ID: 917966843

View in Genome Browser
Species Human (GRCh38)
Location 1:180184181-180184203
Sequence CTGTCCCCCACCCTGGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 821
Summary {0: 1, 1: 0, 2: 7, 3: 61, 4: 752}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917966837_917966843 14 Left 917966837 1:180184144-180184166 CCTTGTCATATGATTAGTGTGTA 0: 1
1: 0
2: 2
3: 56
4: 490
Right 917966843 1:180184181-180184203 CTGTCCCCCACCCTGGGGTCTGG 0: 1
1: 0
2: 7
3: 61
4: 752

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917966843 Original CRISPR CTGTCCCCCACCCTGGGGTC TGG Intronic
900169600 1:1260169-1260191 CTGTCACCCATCCTGGCGTGCGG + Intronic
900172782 1:1277792-1277814 CTGTCCCCCAGGCTGGAGTGCGG - Intergenic
900188321 1:1343118-1343140 CTGTCCTCCTACCTGGGGGCTGG - Intronic
900229540 1:1549480-1549502 CTGTCCCCCAGGCTGGAGTGCGG - Intronic
900247676 1:1645412-1645434 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
900258903 1:1712550-1712572 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
900318432 1:2070711-2070733 CTGGCCCCCACTGTGGGGTCAGG - Intronic
900322449 1:2091826-2091848 CTGTCCTCCCGCCTGGGGTCAGG - Intronic
900370372 1:2329519-2329541 CAATCCCCCACCCTGGGGCCAGG + Intronic
900678149 1:3901171-3901193 CTGTCCCCCACGTTGCGGGCGGG + Intergenic
900902814 1:5528241-5528263 CTGTCCCCAACACTGAGGACTGG + Intergenic
901326523 1:8369162-8369184 CTGTCCCCCAGGCTGGAGTGCGG - Intronic
901453720 1:9351779-9351801 CTGTCACCCACCCTGTGTCCAGG - Intronic
901863443 1:12089058-12089080 CTGTGGCCCAGGCTGGGGTCAGG - Intronic
902530201 1:17086032-17086054 TTGTGCCCTACCCTGGGGCCAGG - Intronic
903225377 1:21891645-21891667 CTGTCACCCACGCTGGAGTGCGG + Intronic
903353091 1:22730062-22730084 CACACCCCCACCCTGGGGCCTGG - Intronic
903511574 1:23879574-23879596 CTGTCACCCACACTGGAGTGTGG - Intronic
903653718 1:24936146-24936168 CTGAACCCCACCCTGGGGGAAGG - Intronic
903745094 1:25581519-25581541 CTGTCTCCCACCTTGGGCTGAGG + Intergenic
904021501 1:27469905-27469927 CTGTCGCCCACTCTGGAGTGTGG - Intronic
904024994 1:27497116-27497138 CTGTCCCCCACACTGGGAGCGGG - Intergenic
904044451 1:27601712-27601734 CTGTCCCCCAACCTGGGGTGGGG - Intronic
904283553 1:29438406-29438428 CTGTCGCCCAGGCTGGAGTCTGG + Intergenic
904309729 1:29621001-29621023 CCTTCCCCCACTCTGTGGTCTGG + Intergenic
904310931 1:29629154-29629176 CTGTCTCCTCCCCTGGGGTGGGG + Intergenic
904498415 1:30900651-30900673 CTGTCCCCCTCCCTGGGCTGGGG - Intronic
904736413 1:32637529-32637551 CTGTCACCCACACTGGAGTGCGG - Intronic
905270722 1:36785797-36785819 CTGTCCCCACTCCAGGGGTCAGG + Intergenic
905279503 1:36840044-36840066 CTGTCCTGGCCCCTGGGGTCAGG + Intronic
