ID: 917966678

View in Genome Browser
Species Human (GRCh38)
Location 1:180183230-180183252
Sequence GAGGGCTGCCCCGGGGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 517
Summary {0: 1, 1: 0, 2: 5, 3: 62, 4: 449}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917966678_917966690 20 Left 917966678 1:180183230-180183252 CCAGCTCCCCCGGGGCAGCCCTC 0: 1
1: 0
2: 5
3: 62
4: 449
Right 917966690 1:180183273-180183295 GTCTCTCTCTGCAGGTGCCCTGG 0: 1
1: 0
2: 2
3: 52
4: 408
917966678_917966691 26 Left 917966678 1:180183230-180183252 CCAGCTCCCCCGGGGCAGCCCTC 0: 1
1: 0
2: 5
3: 62
4: 449
Right 917966691 1:180183279-180183301 CTCTGCAGGTGCCCTGGCTGTGG 0: 1
1: 0
2: 3
3: 53
4: 466
917966678_917966687 12 Left 917966678 1:180183230-180183252 CCAGCTCCCCCGGGGCAGCCCTC 0: 1
1: 0
2: 5
3: 62
4: 449
Right 917966687 1:180183265-180183287 GACCCGGCGTCTCTCTCTGCAGG 0: 1
1: 0
2: 1
3: 4
4: 143
917966678_917966692 27 Left 917966678 1:180183230-180183252 CCAGCTCCCCCGGGGCAGCCCTC 0: 1
1: 0
2: 5
3: 62
4: 449
Right 917966692 1:180183280-180183302 TCTGCAGGTGCCCTGGCTGTGGG 0: 1
1: 0
2: 4
3: 42
4: 306
917966678_917966686 -4 Left 917966678 1:180183230-180183252 CCAGCTCCCCCGGGGCAGCCCTC 0: 1
1: 0
2: 5
3: 62
4: 449
Right 917966686 1:180183249-180183271 CCTCACGCTGCTGCTGGACCCGG 0: 1
1: 0
2: 3
3: 18
4: 263
917966678_917966683 -10 Left 917966678 1:180183230-180183252 CCAGCTCCCCCGGGGCAGCCCTC 0: 1
1: 0
2: 5
3: 62
4: 449
Right 917966683 1:180183243-180183265 GGCAGCCCTCACGCTGCTGCTGG 0: 1
1: 0
2: 0
3: 39
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917966678 Original CRISPR GAGGGCTGCCCCGGGGGAGC TGG (reversed) Intronic
900117097 1:1033554-1033576 TGGGGCTGGGCCGGGGGAGCAGG - Intronic
900534608 1:3170684-3170706 GAGGCGGGGCCCGGGGGAGCAGG + Intronic
900663088 1:3795833-3795855 GGGGGCTGCCCGGGCGGGGCGGG - Intronic
900764147 1:4492786-4492808 CAGGGAAGCCCCAGGGGAGCTGG - Intergenic
901754733 1:11434671-11434693 GAAGACAGCCCCTGGGGAGCTGG - Intergenic
902048538 1:13543695-13543717 AAGGACTTCCCGGGGGGAGCTGG - Intergenic
902214351 1:14924781-14924803 GGGGGCTGCACCGGGGGGCCAGG + Intronic
902431558 1:16367357-16367379 GAGGGGAGCCTCCGGGGAGCGGG + Intronic
902866809 1:19285122-19285144 GAGAGGGGCCCCGGGGGAGAGGG + Intronic
904379399 1:30101078-30101100 GGGGGCTGCCCCGAGGAAGGAGG - Intergenic
904593245 1:31626983-31627005 GAGGGCTGCCCTGGAGGCTCCGG + Exonic
905867064 1:41382225-41382247 GCTGGGTGCGCCGGGGGAGCTGG + Exonic
905886973 1:41496717-41496739 GAGGGCTGCCCAGGAGGAGGGGG + Intergenic
906365350 1:45205795-45205817 GACGGATGCCCCGGCGGAACGGG + Exonic
907022831 1:51086046-51086068 CAGTGCTGCCCCTGAGGAGCAGG - Intergenic
907069159 1:51518865-51518887 GAAAGCTGCCCCGCGGGAGCCGG + Intronic
907430042 1:54406322-54406344 GAGGGCGGCGCAGGCGGAGCCGG - Exonic
908832202 1:68190630-68190652 GAGGGCTCCACCGGGGAAGGGGG - Intronic
910682707 1:89883564-89883586 GAGAGATGCCCTGGAGGAGCCGG + Intronic
910691749 1:89972604-89972626 GCAGCCTGCCCCGGGGTAGCTGG - Intergenic
912391736 1:109307502-109307524 GCCCGCTGCCCCCGGGGAGCGGG - Intergenic
912453010 1:109778882-109778904 GAGGGGAGCCCTGGAGGAGCAGG - Intergenic
914431772 1:147625077-147625099 GAGGGCTGCTTTGGGGGAGGGGG + Exonic
914754344 1:150554288-150554310 CAGGGCTGAACCTGGGGAGCAGG - Intronic
916244240 1:162671142-162671164 GAGGGCTGCCCCTGAGGAGCTGG + Intronic
917724298 1:177814282-177814304 CAGGGCTGCCCAGGGGGAGGAGG + Intergenic
917966678 1:180183230-180183252 GAGGGCTGCCCCGGGGGAGCTGG - Intronic
918321953 1:183372989-183373011 GATGGCCTCCCTGGGGGAGCTGG - Intronic
918448397 1:184636185-184636207 GAGAGTAGCCCCAGGGGAGCTGG + Intergenic
918472163 1:184885600-184885622 GAGAGCTGCCCTGTTGGAGCTGG - Intronic
920135327 1:203764635-203764657 GAAGGTTGCCTTGGGGGAGCAGG + Intergenic
920435396 1:205943730-205943752 CAGGGCCGCCTTGGGGGAGCCGG - Intergenic
920504726 1:206507791-206507813 GAGGGCTGCCCGGGGGAACCTGG + Exonic
921314155 1:213874897-213874919 AAGGGCTGCCCCGGGGAAGGGGG - Intergenic
922209708 1:223478212-223478234 GAGGGAGGGCCGGGGGGAGCAGG - Intergenic
922295375 1:224245483-224245505 CAGAGCTGCCCAGGAGGAGCAGG - Intronic
922481237 1:225941140-225941162 TGGTGCTGCCCTGGGGGAGCAGG + Exonic
922698686 1:227745315-227745337 GATGGCTGCACCTGGGGAGAGGG - Intronic
923523211 1:234752264-234752286 GAGGGCTGTCTGGAGGGAGCAGG + Intergenic
923620835 1:235577818-235577840 GAGGGCAGCCCTGGGGAAGGAGG - Intronic
924090275 1:240493881-240493903 GATGGCTGCCCAGGGGCAGCTGG + Intronic
924100220 1:240595444-240595466 AAGGGCTGCCCAGGAGGAGGGGG - Intronic
924539925 1:244970819-244970841 GCGGGCTGCGCCGGAGGCGCCGG + Exonic
1062953578 10:1524694-1524716 GGTGGCTGCCCGGGGGGAGGTGG + Intronic
1064147900 10:12839999-12840021 GGGCTCTGCCCAGGGGGAGCTGG - Intergenic
