAGGCTCCCTAAGGAGG + Intronic
999440348 5:151595782-151595804 CTGGCCCAGGCTGCTGCTGGTGG + Intergenic
1002164941 5:177338309-177338331 CAGAGCCAGGCTCCTTCCGGAGG + Intronic
1002309984 5:178308585-178308607 CAGGCCCATGCTCCTGGCCGAGG + Intronic
1002414630 5:179113349-179113371 CAGGGCCAGGCGGCTGACCGGGG - Exonic
1002820032 6:716400-716422 CAGGCCCCAGCTGCTCACGGGGG + Intergenic
1003756694 6:9128817-9128839 CAGGCCCAGACACCTGACCTTGG + Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006072288 6:31506648-31506670 CAGGCTCAGGCTTCTGTCAGAGG - Intronic
1006358678 6:33575492-33575514 CAGGCCCTGGCTCATGGCAGAGG + Intronic
1006410623 6:33871274-33871296 CTGGCTCAGGCTCCAGAAGGTGG - Intergenic
1007412974 6:41675396-41675418 CAGGCCCTGGCTCTTGGTGGGGG + Intergenic
1008093016 6:47310890-47310912 AAGGCCGAGTCTCCTGACTGTGG + Intergenic
1011629887 6:89312998-89313020 CAAGCCCAGGCTGCTGAGTGGGG + Intronic
1018091507 6:160349558-160349580 CAGGCGGAGGCTGCTGCCGGCGG + Intronic
1019215529 6:170440505-170440527 GAGACCCAGGCTCCTGACGGAGG - Intergenic
1019347898 7:539593-539615 CAGGCCCAGGCTCCCTACACTGG + Intergenic
1019710954 7:2518099-2518121 CAGCCCCAGCCTCCGGACTGAGG - Intronic
1020013469 7:4818409-4818431 CAGCCCCAAGCCCCTGAAGGAGG - Intronic
1023835423 7:44064803-44064825 CCTGCCCAGGCTCCTGAAGGTGG + Intronic
1023849928 7:44144930-44144952 CAGCCCCAGGGCCCTAACGGGGG - Exonic
1023990130 7:45123858-45123880 CTGTCCCGGGCTCCTGAGGGAGG - Intergenic
1025230580 7:57201260-57201282 CAGGACCAGGCTGCTGATGTTGG + Intergenic
1025994292 7:66518482-66518504 CAGGCCCAAGCTGCTCACTGAGG + Intergenic
1026048124 7:66921720-66921742 CAGGCCTCGGCTCCAGACGTGGG - Intronic
1026479691 7:70766762-70766784 CAGTCCCAGCCTCCTGGCAGAGG - Intronic
1026975484 7:74495252-74495274 CAGGCCCAGGCTCTGGGCTGAGG + Intronic
1029298340 7:99558978-99559000 CGGTCGCCGGCTCCTGACGGCGG - Exonic
1033413838 7:141145224-141145246 CAGTCCCTGGCTCCTGAGGAGGG + Intronic
1034129045 7:148698971-148698993 CAGGCCCAGGGACCAGGCGGAGG + Exonic
1034267602 7:149788794-149788816 CAGGCACAAGCTCCTCACAGTGG - Intergenic
1036930585 8:12951884-12951906 CGGGCCCAGGCGCCGGACGCCGG + Intronic
1037750783 8:21680810-21680832 CAGGCCCAGGCTCAGCACAGGGG + Intergenic
1037880549 8:22571436-22571458 CCGGCCCAGGCTCCTGACCCTGG + Intronic
1037977562 8:23224525-23224547 CGGGCCCAGCCTCCTGCGGGAGG + Intronic
1038963522 8:32548139-32548161 CGAGCCCAGGCTCCTCCCGGTGG + Intronic
1040079919 8:43275519-43275541 CAGGCCCAGGCCCCTGCCGAGGG - Intergenic
1047186190 8:122635404-122635426 CATGCCCAGGCTCCTACCAGAGG - Intergenic
1049423171 8:142525753-142525775 CAGGCCCAGGTTCCAGAAGCTGG - Intronic
1049573628 8:143380779-143380801 CAGGCCCTGGCTGCTCACGCTGG - Exonic
1049592704 8:143469785-143469807 CAGGACCAGCCTGCTGAGGGCGG + Intronic
1049696805 8:143988049-143988071 CAGTCCCAGGCTACTGAGGCAGG - Intronic
1053119972 9:35539087-35539109 CAGCTCAAGGCTCCTGACAGAGG + Exonic
1053222794 9:36325921-36325943 CAGGCCCAGGGTCCTGAAGAAGG + Intergenic
1057146855 9:92764456-92764478 CAGGCCCCGGCGCCGGGCGGGGG + Intronic
1057435960 9:95040693-95040715 CTGGCCCAAGCTCCTGGAGGTGG + Intronic
1059889036 9:118780446-118780468 CACACCCAGGCTCCTGGCTGGGG - Intergenic
1060291505 9:122307209-122307231 CAGGCCCATGCTCCTGTAGGGGG + Intronic
1060496850 9:124125561-124125583 CAGGCCCAGGCCTCTGACCAGGG - Intergenic
1061027187 9:128057347-128057369 CAGCCACAGCCTCCTGGCGGTGG + Intergenic
1061202587 9:129146247-129146269 CAGGCCCAGGATCCTGGCTGTGG + Intronic
1061674945 9:132210392-132210414 CAGCCCCAGGCGAGTGACGGAGG - Intronic
1061777088 9:132972901-132972923 CAGGTCCAGGCTCCTTACCGGGG - Intronic
1062084861 9:134643166-134643188 CTGGCGCAGCTTCCTGACGGGGG + Intronic
1062112755 9:134790992-134791014 CACTCCCATGCTCCTGACTGGGG + Intronic
1062193998 9:135263303-135263325 CAGGGCCATGCTCCCCACGGAGG - Intergenic
1062388948 9:136326603-136326625 AAGGCCCAGGATGCTGTCGGGGG + Intergenic
1062561296 9:137143250-137143272 CAGGCCCAGGCTCTTCTGGGAGG + Intronic
1189397955 X:40640497-40640519 CAGGGCTATGCTCCTGATGGTGG + Intronic
1189487358 X:41443812-41443834 TAGGTCCAGTCTCCTGAAGGTGG - Intergenic
1192138861 X:68630815-68630837 CAGGCCGTGGCAGCTGACGGTGG - Intergenic
1192314142 X:70038992-70039014 CCTGGCCAGGCTCCTGAAGGGGG - Exonic
1197717802 X:129722039-129722061 CAGCCCCAGCATCCTGAAGGGGG + Intergenic
1199607100 X:149586110-149586132 CAGGGCCAGGACCCTGAGGGAGG - Intronic
1199632022 X:149783258-149783280 CAGGGCCAGGACCCTGAGGGAGG + Intronic
1199991871 X:152991992-152992014 CAGGCCCTGCCTCCTGACGTTGG - Exonic
1200097046 X:153669340-153669362 CAGTCCCAGGCACCTGGCTGAGG + Intergenic