905432379 1:37933681-37933703 CTGTCACCCAGGCTGGGGTGTGG - Intronic
905599732 1:39239242-39239264 CTGTCACCCACGCTGGAGTGCGG - Intronic
905885933 1:41491969-41491991 GTGTGGCCCACCCTGGGGTCTGG - Intergenic
906088468 1:43156806-43156828 CTCTCCCCCACGCTGGAGGCTGG + Intergenic
906288798 1:44605898-44605920 CCGGCCACTACCCTGGGGTCTGG + Intronic
906327952 1:44860036-44860058 CTGTCCCCCAGACTGGAGTGCGG + Intronic
906431783 1:45761108-45761130 CTGTCACCCAGGCTGGGGTGTGG + Intergenic
906441691 1:45852396-45852418 CTGTCCCCCAGGCTGGAGTGTGG + Intronic
906580405 1:46930862-46930884 CTGCCTCCCACCCCAGGGTCCGG + Intronic
906603318 1:47148026-47148048 CTGCCTCCCACCCCAGGGTCCGG - Intronic
906803154 1:48755131-48755153 CTATCCCCCACCCTTGGGTGTGG + Intronic
907033352 1:51194353-51194375 CTGTCACCCAGACTGGGGTGCGG + Intergenic
907239283 1:53071641-53071663 GTGTCCCTGACCCTGGGCTCTGG - Intronic
908271133 1:62423797-62423819 CTGTAGCCCACCCTGGAGTGCGG - Intergenic
910986546 1:93010615-93010637 CTGTCGCCCAGCCTGGAGTGCGG - Intergenic
911137558 1:94457572-94457594 TTGTCCCCCACCTTAGAGTCTGG + Intronic
911139579 1:94484594-94484616 GTGTTCCCCACCCTGGGTCCAGG - Intronic
911761190 1:101619213-101619235 CTGTCCACAAGCCTGGGGTCTGG + Intergenic
912343496 1:108941688-108941710 CTGTCACCCACGCTGGTGTGCGG + Intronic
912532418 1:110335888-110335910 CTGGTCCACAGCCTGGGGTCTGG - Intergenic
912798444 1:112706721-112706743 CGGCCGCCCACCCTGGGGGCTGG + Intronic
912889720 1:113516663-113516685 ATGTCCCACACCTTGGGGGCAGG - Intronic
912994113 1:114516444-114516466 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
913970254 1:143409595-143409617 CTGTCGCCCAGCCTGGAGTGCGG + Intergenic
914064629 1:144235191-144235213 CTGTCGCCCAGCCTGGAGTGCGG + Intergenic
914114521 1:144731163-144731185 CTGTCGCCCAGCCTGGAGTGCGG - Intergenic
914224327 1:145707720-145707742 CAGTCCCCCATCCTGGGGTCAGG + Intronic
914665499 1:149829222-149829244 CTCTCACCCAGCCTAGGGTCAGG - Intergenic
914670266 1:149864572-149864594 CTCTCACCCAGCCTAGGGTCAGG + Intronic
914880694 1:151544331-151544353 CTGTCACCCAGGCTGGGGTGCGG + Intronic
915300465 1:154948470-154948492 ATGTGCCCCTCTCTGGGGTCAGG - Intronic
915311395 1:155007493-155007515 CTGGCCCCCACCCTGGGGTGTGG + Intronic
915325655 1:155080221-155080243 CGGTCCCCTCCCCTGGGGTCTGG - Intronic
915590275 1:156866646-156866668 AGATCCCCCTCCCTGGGGTCTGG + Intronic
915610991 1:156992493-156992515 TTGTCGCCCACCCTGTGGGCTGG - Intronic
917032327 1:170707085-170707107 CTGTCACCCAGGCTGGGGTACGG - Intronic
917121469 1:171648150-171648172 CTGTCCCCCAGGCTGGAGTGCGG - Intronic
917801695 1:178577200-178577222 CTGTCACCCACGCTGGAGTGCGG + Intergenic
917966843 1:180184181-180184203 CTGTCCCCCACCCTGGGGTCTGG + Intronic