1064354412 10:14604342-14604364 GAGGGCGGCTCCGGGGGCGGCGG + Intronic
1064418385 10:15169090-15169112 CAGGGCTGGCCAGGGTGAGCAGG - Intergenic
1066299864 10:34087091-34087113 GAGAGCTGCCCCAGTGAAGCAGG - Intergenic
1067060799 10:43077032-43077054 GCCGGCTGCGCCGGAGGAGCGGG - Exonic
1067937188 10:50623029-50623051 CAGGGCTGCCCCCGCGGGGCGGG - Intronic
1069729736 10:70602861-70602883 GAGGGCTGTCAGTGGGGAGCCGG - Intergenic
1069991905 10:72321323-72321345 GAGGGCTGGCCGGGGGGGTCCGG + Intergenic
1070257604 10:74825429-74825451 GCGGGCGGCGCGGGGGGAGCGGG + Intergenic
1070828066 10:79402605-79402627 GGGGGCTGCTCTGGTGGAGCTGG + Intronic
1070843197 10:79502459-79502481 GAGGGCTGTCCTGTGGGAACAGG + Intergenic
1070930473 10:80257175-80257197 GAGGGCTGTCCTGTGGGAACAGG - Intergenic
1071566595 10:86674410-86674432 AAGGGCAGCCCAGGGAGAGCTGG - Intronic
1073178316 10:101569717-101569739 AAGAGCTTCCCCGGGGGAGCTGG + Intergenic
1073423381 10:103441755-103441777 GTGGGCTGGCACGGGGGAACAGG + Intronic
1074103773 10:110374211-110374233 GAGGGCAGGTCCGGGGGAACTGG + Intergenic
1075082565 10:119393612-119393634 GCGGGCTGTCCAGGGGCAGCAGG + Intronic
1075293664 10:121253301-121253323 GAGGGCTTCCTGGGGGAAGCAGG - Intergenic
1075516030 10:123109014-123109036 GAGAGCTGCCCCAGGGAAGCTGG - Intergenic
1075995515 10:126873474-126873496 GGGGTCTTCCCCAGGGGAGCAGG - Intergenic
1076627652 10:131831834-131831856 GAGTGCAGCCCTGGGGAAGCCGG + Intergenic
1076868571 10:133181557-133181579 GTGGGCTGCCCCAGGGCACCAGG + Intronic
1076947520 10:133661393-133661415 GAGGGCTGCCCCTGGACAGCAGG - Intergenic
1076947995 10:133665010-133665032 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076948985 10:133668320-133668342 AACGGAGGCCCCGGGGGAGCTGG + Intronic
1076949969 10:133671619-133671641 AACGGAGGCCCCGGGGGAGCTGG + Exonic
1076950953 10:133674918-133674940 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076951943 10:133678228-133678250 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076952932 10:133681538-133681560 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076953916 10:133684837-133684859 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076954900 10:133741189-133741211 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076955889 10:133744499-133744521 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076956879 10:133747809-133747831 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076957866 10:133751118-133751140 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076958851 10:133754417-133754439 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076959840 10:133757727-133757749 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076960824 10:133761026-133761048 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1077059247 11:610519-610541 GAGGGCTGGGCCGGGGCAGGCGG - Exonic
1077160375 11:1109887-1109909 GAGGGGTGCCTGGGGAGAGCGGG - Intergenic
1077201362 11:1309200-1309222 GGAGGCAGCCCCGGGGGAGGGGG - Intronic
1077227681 11:1445504-1445526 GAGCGCTGCCCCGGAGGAGCCGG + Intronic
1077268893 11:1665955-1665977 GAGGGCGGGCCCGGGAGATCTGG + Intergenic
1077271859 11:1685225-1685247 GAGGGCGGGCCCGGGAGATCTGG - Intergenic
1077331721 11:1986929-1986951 GGGGGCTGCTCAGGGGGTGCAGG + Intergenic
1077443934 11:2581490-2581512 GAGGGGGGCCCTGGGGGAACCGG - Intronic
1077631774 11:3816152-3816174 GAGGGCAGGCCCTGAGGAGCAGG + Intronic
1078594928 11:12677362-12677384 GAGGGCAGCCTGGGGGGAGTCGG + Intronic
1079135757 11:17775286-17775308 GGGGGCTGGCCTGGGGGGGCGGG - Intronic
1080824048 11:35832970-35832992 GAGGGCTGCTGAGGGGAAGCTGG + Intergenic
1081488219 11:43547782-43547804 GGGGGCTTCCCCGGGGGGGGGGG + Intergenic
1083300810 11:61738836-61738858 GAGGGCTCGCCCGGGGCAGGGGG - Intronic
1083602532 11:63957892-63957914 CAGCCCTGGCCCGGGGGAGCTGG + Intergenic
1083639392 11:64137123-64137145 AAGGGTTGCCCCTGGGGGGCTGG - Intronic
1089076908 11:115745616-115745638 GACTGCTGCCCCGGGGAACCTGG - Intergenic
1089584579 11:119502327-119502349 GGGGGCTGCCCAGGGGGCTCAGG + Intergenic
1089682573 11:120127464-120127486 GAGGGCTGCGCTGGAGCAGCGGG - Exonic
1089743644 11:120602071-120602093 GAAGGCAGCCCCGGGGTACCTGG - Intronic
1090658365 11:128862502-128862524 TAGGGCAGCCCCGGGGGGGATGG - Intronic
1091264662 11:134261278-134261300 GTGGGCAGCCCCCAGGGAGCAGG - Exonic
1091349387 11:134880974-134880996 CCGGGCTGCCCCGGGGGCGCTGG + Intergenic
1202814702 11_KI270721v1_random:42105-42127 GGGGGCTGCTCAGGGGGTGCAGG + Intergenic
1091823113 12:3491077-3491099 GGGGGCGGGCCCGGGGGCGCTGG + Intronic
1092282341 12:7108053-7108075 GATGGCAGCCCCGGAGGCGCTGG + Intronic
1092963817 12:13622378-13622400 GAGGCCTGCCCCGGGGCTGCAGG - Intronic
1095776715 12:46018200-46018222 GAGCGCAGCACCGGGTGAGCTGG - Intergenic
1095878378 12:47106475-47106497 GAGGGCTGTTCCGAGGGAGCTGG - Intronic
1099713720 12:86264456-86264478 GCGGGCTGCAGCGGGGGAGGCGG + Intronic
1101439891 12:104695759-104695781 GAGGGCTGTGAAGGGGGAGCTGG - Intronic
1101612125 12:106302314-106302336 GGGGGCTGAGCGGGGGGAGCGGG - Intronic
1101639917 12:106580649-106580671 GAGGGATGCCACGGGGGCACGGG - Intronic
1103077196 12:117993574-117993596 GGTGGCTGCCTCTGGGGAGCAGG - Intergenic
1103319133 12:120080412-120080434 AAGGGCTGTCACGGGGGAGCAGG + Intronic
1103357362 12:120331632-120331654 CAGGGCTGCCCCATGGGAGGTGG + Intergenic
1103856348 12:123973173-123973195 CGGGGAAGCCCCGGGGGAGCGGG - Exonic
1103923011 12:124409269-124409291 GAGAGCTGCCCTGAGGGAGGTGG - Intronic
1104747529 12:131219633-131219655 GAGGGCTGTCCCGGGGACTCTGG + Intergenic
1104913528 12:132251933-132251955 GGGGGCAGGCCTGGGGGAGCTGG - Intronic
1104970719 12:132529471-132529493 AAGGGCAGCCTCAGGGGAGCTGG - Intronic
1104982086 12:132577630-132577652 GAGGGGTGACCCGGGGGAGGGGG - Intronic
1106621432 13:31374440-31374462 GAGGGGTGATCCAGGGGAGCTGG - Intergenic
1107058394 13:36130894-36130916 GCGGGCGGCCCCGGGGCTGCTGG - Intronic
1107238526 13:38202443-38202465 GAGGGCTACTCCCGGGGAGCAGG + Intergenic
1107879463 13:44820512-44820534 TGGGGCTTCCCTGGGGGAGCTGG + Intergenic
1107943309 13:45394173-45394195 TAGGGTTGCCCAGGGAGAGCTGG + Exonic
1108408312 13:50125452-50125474 GAGCGCTGCGCCGGGGGAGGGGG - Intronic
1110705937 13:78602175-78602197 GGCGGCGGCCCCGGGGGAGGCGG - Exonic
1111998472 13:95188457-95188479 GTGGTCGGCCCCGTGGGAGCAGG - Exonic
1112261190 13:97879873-97879895 CAGGGCTGCCTCGAGAGAGCAGG - Intergenic
1113494151 13:110714388-110714410 GAGGGCCGCCGCTGCGGAGCCGG - Intronic
1113640561 13:111954016-111954038 GATGGACGCCCCGGGGGTGCTGG + Intergenic
1113660276 13:112103040-112103062 GAGCCCTGCCCTGGAGGAGCTGG + Intergenic
1113901508 13:113800739-113800761 CAGGGCTGCCTCATGGGAGCTGG - Intronic
1113932905 13:113977686-113977708 GAGGGTGGCACCTGGGGAGCAGG - Intergenic
1113936182 13:113996265-113996287 AGGCCCTGCCCCGGGGGAGCGGG - Intronic
1117353356 14:54902051-54902073 GAGGGCTGCGCGCTGGGAGCGGG + Intronic
1117472555 14:56060974-56060996 GAAGGATGGCCTGGGGGAGCAGG - Intergenic
1118894076 14:69931317-69931339 GAAGACTGCCCGGAGGGAGCGGG - Intronic
1119322458 14:73739920-73739942 GGGGGCTGCTCCTTGGGAGCTGG + Exonic
1119388801 14:74276276-74276298 TAGGCCTGCCTTGGGGGAGCCGG + Intergenic
1120953495 14:90062181-90062203 GGGGGCTGCCCCCGGGGGCCCGG + Exonic
1121439844 14:93941698-93941720 AGGGGCTGCCCCGGGGCCGCTGG + Intronic
1121639807 14:95477646-95477668 GTGGGCTGGCCAGGGGGAGGTGG + Intergenic
1121728144 14:96167821-96167843 GAGGGCTCCCCTGGTGGGGCTGG - Intergenic
1122117697 14:99535937-99535959 GAAGGGTGCCCTGGGTGAGCTGG + Intronic
1122122471 14:99561786-99561808 GAGGGATGCCAGGTGGGAGCAGG + Intronic
1122158205 14:99763875-99763897 GAGGACAGCCCTGGAGGAGCCGG + Intronic
1122203266 14:100135527-100135549 GTGTGCTGCACAGGGGGAGCAGG + Intronic
1122406615 14:101504712-101504734 GAGTGCGGCCGCGGGGGAGGAGG + Intergenic
1122640813 14:103158106-103158128 GAGCGCTGCACAGAGGGAGCCGG - Intergenic
1123031883 14:105455848-105455870 GAGGGCTGGGCCTGGGGAGGAGG + Intronic
1123034290 14:105465617-105465639 GAGTGCTGCCCCTGTGGAGTGGG - Intronic
1123106855 14:105845792-105845814 GAGGAGTGCCCAGGGTGAGCGGG + Intergenic
1202853801 14_GL000225v1_random:37529-37551 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1202859360 14_GL000225v1_random:72038-72060 AACGGAGGCCCCGGGGGAGCTGG - Intergenic
1125509728 15:40286464-40286486 GAGGGCTGCTCAGGGGATGCAGG + Intronic
1125589355 15:40844669-40844691 GCGGGCAGCCCAGGGGGCGCGGG - Exonic
1125606308 15:40941745-40941767 GAGGGCTGACCCGGGCGGGCAGG - Intergenic
1125780415 15:42261085-42261107 GAGTGCTGCACCTGGGGAGCAGG - Intronic
1125921443 15:43527996-43528018 GAGGGCAGCTGTGGGGGAGCTGG - Exonic
1128349309 15:66878297-66878319 GGGGGCTGACAGGGGGGAGCAGG + Intergenic
1128720051 15:69941519-69941541 GAGGGGTGCGCAGGGGGCGCGGG + Intergenic
1129460908 15:75699705-75699727 GAGGGCTGGGCCGGGGGAGGAGG + Intronic
1129464523 15:75716475-75716497 GAGGGCGGGCCCTGGGCAGCAGG - Intergenic
1129660392 15:77549845-77549867 GAGGGCTGCCCCTGGAGAGCAGG + Intergenic
1129672258 15:77613884-77613906 GAGGGCTGGCGGGGGGCAGCAGG + Exonic
1129720724 15:77876537-77876559 GAGGGCGGGCCCTGGGCAGCAGG + Intergenic
1129723911 15:77892012-77892034 GAGGGCTGGGCTGGGGGAGGAGG - Intergenic
1130102417 15:80903983-80904005 GTGGGCTGCCCTGGAGGAGGGGG + Intronic
1130209336 15:81908968-81908990 GAGGGCTGACCTTGGGGAGTAGG - Intergenic
1131107173 15:89743218-89743240 GAGGTCTGCCCTGGGGGCTCGGG + Intronic
1131829094 15:96343047-96343069 GGGGGCCGCTCCGGGGGAGATGG - Intergenic