918012978 1:180604825-180604847 CTGTCCCCCAGGCTGGAGTGCGG - Intergenic
920229901 1:204463390-204463412 CTTTCCACTACCCTGGGCTCTGG - Intronic
920342154 1:205282105-205282127 CTGTCGCCCAGGCTGGGGTGCGG - Intergenic
920431854 1:205923831-205923853 CTCTCCCCTGCCCTGTGGTCTGG - Intronic
920555076 1:206898773-206898795 CTGTGCCCCTCCCTGGGACCAGG + Intronic
920891716 1:209993423-209993445 ATGTCCCGCAGCTTGGGGTCAGG - Intronic
921583803 1:216925398-216925420 CTGTCCCCCAGGCTGGAGTGTGG - Intronic
922305866 1:224343986-224344008 CTGTCACCCAGCCTGGAGTGTGG - Intergenic
922528797 1:226327242-226327264 CTGTCACCCACGCTGGAGTGTGG + Intergenic
922862058 1:228827457-228827479 CTGCACCCCACCCTGGCGACAGG - Intergenic
922919032 1:229285039-229285061 CTGTCACCCAAGCTGGGGTGTGG + Intronic
923230812 1:231984581-231984603 CTGGTCCCCAGCCTGAGGTCTGG - Intronic
923739911 1:236645772-236645794 CTGTCCCCCAGGCTGGAGTGTGG - Intergenic
923865331 1:237933409-237933431 CTGTATCCTACCCTGGGGGCTGG + Intergenic
924706445 1:246506796-246506818 CTGCCCCCCAACCTGGGCTGCGG - Intronic
1063409368 10:5825084-5825106 CTGTCACCCAGGCTGGGGTGCGG - Intronic
1063846260 10:10130195-10130217 CTGTCACCCAGCCTGGAGTGTGG - Intergenic
1064168983 10:13012732-13012754 CTGTCCCCCAGGCTGGAGTGCGG - Intronic
1064357427 10:14632266-14632288 CTGTCCCCCAGGCTGGAGTCTGG - Intronic
1064526193 10:16259433-16259455 CTGTCACCCAGCCTGGAGTGCGG + Intergenic
1064553022 10:16521324-16521346 CCGGCCCCCACCCCGGGCTCGGG - Exonic
1064607284 10:17056570-17056592 CTGTCGCCCAGGCTGGAGTCCGG - Intronic
1066652786 10:37674414-37674436 CTGTCCCCCAGGCTGGAGTGTGG - Intergenic
1067091518 10:43267958-43267980 CTCTGGGCCACCCTGGGGTCAGG - Intergenic
1069024503 10:63524472-63524494 CTGTCGCCCACGCTGGAGTGCGG + Intronic
1070587846 10:77780005-77780027 CTGGCCCCCACCCCAGGGGCAGG - Intergenic
1071541648 10:86490175-86490197 CTGTCCCCCAGGCTGGAGTGTGG - Intronic
1071704247 10:87980282-87980304 CTGTCGCCCAGGCTGGGGTGTGG + Intergenic
1072286122 10:93917246-93917268 CTGTCCTCCATCCTGGAGTGGGG + Intronic
1072744934 10:97933303-97933325 CTCACCCCCACCCTGGAGGCCGG + Intronic
1072923320 10:99595162-99595184 CTGTCACCCAGGCTGGAGTCTGG + Intergenic
1073102054 10:101011654-101011676 CTGTGCCCCTCCCTGGGCTCTGG + Intronic
1075495197 10:122914001-122914023 CTGTCCCCCAGGCTGGTGTGCGG + Intergenic
1076226690 10:128782286-128782308 CTGTCACCCAGGCTGGGGTGCGG + Intergenic
1076483971 10:130803911-130803933 CTGTCGCCCACACTGGAGTGCGG + Intergenic
1076508397 10:130994019-130994041 CTGACCCCCACCCTGGGTCTCGG - Intergenic
1076679180 10:132162952-132162974 TCCTCCCCCACTCTGGGGTCAGG + Intronic
1076806897 10:132863247-132863269 GTCTCCCTCACCCCGGGGTCGGG - Intronic