1132013085 15:98292931-98292953 GCGGGCTGCCCCGGGGCTCCGGG - Intergenic
1132605735 16:792986-793008 GAGGGCCGACCCAGGGGTGCTGG + Exonic
1132697206 16:1207324-1207346 GAGGGCGGCCCAGGAGGAGGTGG - Exonic
1132750116 16:1453677-1453699 GATGGTTTCCCCGGTGGAGCTGG - Intronic
1132938961 16:2497491-2497513 GAGCACAGCCCCAGGGGAGCAGG + Intronic
1133272031 16:4614977-4614999 GCCGGGCGCCCCGGGGGAGCGGG + Intronic
1133732565 16:8589694-8589716 GAGGACTGGCCCGGGGGCGCAGG - Exonic
1134352506 16:13451084-13451106 GAGGGCTGTTCCCGGGAAGCAGG - Intergenic
1135058472 16:19250882-19250904 GATGGCTGCCCTGGGGGAGGGGG - Intronic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1136428713 16:30185124-30185146 GAGGGGTGTCCTGGGGGAGGTGG + Intronic
1136655120 16:31704969-31704991 GAAGGCTGCCCCAGGAGAGCAGG + Intergenic
1138606669 16:58094253-58094275 GAGGGCTTCCCAGGCAGAGCAGG - Intergenic
1139784957 16:69385568-69385590 GAGGGCCGGGCCGGGGGAGGGGG - Intronic
1140371177 16:74413569-74413591 CAGGGCTTACCCGGGGGAGTAGG + Exonic
1140725428 16:77807365-77807387 GAGGGCTGCCCCCAGGGAGGGGG - Intronic
1141004604 16:80340261-80340283 GTGGGCTGCCCTGGTGGAGAGGG + Intergenic
1141285628 16:82668960-82668982 GGGGGCTGCCCCGGTGTACCTGG + Intronic
1141382220 16:83586661-83586683 AAGGGCTGCCTCGTGGGAGCAGG + Intronic
1141427604 16:83953868-83953890 GAGGGCGGCCCCTGGGAGGCTGG + Intronic
1141608657 16:85169475-85169497 GAGGGCGGCCCGGGGCGCGCGGG + Intergenic
1141690348 16:85593218-85593240 GAGAGCTGGCCCGTGGGACCAGG - Intergenic
1141695503 16:85617245-85617267 GAGAGCTGCCCCCGGGAGGCTGG + Intronic
1141799121 16:86295238-86295260 GGGGCCTGCCCCGGGTGACCAGG - Intergenic
1141843954 16:86594208-86594230 GAAGGATGCCCTCGGGGAGCTGG + Intergenic
1141912210 16:87067756-87067778 GAGGGAAGCTCCGTGGGAGCAGG - Intergenic
1142031069 16:87838887-87838909 GAGGGCTGGCCCGGTGCAGAGGG - Intronic
1142287814 16:89178562-89178584 CAGGGCTGCCTCGGTGGGGCTGG - Intronic
1142338808 16:89507853-89507875 GAGGGCAGCCCCGGAGGAGGAGG - Intronic
1142687048 17:1583366-1583388 GAGGGCTCCCCGGAGGAAGCCGG + Intronic
1143023352 17:3927868-3927890 GAGGCCTGCACTGGGGCAGCTGG - Intronic
1143095996 17:4478659-4478681 GTGGGCTGAGCAGGGGGAGCTGG + Intronic
1143264181 17:5623421-5623443 GAGTGCAGCCCAGGGGGAGATGG + Intergenic
1143485387 17:7251347-7251369 GGGGGCTGCCCCCGGGGGGCTGG - Exonic
1143524200 17:7462900-7462922 GTGGGCTGCCCCGAGGCCGCCGG - Exonic
1143697317 17:8630317-8630339 GAGGGCGACCCCTGGGGGGCTGG - Intronic
1146059401 17:29596553-29596575 GTGGGCTGGGCCTGGGGAGCAGG + Intronic
1146296973 17:31657954-31657976 CAGGGCAGGCCAGGGGGAGCCGG + Intergenic
1146889679 17:36498331-36498353 TGGGGCTGCCCCTGGGGAGCTGG + Exonic
1146945437 17:36870116-36870138 TAGAGCAGCCCCAGGGGAGCTGG + Intergenic
1146970317 17:37066622-37066644 GAGGGGGGCCACGTGGGAGCCGG + Intergenic
1147254518 17:39174134-39174156 AAGGGATGCCCCAGGGGAGAGGG + Exonic
1147312336 17:39602871-39602893 GAGGGCTGAGCAGGGGGAGTAGG + Intergenic
1147645027 17:42028191-42028213 GAGGGGCTCCCCGGAGGAGCCGG - Exonic
1147979931 17:44268143-44268165 GCGAGCTGCCCCTGGGGCGCTGG - Intergenic
1148126781 17:45241448-45241470 GAGGGCCGCGTCGGGGCAGCGGG - Exonic
1148642781 17:49200885-49200907 ATGGGCTGCTGCGGGGGAGCAGG + Intergenic
1148770713 17:50064413-50064435 GAGGGCTGCCCTGTGGGTGGAGG + Intronic
1150003133 17:61454511-61454533 GACGGCCGCCCCGGGCCAGCCGG + Intronic
1150220765 17:63494566-63494588 CAGGGCAGACCCGGGGGAGCCGG + Intronic
1150472199 17:65446764-65446786 GAGGGCTGCTATGGGGGAGCAGG + Intergenic
1150652064 17:67016704-67016726 GGGGGCTGACCCGGGGGAAGGGG + Intronic
1151562740 17:74879375-74879397 GAGGGCTGGGCTGGGGGCGCTGG - Intronic
1151673803 17:75588105-75588127 GAGGCCGGCCTCAGGGGAGCAGG + Intergenic
1151685966 17:75646800-75646822 GAGGGCAGCCCAGGTGGAGAAGG - Intronic
1151698902 17:75732120-75732142 GTGGGGTGCGTCGGGGGAGCAGG - Intronic
1151758885 17:76089681-76089703 GAGGGCAGCCCAGGGTGGGCAGG + Intronic
1151826666 17:76527699-76527721 CAGGGCAGCCCCGGGGGATCCGG - Exonic
1151964165 17:77422611-77422633 CAGGGCTGGTCCCGGGGAGCCGG + Intronic
1151974253 17:77475556-77475578 TAGGGCTGCCGCAGGGGTGCTGG + Intronic
1152132192 17:78484418-78484440 GAGAGATGCCCCTGGGGAGATGG - Intronic
1152195214 17:78914104-78914126 AAGGGCTGACCTGGGAGAGCAGG + Intronic
1152245757 17:79183847-79183869 GAGGGCTGCCCCGGTGCCGGCGG - Intronic
1152432626 17:80257782-80257804 GAGGGCTGGGGCGGGGAAGCAGG + Intergenic
1152562164 17:81083982-81084004 GGGGGCAGCCCCAGGGGCGCAGG - Intronic
1152571620 17:81123652-81123674 GGGAGCTGCCCTGGGGGAGCTGG + Intronic
1152648564 17:81481585-81481607 GCGGGCCGGCCCGGGGGAGGGGG + Intergenic
1152856725 17:82668768-82668790 TAGAGCTGCCCCAGGGCAGCGGG + Intronic
1152965848 18:112509-112531 AACGGAGGCCCCGGGGGAGCTGG - Intergenic
1153414532 18:4832114-4832136 TAGGGCTGCCTGGTGGGAGCTGG - Intergenic
1153659885 18:7317136-7317158 GAGGGCTGTCCCACAGGAGCTGG - Intergenic
1153900462 18:9614094-9614116 GAGGGCGGCCCCAGGCGGGCTGG - Intronic
1153972775 18:10241546-10241568 TTGGTCTGCCCCGGGGGTGCCGG + Intergenic
1156481707 18:37440439-37440461 CAGGGCTGCCCTGGGACAGCGGG - Intronic
1157168985 18:45384672-45384694 GAGGGCAGCCCCTGGACAGCTGG - Intronic
1157322795 18:46647156-46647178 CAGGGCTGCCCAGGAGAAGCTGG + Intronic
1157521301 18:48347423-48347445 GAGGGCTTCCTAGGGGAAGCAGG - Intronic
1157614001 18:48976162-48976184 GAGGGCGGGCCCGCGGGAGCGGG + Intergenic
1158392967 18:57058581-57058603 GAATCATGCCCCGGGGGAGCTGG + Intergenic
1160505183 18:79422923-79422945 GGGGGCTGCCTCGGGGGCGGGGG + Intronic
1160566164 18:79787993-79788015 GAAGGCCGCCCCGGGAGAGCGGG + Intergenic
1160867726 19:1263084-1263106 GAGGGCTGTCCCGGGCGTGCTGG - Intronic
1160906084 19:1452288-1452310 GAAGGCTGCGCAGGGGGTGCGGG + Exonic
1160988721 19:1852001-1852023 GCGAGCAGCCCCGGGGGCGCAGG + Intergenic
1161027093 19:2041782-2041804 CAGGGCAGGCCCGGGGGAGGAGG + Intronic
1161061496 19:2217395-2217417 GAGGACTTCCCCGGGGGCACTGG + Intronic
1161073076 19:2271977-2271999 GAGTGCTCACCCAGGGGAGCAGG + Intronic
1161073093 19:2272028-2272050 GAGTGCTCACCCAGGGGAGCAGG + Intronic
1161081574 19:2313042-2313064 GAGAGCTGCCCGGGGGGCGGGGG - Intronic
1161222037 19:3122317-3122339 GAGCGCCGCCCCCGGGGAGCGGG + Exonic
1161242046 19:3228074-3228096 GAGGGCAGGCCCTGGGGCGCTGG + Intronic
1161374716 19:3933521-3933543 GGAGGCCGCCCCGGGGGAGGCGG - Exonic
1161476908 19:4491275-4491297 CAGGGCTGCGCCGGGGGGGGTGG - Intronic
1161504421 19:4636256-4636278 GAGGCCTGGCCTGGGGGTGCGGG + Intergenic
1161678788 19:5668236-5668258 GAGGCCAGAGCCGGGGGAGCAGG + Exonic
1161924226 19:7289277-7289299 GAGGACTGGCCTGGGGAAGCTGG + Intronic
1162929881 19:13952561-13952583 GGCGGCGGCCCCGGGGGAGCCGG + Exonic
1162940459 19:14006075-14006097 CAGGGCGGCCCCGGGGTGGCTGG - Intronic
1163250603 19:16124443-16124465 CAGGGCTGGGCCTGGGGAGCAGG + Intronic
1163364599 19:16869008-16869030 GTGGGCAGCCCCGGTCGAGCTGG + Intronic
1163606935 19:18280862-18280884 GCGGGCGGCGCCGGGGGCGCGGG - Exonic
1163695304 19:18760762-18760784 GAGGGGGGTCCCGGGGGAGCAGG - Intronic
1163804485 19:19387194-19387216 GAGGGGTCCCCCGGGGAAGAAGG - Intronic
1164904875 19:31959240-31959262 GGAGGCTGCCCAGGAGGAGCCGG + Intergenic
1165113999 19:33518136-33518158 GAGGGTTGCCACGGCGGAACAGG + Intronic
1165309716 19:35022809-35022831 AAGAGCTGCCCCGGGTGAGGAGG + Intronic
1165345717 19:35248095-35248117 GAGGGCTGACCCGGGGGCTAGGG + Intergenic
1165448060 19:35867744-35867766 CAGGGCTGCCCCAGGGGTCCTGG + Intronic
1165875138 19:39001221-39001243 GTGGGCTGCCCCTGGGGATTGGG + Intronic
1166129847 19:40739636-40739658 GAGGTTGGCCACGGGGGAGCTGG + Exonic
1166694427 19:44844697-44844719 TTGGGCTGCCCAGGGGGAGCTGG - Intergenic
1166765960 19:45252108-45252130 GAGGGGGGCTCCTGGGGAGCCGG - Intronic
1166943474 19:46383257-46383279 CAGGGCAGGCCTGGGGGAGCGGG - Intronic
924998458 2:385240-385262 GAGGGCTGCCTCAGGGTGGCTGG - Intergenic
925294536 2:2768527-2768549 GAGGGCTGACCCTGGGGTCCTGG + Intergenic
926145307 2:10393630-10393652 CAGGGCTGCCCCCAGGAAGCTGG + Intronic
926228859 2:10987690-10987712 CAGGGCTGCCTGGGGTGAGCAGG - Intergenic
927512088 2:23650143-23650165 CAAGTCTGCCCTGGGGGAGCTGG + Intronic
927606740 2:24492102-24492124 GAGGGCTGCGCCGACGGAGAGGG - Exonic
928428522 2:31199250-31199272 GAGGGCTGCCCCAGGGGATGAGG + Intronic
929197948 2:39205839-39205861 CAGGACTGCCCTGGGCGAGCTGG + Intronic
931182701 2:59918899-59918921 GAGGGCTGCCTCCAGGGATCAGG - Intergenic
931321460 2:61177654-61177676 GAGGGCCGGGCCGCGGGAGCCGG + Exonic
934535593 2:95130525-95130547 CAGGTATGCCCCGGGGGGGCCGG + Intronic
934678254 2:96265340-96265362 CAGGGCTGCCCGGCGGGCGCCGG - Exonic
934748267 2:96774138-96774160 GAGGGCTGCCCTGTGGGAGGGGG + Intronic
934753642 2:96810378-96810400 GAGGGCAGGGCCTGGGGAGCAGG - Exonic
937093875 2:119223703-119223725 GATTGCGGCCCCGGGGGAGGTGG + Intergenic
938230059 2:129650640-129650662 TAAGGCTGCCCCGTGGTAGCTGG - Intergenic
940214366 2:151289442-151289464 GCGGGCAGCTCCCGGGGAGCAGG + Intronic
940774922 2:157875815-157875837 GGGGGCTGAGCCGGGGGAGGCGG + Intronic
945151625 2:206797571-206797593 GAGCTCTGCCCTGGGGCAGCTGG - Intergenic
946308746 2:218871387-218871409 GAGGGCTGCCCCAGGGGCCTGGG - Intronic
948367258 2:237465079-237465101 GAGGGGTGCATCAGGGGAGCTGG - Intergenic
948467645 2:238159861-238159883 CAGGGCTGCCCCAGGGAAGCCGG + Intronic
949037382 2:241822097-241822119 AAGGGCTGCGCCGAGGGGGCCGG + Intergenic
1169268600 20:4182369-4182391 GAGAGGAGCCCCGGGGGGGCAGG + Exonic
1169867896 20:10219574-10219596 GAGGGCTGGCGCGGGTGGGCTGG + Intronic