1076836271 10:133022535-133022557 CAGTCCCCCACCCTGTCGTCAGG + Intergenic
1077041436 11:525858-525880 CTGTCCCCCAGGCTGGAGTGTGG - Intergenic
1077111942 11:865832-865854 GAGACCCCCACCCTGGGGGCTGG + Intronic
1077112109 11:866442-866464 GTGTCGCCCACCCTGGGGTCGGG + Intronic
1077154726 11:1086179-1086201 CTGCAGCCCTCCCTGGGGTCAGG - Intergenic
1077176830 11:1194940-1194962 CTGTCCCCCAGCTGGGGGTGGGG + Intronic
1077443745 11:2580732-2580754 CTGACCCCCACCTTGGGCGCTGG + Intronic
1077581821 11:3422241-3422263 CGGTCCCCGTCCCTGGGGCCTGG - Intergenic
1077637261 11:3851817-3851839 TTGTCACCCACGCTGGAGTCCGG + Intergenic
1078112320 11:8406104-8406126 CTGTCACCCAGCCTGGAGTGCGG - Intronic
1078135601 11:8649300-8649322 CTGTCACCCAGGCTGGGGTGCGG - Intronic
1078432397 11:11298109-11298131 CTGTCCCTCACCTTGGGGCAAGG + Intronic
1078709447 11:13776712-13776734 CTGTCTCCCTGCCTGGGGCCTGG + Intergenic
1078806621 11:14712120-14712142 CTGTCCCCCACACTGGAGTGCGG + Intronic
1079579094 11:22039824-22039846 ATGTCCCTCACCCTGAGGACAGG - Intergenic
1079845821 11:25466349-25466371 CTGTCACCCAGGCTGGAGTCTGG - Intergenic
1081472641 11:43390284-43390306 CTGTCACCCAGCCTGGAGTCTGG - Intronic
1082688663 11:56272767-56272789 CTGTCGCCCACGCTGGCGTGCGG + Intergenic
1082820796 11:57543484-57543506 CCCTCCCCCACCCTGGGCTCTGG - Intronic
1083123656 11:60540916-60540938 CTGTCACCCACACTGGGGTACGG - Intronic
1083314262 11:61804624-61804646 CTATCCCCCACTCTGGGTGCTGG + Intronic
1083851948 11:65373198-65373220 CTGTCACCCAGGCTGGGGTGCGG - Intergenic
1083890779 11:65594831-65594853 CTGTCACCCAGGCTGGGGTGCGG - Intronic
1083970617 11:66071606-66071628 CTGTCTCCAACTCTGGGGACAGG + Intronic
1084092694 11:66889035-66889057 CTGTCACCCAGGCTGGGGTGCGG - Intronic
1084157032 11:67318954-67318976 CTGTCACCCAGGCTGGGGTGCGG + Intronic
1084289381 11:68151998-68152020 CTGGCCACCAGCCTGGGCTCAGG + Intergenic
1084329425 11:68421962-68421984 CTGTCACCCAGGCTGGGGTATGG + Intronic
1084641787 11:70430599-70430621 CAGTCCCTCCCCATGGGGTCTGG + Intronic
1084643720 11:70441966-70441988 CTGTCCCCCAGGCTGGAGTGGGG - Intergenic
1084833690 11:71787770-71787792 CGGTCCCCGTCCCTGGGGCCTGG + Intronic
1084972152 11:72777845-72777867 CCCACCCCCACCCTGGGATCAGG + Intronic
1087358130 11:97121436-97121458 CTGTCCCCCAGGCTGGAGTGCGG - Intergenic
1088370624 11:109084574-109084596 ATGTCCCCCACCCTGTGTCCAGG + Intergenic
1088489430 11:110372384-110372406 CTGTCACCCAGGCTGGGGTACGG + Intergenic
1088882098 11:113980434-113980456 ATGTCACCCAGCCTGGGGTGTGG + Intronic
1089503003 11:118943695-118943717 CTGTCGCCCACGCTGGAGTGCGG + Intronic
1089746597 11:120621935-120621957 CTGTCGCCCAAGCTGGAGTCCGG + Intronic
1090570280 11:128037803-128037825 CTGTCGCCCATGCTGGGGTACGG + Intergenic
1091278238 11:134366841-134366863 CTCCCCCCCACCCTGGGTACTGG - Intronic
1091319311 11:134638877-134638899 CTGTAGCCCACCCTGTGATCAGG + Intergenic
1091379173 12:44838-44860 CTGTCACCCAGCCTGGAGTGCGG + Intergenic
1091542365 12:1473591-1473613 CTGTCCCCCAGGCTGGAGTGCGG - Intronic
1091763668 12:3104387-3104409 CTGTCACCCAGGCTGGAGTCCGG + Intronic
1092057645 12:5521173-5521195 CTGTCCCCCAACCTGTCTTCAGG - Intronic
1092101223 12:5885162-5885184 CCGTCCCCACTCCTGGGGTCTGG + Intronic
1092193336 12:6535133-6535155 GCGTCCCCCACCTAGGGGTCCGG - Intronic
1092475548 12:8815860-8815882 CTGTCACCCACCCTGGAGTACGG - Intergenic
1092491493 12:8949632-8949654 CTGTGCCCCACTCTGGGAACCGG + Exonic
1092891943 12:12977379-12977401 ATGTCCCTCACCCTGGAGTCAGG - Intronic
1093946607 12:25116969-25116991 CTGTCACCCACCCTGAGTGCTGG + Intronic
1096048016 12:48581456-48581478 CTGTCGCCCAGGCTGGGGTGCGG + Intergenic
1096062615 12:48714847-48714869 CTGTCGCCCACACTGGAGTGCGG + Intronic
1096092373 12:48911518-48911540 CTGTCACCCAGGCTGGGGTCAGG - Intronic
1096201310 12:49685423-49685445 CTGTCTCCCAGGCTGGAGTCCGG - Intronic
1096400839 12:51304979-51305001 CTGTCGCCCAGCCTGGAGTACGG - Intronic
1096736072 12:53655939-53655961 CTGTCGCCCAGGCTGGAGTCTGG + Intronic
1096745798 12:53726089-53726111 CTGTTCCCTGCCCTGGGGTGGGG - Intronic
1097095419 12:56543696-56543718 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
1097500415 12:60393710-60393732 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1098769910 12:74539353-74539375 CTGCCTCCCACCCTGGGGGCAGG + Exonic
1100831321 12:98518916-98518938 CTGTCGCCCAGTCTGGGGTGCGG + Intronic
1101982271 12:109417850-109417872 CTGTCGCCCAGACTGGAGTCCGG + Intronic
1102029882 12:109734169-109734191 CTGTCACCCAGGCTGGGGTACGG - Intronic
1102084507 12:110124696-110124718 GTGTCCCCCTCCCCGGGCTCGGG - Exonic
1102341368 12:112124627-112124649 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1102556643 12:113731144-113731166 CTGCCTCCCACCCTGGGGTGGGG - Intergenic
1102587432 12:113933122-113933144 CTGTCCCCCTCCCTCGAGACTGG + Intronic
1102901212 12:116638885-116638907 CTGTCACCCAGCCTGAAGTCTGG + Intergenic
1103398980 12:120629660-120629682 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1103531551 12:121605825-121605847 CTATCACCCACCCTGGAGTGCGG + Intergenic
1103804263 12:123560184-123560206 CTGTCTCCCAGGCTGGGGTGTGG + Intergenic
1103880179 12:124159978-124160000 CTGACCTCCAGCCTGGGGCCTGG + Intronic
1104101824 12:125619732-125619754 CTGTCCAGCAGCCTGTGGTCAGG - Intronic
1104689356 12:130813713-130813735 CTGCCACCCTCCCTGGGCTCTGG - Intronic