1171133688 20:22677933-22677955 GAGGGCTGCCCATGTGGAGCTGG + Intergenic
1172523564 20:35584161-35584183 GAGGTGTGCCCTGGGGAAGCAGG - Intergenic
1172772709 20:37390999-37391021 GTGGGCTGACTCTGGGGAGCTGG + Intronic
1172930219 20:38581186-38581208 CAGGGCTGCCCCATGGGACCTGG - Exonic
1172996313 20:39072571-39072593 GGGAGCTACCCAGGGGGAGCGGG + Intergenic
1173324025 20:42016461-42016483 AAGGGCTGCCCCAGGGCAGGGGG + Intergenic
1175197474 20:57254409-57254431 GAGAGCTGCCCGTGGGGAGGAGG - Intronic
1175777771 20:61663848-61663870 CAGGGCGGCCTCGAGGGAGCTGG - Intronic
1175826301 20:61938317-61938339 GAGCGCTGTCCCAGGGGTGCCGG - Exonic
1175907518 20:62388157-62388179 GCAGGCTGCCCCGGGAGAGGTGG + Intronic
1175989944 20:62783617-62783639 GCAGCCTGCCCAGGGGGAGCCGG - Intergenic
1176048076 20:63102868-63102890 GCGGGCCGCTCCGGGGAAGCGGG + Intergenic
1176081562 20:63275976-63275998 GAGGGCTGCCCAGGGTGGCCGGG - Intronic
1176158880 20:63638475-63638497 CAGGGCTGCCCTGGGAGAGGAGG + Intergenic
1176189815 20:63803101-63803123 GTGAGGTGCCCTGGGGGAGCCGG - Intronic
1176257500 20:64159880-64159902 GAGGGCTGCCCAGAAGGACCTGG - Intronic
1179400126 21:41075881-41075903 GCGGGCTGCCCCAGGGTGGCAGG + Intergenic
1179966921 21:44812724-44812746 GAGGGGAGCTCCGGGAGAGCAGG + Intronic
1180105469 21:45615611-45615633 CAGAGCAGCCCCGGGGGGGCAGG + Intergenic
1180158402 21:45988524-45988546 GTGGACTGTCCCGGGGGCGCTGG + Intronic
1180970339 22:19811805-19811827 GAGGGCTGACCCAGGGCAGCAGG - Intronic
1181006664 22:20016778-20016800 GAGGGCTGGCCCGGGGTCTCGGG - Exonic
1181026521 22:20130801-20130823 GGGTGCTTCCCCAGGGGAGCAGG + Intronic
1181230101 22:21417168-21417190 GAGGGGTGCGCGGGAGGAGCCGG - Intergenic
1181248548 22:21517698-21517720 GAGGGGTGCGCGGGAGGAGCCGG + Intergenic
1181457294 22:23066999-23067021 AAGGGAGGCCCCGGGGAAGCTGG + Intronic
1183227167 22:36558477-36558499 GAGCTGTGCCCTGGGGGAGCAGG + Intergenic
1183466714 22:37983817-37983839 GGCGGCTGGCCCGGGGGAGGCGG - Exonic
1183492293 22:38123070-38123092 GAGGGCGGCCCCTGGGGATGGGG - Intronic
1183640062 22:39087228-39087250 GACAGGTGCCCTGGGGGAGCAGG - Intronic
1183662204 22:39227844-39227866 GAGAGCTGCCTCGTGGGAGCTGG - Intronic
1184298954 22:43543674-43543696 GAGGGCTGCCCTGGAGGGGCTGG + Intronic
1184606983 22:45579863-45579885 GATGGCTGCCCCTAGGGACCAGG - Intronic
1184717212 22:46289012-46289034 GAGGGCTGACCTGGAGGACCTGG + Intronic
1185093103 22:48786815-48786837 GAGGGCTGCCCAGAGGGGCCAGG - Intronic
1185107560 22:48882941-48882963 CAGGGCTGCCCCCGGTGGGCTGG - Intergenic
1185272790 22:49936400-49936422 GTGGGCGGGCCTGGGGGAGCTGG - Intergenic
1185330230 22:50249069-50249091 GAGGGCTCCCCCAGGGCAGCCGG - Intronic
950198443 3:11026142-11026164 GAGGGGTGGCCCGGAGGAGGGGG - Intronic
950264071 3:11561816-11561838 AGAGGCTGCCCCGGGGGAGAGGG + Intronic
950469641 3:13176582-13176604 GAGGGCTGCACCCTGGGACCTGG - Intergenic
950728285 3:14933904-14933926 GAGGACTGCTCTGGGGGAGGAGG - Exonic
952238686 3:31507341-31507363 GAGGGCTGCCCAGCAGGAGCTGG + Intergenic
953226998 3:41030209-41030231 CAGGGCTTCCCCGAGGGATCAGG - Intergenic
953494169 3:43372247-43372269 AGGGGCTGGGCCGGGGGAGCAGG - Intronic
953691970 3:45127360-45127382 GAGGTCTGCCCGGGGGGTGTGGG + Intronic
953877890 3:46676782-46676804 GAGGGCTTCCTGGGGGGAGGGGG - Intronic
954431620 3:50473733-50473755 GAGGGCAACCCTGTGGGAGCAGG - Intronic
958642478 3:96824876-96824898 GAGGGCAGGGGCGGGGGAGCTGG - Intronic
960115065 3:113885224-113885246 GGGGGTTGCCCCCGGGGGGCTGG + Intronic
960960488 3:123067300-123067322 GGGAGCTGCCCCGGGGCACCGGG + Intronic
961331783 3:126146948-126146970 GAGGCTGGCCCCAGGGGAGCTGG + Intronic
961337087 3:126187017-126187039 CAGGGCTGCTCAGGGGGAGCGGG + Intronic
966762082 3:183427797-183427819 GCGCGCTGCCCCGGGGCAGCGGG + Intronic
966910552 3:184557240-184557262 GAGAGGTGCCCCGGCAGAGCTGG + Intronic
967055150 3:185824492-185824514 GAGGGGTGCCCCTAAGGAGCCGG + Intronic
967694436 3:192514943-192514965 GAGGGCTGCCCCCGGCGGACCGG - Intronic
968434924 4:579488-579510 GAGCCCTGCCACTGGGGAGCTGG + Intergenic
968506873 4:974772-974794 GAGGGCTGCCTGGGGGCAGCAGG + Intronic
968574700 4:1360166-1360188 AAGGGCTGCCCACGGGGGGCGGG + Intronic
969046715 4:4341675-4341697 GAGGCCTGCACAGGGTGAGCAGG - Intergenic
969484874 4:7466655-7466677 GAGGACTGAGCCCGGGGAGCAGG + Intronic
969615915 4:8252519-8252541 GAGGGTTGGCCTGAGGGAGCTGG + Intergenic
969681464 4:8645592-8645614 GGGGGCTGCCCGGGTGGAGGTGG + Intergenic
969702654 4:8776213-8776235 CAGGGATGCTCCTGGGGAGCAGG + Intergenic
972291859 4:37697155-37697177 GAGGGCTGTCCCTGGGGAAGAGG - Intergenic
972675535 4:41256856-41256878 GAGGCCTGTGCAGGGGGAGCAGG - Exonic
977373124 4:96165726-96165748 GAGAGCTGCCCTGTGGTAGCTGG + Intergenic