1105677770 13:22691760-22691782 CTGTCCCCCAGGCTGGAGTGTGG - Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1106404988 13:29465580-29465602 CTGTTTCCTGCCCTGGGGTCTGG + Intronic
1107365131 13:39663849-39663871 CTGTCACCCAGCCTGGAGTATGG - Intronic
1107529306 13:41266570-41266592 CTGTCACCCAGGCTGGGGTGAGG - Intergenic
1107769283 13:43772710-43772732 CTGTCGCCCAGGCTGGGGTGCGG - Intronic
1108633637 13:52311393-52311415 CTGTCACCCACACTGGAGTCCGG + Intergenic
1109759493 13:66808982-66809004 CTGTCACCCACGCTGGAGTGCGG + Intronic
1111503306 13:89154063-89154085 CTGTCTCCCAGGCTGGGGTGCGG - Intergenic
1111644602 13:91015421-91015443 CTGTCACCCAGGCTGGGGTTTGG - Intergenic
1112002825 13:95227743-95227765 CTGTCACCCACGCTGGAGTGCGG + Intronic
1113445197 13:110360787-110360809 CCGCCCCCCACCCCGGGGCCTGG + Intronic
1114527621 14:23376577-23376599 CTAGCCCCCACCCTGGTGTTTGG - Intergenic
1115173476 14:30534846-30534868 CTGTCACCCAGGCTGGGGTGCGG + Intergenic
1115272143 14:31564561-31564583 CTGTCCCCCAGGCTGGAGTTGGG - Intronic
1115592390 14:34876638-34876660 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1115722723 14:36180990-36181012 CTGTCACCCAGGCTGGAGTCTGG + Intergenic
1117477220 14:56108266-56108288 CTGTCCCTCATTCTGGGATCAGG + Intergenic
1121288730 14:92757179-92757201 CTGTCCCCCACCCTGCTTTTTGG - Intergenic
1121671007 14:95710757-95710779 TTCTCCACCACGCTGGGGTCTGG - Exonic
1121733121 14:96200096-96200118 CTGTCCCCCAGGCTGGAGTGCGG - Intergenic
1122013090 14:98769849-98769871 CTGTCACCCAGCCTGGAGTGCGG + Intergenic
1122053913 14:99079401-99079423 CTGCTCCCCACCCAGGGTTCAGG + Intergenic
1122505116 14:102227244-102227266 CTGTCCCCCGGCCTGGCTTCAGG - Intronic
1122524832 14:102374033-102374055 CTGTCCCCCAAGCTGGAGTGCGG - Intronic
1122708612 14:103638696-103638718 CTGTCACCCAGGCTGGAGTCTGG + Intronic
1122819819 14:104335740-104335762 ATCTCCCCCACCCTGGCGTCTGG - Intergenic
1122882056 14:104694672-104694694 CCGTCCCCCACCCTGGGCCCTGG + Intronic
1122941744 14:104984638-104984660 ATTTCTCCCACCCTGGGGCCTGG - Intergenic
1122956971 14:105075472-105075494 CTATCCCCCGCCCTGAGGCCTGG - Intergenic
1123493066 15:20798520-20798542 CTGTCCCCCACCTTTGTTTCTGG - Intergenic
1123549572 15:21367622-21367644 CTGTCCCCCACCTTTGTTTCTGG - Intergenic
1125029178 15:35059509-35059531 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1125958595 15:43809455-43809477 CTGTCACCCAGGCTGGGGTACGG - Intronic
1126110784 15:45173581-45173603 CTGTCCTCCAGGCTGGGCTCAGG + Exonic
1126366795 15:47902937-47902959 CTGCCCCCCACCCTGGATTTAGG - Intergenic
1126815296 15:52448052-52448074 CTGTCTACCATTCTGGGGTCTGG - Intronic
1127391260 15:58506741-58506763 CTGCCCCCCACCCTGACGTGGGG + Intronic