980975340 4:139605461-139605483 GAGGACTGCCCAGAGAGAGCGGG + Intronic
981136220 4:141213780-141213802 GAGCACTGCCCCGGGGGAGGTGG - Intergenic
982257769 4:153466792-153466814 GGGGGCTGCGCCCGGGGCGCAGG - Intronic
985041241 4:185893729-185893751 TAGGGGTTCCCCGGGGGAGGAGG + Intronic
985111896 4:186555147-186555169 GAGCGCTGGCCCAGGGGAGGCGG + Intronic
985173203 4:187174189-187174211 GCAGGCAGCCCCGGAGGAGCAGG - Intergenic
985450974 4:190062191-190062213 GAGGGCTGCCCCTGGACAGCAGG - Intergenic
985451452 4:190065818-190065840 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
985452441 4:190069110-190069132 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
985453426 4:190072407-190072429 AACGGAGGCCCCGGGGGAGCTGG + Exonic
985454416 4:190075700-190075722 AACGGAGGCCCCGGGGGAGCTGG + Exonic
985455404 4:190078993-190079015 AACGGAGGCCCCGGGGGAGCTGG + Exonic
985456389 4:190082287-190082309 AACGGAGGCCCCGGGGGAGCTGG + Exonic
985457376 4:190085587-190085609 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
985458363 4:190088880-190088902 AACGGAGGCCCCGGGGGAGCTGG + Exonic
985459352 4:190092180-190092202 AACGGAGGCCCCGGGGGAGCTGG + Exonic
985463604 4:190174949-190174971 AACGGAGGCCCCGGGGGAGCTGG + Exonic
985855513 5:2421601-2421623 GAGGGTGGCCCCTGGGGTGCTGG - Intergenic
986321288 5:6633989-6634011 GGGGGACGCCCCGGGGGATCTGG - Intronic
990381743 5:55226663-55226685 GAGGGCTGCGCGGGGAGACCGGG + Exonic
994422031 5:99534386-99534408 GAGGGCTGGCCAGGCAGAGCGGG - Intergenic
994460811 5:100066198-100066220 GAGGGCTGGCCAGGCAGAGCGGG + Intergenic
994484956 5:100379623-100379645 GAGGGCTGGCCAGGCAGAGCGGG + Intergenic
995404202 5:111775359-111775381 GTGGGCTGCCCTAGGGTAGCAGG + Intronic
997472174 5:134123220-134123242 GGGCACTGCCCCAGGGGAGCTGG - Intronic
998004853 5:138649982-138650004 TGGGGCTGCCACAGGGGAGCAGG + Intronic
999683501 5:154081776-154081798 GAGGCCTGCCCTGGGGCTGCCGG + Intronic
1001296701 5:170503932-170503954 GAGGGCTGCACGGTGGGGGCGGG - Intronic
1002052226 5:176577557-176577579 GAGGGCTGCTCCGGGGTGCCAGG + Intronic
1002059003 5:176615302-176615324 GAGGGCTGCCAAGGAGCAGCTGG - Intergenic
1002082162 5:176743576-176743598 GGGGCCAGCCCCGGGGGTGCGGG - Intergenic
1002711874 5:181200009-181200031 GAGGGCTTTCCTGGTGGAGCAGG - Exonic
1002799799 6:511596-511618 GAGGGCTGCACGGGGGCATCTGG + Intronic
1002898812 6:1393923-1393945 GGGAGCCGCCCCGGGAGAGCAGG + Intronic
1003234275 6:4281945-4281967 GGGGACTGCCGCGGGGGAGCAGG - Intergenic
1003868427 6:10383426-10383448 GAGGGAGGCGCCGGGGGAGTCGG - Intergenic
1004883119 6:20028140-20028162 GAGGGCTGCTAGGGTGGAGCAGG - Intergenic
1006400751 6:33815845-33815867 CTGGGCTGCCCAGTGGGAGCTGG + Intergenic
1006458548 6:34145133-34145155 CCGGCCTGCCCCGGGGGCGCAGG + Intronic
1006606210 6:35259595-35259617 GATGGCTGCCGCGGCGAAGCGGG + Intronic
1007072838 6:39049183-39049205 CAGGGCGGCCGCGGGGCAGCGGG - Intronic
1007363237 6:41373263-41373285 GAGGGCAGCGCGCGGGGAGCCGG - Intergenic
1007595907 6:43051152-43051174 GAGGGCTGAGCCTGGGCAGCGGG + Exonic
1007902615 6:45424258-45424280 GAGGGCTACCCCGGGAAATCTGG - Intronic
1009940202 6:70281443-70281465 GAGAGGTCCCCCGGGTGAGCAGG - Exonic
1011831464 6:91376918-91376940 GCGGGCTGCCCCCAGGGAGCAGG - Intergenic
1013600645 6:111701343-111701365 GGGGGCTGCCAGGAGGGAGCGGG - Intronic
1013619423 6:111873336-111873358 GGGGGCTGCCGCGGGCGAGGAGG - Exonic
1014221693 6:118804742-118804764 GTGGGCTGCCCTGGGGAAGGGGG - Intergenic
1016739075 6:147509166-147509188 GCGGGCGGCCCGGGGGGCGCCGG - Exonic
1017616429 6:156251514-156251536 CAGGGCTGGCGCGGGGGATCTGG + Intergenic
1019306875 7:339818-339840 GAGGGCCGCCTCTGGGGAGGAGG - Intergenic
1019342010 7:512797-512819 GAGGGCTGCCCCGGGGCAGGAGG + Intronic
1019426553 7:980190-980212 GTGGGCTCCCCCGGAGGGGCTGG - Intergenic
1019479613 7:1260408-1260430 TAGGGCTGGCACAGGGGAGCCGG + Intergenic
1019550162 7:1598197-1598219 AAGGGCGGCCCAGAGGGAGCAGG - Intergenic
1019575447 7:1735509-1735531 GAGGGCTGACTCGGCGGGGCTGG - Intronic
1019578917 7:1750551-1750573 CAGGGCTGCCCCTCGGAAGCTGG - Intergenic
1021200804 7:17726884-17726906 GAGTGCAGCCCCAGGGAAGCAGG - Intergenic
1022969724 7:35505848-35505870 CAGGGCTGCCCCTGAGAAGCTGG + Intergenic
1023405808 7:39833247-39833269 GAGGGCGGCGCAGGCGGAGCCGG + Intergenic
1026994657 7:74607624-74607646 GAGGGTGGCCCGAGGGGAGCAGG - Intergenic
1028774046 7:94658145-94658167 GGGGGCGGCCCCGGGAGAGGCGG - Intronic
1029524865 7:101088318-101088340 CAGGGCTGCCCCTGGGCACCAGG + Exonic
1030152024 7:106417108-106417130 GAGGGGTGACCCTGGGAAGCAGG - Intergenic
1030216019 7:107044683-107044705 GAGCGCGGCCCCGGGAGGGCTGG - Exonic
1032239428 7:130149511-130149533 CCCGGCCGCCCCGGGGGAGCAGG - Intergenic
1034276892 7:149827793-149827815 GCAGGTGGCCCCGGGGGAGCTGG + Intergenic
1034469165 7:151246506-151246528 GTGGGCTGCCCAGGGGGGCCTGG + Intronic
1035062596 7:156080090-156080112 GCTGGCTGCCCCGAGGGAGGTGG - Intergenic
1035263444 7:157675758-157675780 GAGGGCAGCCCTGTGGGTGCGGG - Intronic
1035453996 7:158997276-158997298 GGGGGCTGCCCAGGGGAAGAAGG - Intergenic
1035632373 8:1117751-1117773 GGGGGCTCCCCCAGGAGAGCAGG + Intergenic
1035870324 8:3130570-3130592 GAGGGCTTCCCCGGGTCAGGGGG - Intronic
1037804958 8:22053969-22053991 GAGGCCTTCCCAGGGGGAGGAGG + Intronic
1038166062 8:25086113-25086135 GAGGGGAGCCCCTGGGGTGCTGG + Intergenic
1038176235 8:25184391-25184413 GAGGGCTGCGCTGGAGGAGCCGG - Intergenic
1038443867 8:27589555-27589577 GAGGGCAGCTCCAGGGGAGTGGG - Intergenic
1038816689 8:30912114-30912136 GAGGGCGGCGCGGGGGTAGCTGG - Intergenic
1039518783 8:38153862-38153884 GAGGGAGGAGCCGGGGGAGCTGG - Intergenic
1040315131 8:46256977-46256999 CAGGGCTGTCCCGGGCGGGCTGG + Intergenic
1041281140 8:56211713-56211735 GCGGGCTGCCGCCGGGGAGCGGG + Intronic
1042020867 8:64370491-64370513 GAGGGCAGCTCAGGGGGAGGAGG + Intergenic
1042651403 8:71045910-71045932 GAAGGCTGCCACGTGGGAGTCGG + Intergenic
1043354364 8:79395172-79395194 GATGCCAGCCCCAGGGGAGCTGG - Intergenic
1044389777 8:91636281-91636303 GAGTGCTACCCAGAGGGAGCAGG - Intergenic
1045060109 8:98403609-98403631 GAGGGCTGCCCCTGGGGAGGGGG + Intronic
1045254623 8:100509258-100509280 GAGGCCAGGCCCGGGGGAGAAGG + Intergenic
1049406025 8:142452210-142452232 GAAGGCTGGCCCGGGAGACCCGG + Intronic
1049452554 8:142669932-142669954 GGCGGCTGCTCCGGGTGAGCAGG - Exonic
1049607139 8:143534945-143534967 GGGGGCTGCCGCGGGAGGGCAGG - Intronic
1053123013 9:35560303-35560325 CAGGGCAGCCCAAGGGGAGCGGG + Exonic
1054808301 9:69413290-69413312 GTGGGCAGCCTCCGGGGAGCAGG - Intergenic
1055528229 9:77156663-77156685 GTGGGCTGCTCCTGGGGAGGGGG + Intergenic
1056307577 9:85305245-85305267 GTGGGCTGCCTGGTGGGAGCTGG + Intergenic
1056779524 9:89538891-89538913 GAGGGCTTCCCTGAGCGAGCGGG + Intergenic
1056796454 9:89662139-89662161 GAGGGCAGCCCAGGAGGAGCGGG + Intergenic
1057180003 9:93024678-93024700 GAGGGATGCCCTGGGTGGGCAGG + Intronic
1057212306 9:93206787-93206809 AAGAGCTGCCTCGGGGAAGCAGG - Intronic
1057406058 9:94771728-94771750 GGGGACTGTCCAGGGGGAGCTGG - Intronic
1057724585 9:97559162-97559184 GTGAGCTGCTCCGTGGGAGCTGG + Intronic
1059455673 9:114398564-114398586 GGGGGCGGCCCGGGGGGGGCGGG + Intergenic
1060482137 9:124022835-124022857 CAGCGCTGCCCACGGGGAGCGGG + Intronic
1061293597 9:129665841-129665863 GCGAGCGGCCCCGGGGGGGCCGG - Exonic
1061411184 9:130422574-130422596 CAGGGGAGCCCCAGGGGAGCTGG + Exonic
1061497846 9:130985850-130985872 GAGGGGTGCCCGGCGGGTGCTGG + Intergenic
1061725943 9:132582150-132582172 GAGAGCTGCCGCCGAGGAGCAGG + Intergenic
1061903565 9:133685120-133685142 GAGGGGTGCGCCGGGGGATCTGG - Intronic
1062390540 9:136331969-136331991 GAGGGCTGGCTTGGGGGAGGAGG + Intronic
1062577163 9:137214151-137214173 GTGGGCGGCCCCTGGGGAGTGGG + Intronic
1185605439 X:1365797-1365819 GCCGGGTGCCCCGGGTGAGCGGG + Intronic
1185605511 X:1366009-1366031 GCCGGGTGCCCCGGGTGAGCGGG + Intronic
1185605668 X:1366486-1366508 GCCGGGTGCCCCGGGTGAGCGGG + Intronic
1185605725 X:1366655-1366677 GCCGGGTGCCCCGGGTGAGCGGG + Intronic
1185605899 X:1367186-1367208 GCGGGGTGCGCCGGGTGAGCGGG + Intronic
1185606043 X:1367627-1367649 GCGGGGTGCGCCGGGTGAGCCGG + Intronic
1185606074 X:1367717-1367739 GCGGGGTGCGCCGGGTGAGCGGG + Intronic
1185606086 X:1367753-1367775 GCGGGGTGCGCCGGGTGAGCGGG + Intronic
1185606097 X:1367789-1367811 GCGGGGTGCGCCGGGTGAGCGGG + Intronic
1186483363 X:9913084-9913106 GATGGGTTCCCCGAGGGAGCTGG + Intronic
1186485587 X:9932288-9932310 CAGAGCTGCCCCGGGAGGGCCGG + Exonic
1186969221 X:14822158-14822180 GAGAGCTGCCCCCTGAGAGCTGG + Intergenic
1187181532 X:16947210-16947232 CAGGGCTGCCCCCAGGGACCCGG + Intronic
1189241175 X:39525936-39525958 GAGGGCTGCTCCTGGGGTGCTGG - Intergenic
1189330362 X:40141101-40141123 GAGGGCTGCCAAGGGGCAGCAGG + Intronic
1192533660 X:71910868-71910890 GTGTGCAGCCCCGGGGGAGCCGG + Intergenic
1194119058 X:89937973-89937995 GACGGCTTCCCCTGGGTAGCGGG + Intergenic
1195654726 X:107323825-107323847 GGGGGCTGCCTCAGTGGAGCTGG + Intergenic
1199984692 X:152941999-152942021 CAGGGCTGCCCAGGGGGAGGGGG + Intronic
1200155436 X:153972420-153972442 GAGGCGCGCCGCGGGGGAGCCGG + Exonic
1200224760 X:154411451-154411473 GAGGCCAGCCCCGGGGCGGCGGG - Intronic
1200471934 Y:3595533-3595555 GACGGCTTCCCCTGGGTAGCGGG + Intergenic
1201177156 Y:11316090-11316112 AATGGAGGCCCCGGGGGAGCTGG + Intergenic
1201178285 Y:11322727-11322749 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1201179869 Y:11333500-11333522 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1201900690 Y:19044168-19044190 GAGGGCAGCCCCAGGGGGTCAGG - Intergenic