1127480897 15:59376287-59376309 CTGTCACCCACGCTGGAGTGCGG + Intronic
1127629624 15:60814881-60814903 CCGTCCTCAACCCTGGGGTGAGG + Intronic
1127748680 15:62008192-62008214 CTGTCACCCAGGCTGGGGTGCGG - Intronic
1127844324 15:62856516-62856538 CTGCAGCCCACCCTGGGCTCGGG - Intergenic
1128005498 15:64236104-64236126 CTGTCGCCCAGGCTGGGGTGTGG - Intronic
1128378158 15:67091983-67092005 GTGACCCCAACCCTGGGCTCTGG - Intronic
1128568248 15:68715204-68715226 GTTTCCATCACCCTGGGGTCAGG - Exonic
1128772359 15:70291860-70291882 CTTTCCTCCTCCCTGGGGGCAGG - Intergenic
1129000610 15:72330241-72330263 CTGTCACCCAGGCTGGAGTCCGG - Intronic
1129670028 15:77602506-77602528 CTGGTCCCCACTCTGGGGACAGG - Intergenic
1129886237 15:79039804-79039826 CTGTCCCCCAGACTGGAGTATGG + Intronic
1130407639 15:83616287-83616309 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
1130949340 15:88573274-88573296 CTGTCACCCAGGCTGGGGTGCGG + Intergenic
1130957705 15:88639128-88639150 CTGCCCCGCAGCCTGGGGACCGG - Intronic
1131034785 15:89215021-89215043 CTGGCTCCCACCCTGTGGGCTGG - Intronic
1131341690 15:91608560-91608582 GTGGCTCCCACCCTGGGGACAGG - Intergenic
1132186461 15:99806086-99806108 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1132215095 15:100056691-100056713 CTGGTCCGCAACCTGGGGTCTGG + Intronic
1132224565 15:100130325-100130347 CTGTCCCCCAGGCTGGAGTGCGG - Intronic
1132252650 15:100345829-100345851 CCATCCCCCACCCTGGGCTCTGG + Intergenic
1132355342 15:101167738-101167760 TTGTGGCCCCCCCTGGGGTCTGG - Intergenic
1202957903 15_KI270727v1_random:94840-94862 CTGTCCCCCACCTTTGTTTCTGG - Intergenic
1132686594 16:1164826-1164848 CTGTCCACAGCCCTGGGGTCTGG + Intronic
1132970887 16:2688285-2688307 CTGTCCCCCAGGCTGGAGTGTGG + Intronic
1133163509 16:3928700-3928722 CTGTCCCCCAGGCTGGAGTGCGG - Intergenic
1133233404 16:4376826-4376848 CTGCCCTTCACCCTGGGGGCTGG - Intronic
1133350392 16:5097484-5097506 CGGTCCCCGTCCCTGGGGCCTGG - Intronic
1134152276 16:11814533-11814555 CTGTCACCCAGGCTGGAGTCTGG + Intergenic
1134534251 16:15012813-15012835 CTGTCACCCAGGCTGGGGTATGG - Intronic
1134578448 16:15351495-15351517 CTGTCCCCCAGCCAGGCGGCCGG + Intergenic
1134724141 16:16406049-16406071 CTGTCCCCCAGCCAGGCGGCCGG - Intergenic
1134943288 16:18305820-18305842 CTGTCCCCCAGCCAGGCGGCCGG + Intergenic
1135257676 16:20954184-20954206 CTGTCACCCACGCTGGAGTGTGG - Intronic
1135709991 16:24708275-24708297 CTGTCGCCCAGGCTGGGGTGCGG + Intergenic
1135887208 16:26321265-26321287 CTGTTCCCCAGCCTGGAGTACGG + Intergenic
1135907443 16:26525753-26525775 CTGTCACCCAGGCTGGGGTACGG - Intergenic
1136294940 16:29296204-29296226 CTGCTCCCCACCCTGGGCCCAGG + Intergenic
1136407460 16:30056635-30056657 CTGTCACCCAGGCTGGAGTCTGG + Intronic
1136617220 16:31405677-31405699 CTGTCTCCCAGGCTGGGGTGCGG + Intronic
1137286321 16:47018792-47018814 CTGTCACCCAGCCTGGAGTGCGG - Intergenic
1137626985 16:49915298-49915320 CTTTCCCCCACCCTTTGCTCAGG + Intergenic
1137822907 16:51462786-51462808 CTGTCACCCAGCCTGGAGTGCGG + Intergenic
1138485426 16:57339781-57339803 CTGTCACCCAGACTGGAGTCCGG - Intergenic
1139423639 16:66865316-66865338 CTGTCACCCAGGCTGGAGTCTGG + Intronic
1139637506 16:68266969-68266991 CTGTCACCCAGGCTGGGGTGTGG + Intronic
1139740319 16:69030069-69030091 CTGTCGCCCAGGCTGGGGTGCGG - Intronic
1139861791 16:70027916-70027938 CTGTCACCCAGGCTGGGGTATGG + Intergenic
1139912765 16:70408351-70408373 CTGCCCCCCACCCAGGAGGCAGG - Intronic
1141049161 16:80745101-80745123 CACTCCCCCACGCTGGGGGCAGG + Intronic
1141143027 16:81509651-81509673 CTGACCCCAACCCTAGGGTAGGG - Intronic
1141604506 16:85145159-85145181 CTGTCCCCGACCCTGACCTCGGG - Intergenic
1141651120 16:85393794-85393816 CTGCCCCCCAGCCTGGTGGCTGG + Intergenic
1141804616 16:86334613-86334635 CTGAGCCCCACCCTGGGTTAGGG - Intergenic
1142098691 16:88259796-88259818 CAGCCCCCCACCCCAGGGTCAGG - Intergenic
1142100834 16:88270213-88270235 CTGCTCCCCACCCTGGGCCCAGG + Intergenic
1142266273 16:89065319-89065341 CTGCCACCCACCCAGGGGACTGG + Intergenic
1142351785 16:89583963-89583985 TGGTCCCCCACGGTGGGGTCAGG + Intronic
1142373731 16:89696522-89696544 CTCTGCCCTACCCTCGGGTCTGG - Exonic
1142626196 17:1193718-1193740 CTGTCCCCCAGGCTGGAGTGTGG + Intronic
1142914360 17:3123682-3123704 CTGTCACCCAGGCTGGGGTGCGG - Intergenic
1143094099 17:4467703-4467725 CTGTCGCCCACGCTGGAGTGCGG + Intronic
1143295886 17:5871645-5871667 CTGTCACCCAGGCTGGAGTCTGG - Intronic
1143386936 17:6536538-6536560 CTGTCCCCCATTCTTGGCTCTGG - Intronic
1144186091 17:12796631-12796653 CTGTCACCCAGCCTGGAGTGCGG + Intronic
1144642127 17:16943485-16943507 CTGTCCCCCTCCCAGGTCTCTGG + Intronic
1144941681 17:18946591-18946613 CTGCCCCACACCCTGGGGGAAGG - Intergenic
1144942599 17:18952011-18952033 CTGCACCCCACCATGGGGTGAGG + Intronic
1144947432 17:18977094-18977116 CTGTTCCCCAACCTGGGGAGTGG + Intronic
1145963258 17:28899948-28899970 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
1146056843 17:29585549-29585571 CTTTCCCCCAGCCTGGGGGAGGG + Intronic
1146206286 17:30907812-30907834 CTGTCCCCCACGCTGGAGTGTGG - Intronic
1146346807 17:32065531-32065553 CTGTCCCCCAGGCTGGAGTGTGG + Intergenic
1147018288 17:37510196-37510218 CTGTCCTCCACCTTGTGTTCAGG + Intronic
1147047657 17:37766598-37766620 CTGTCCCCCAGGCTGGAGTGAGG + Intergenic
1147961516 17:44170557-44170579 CTGGCCCTCACCCTGGGCTGGGG + Intronic
1148002559 17:44398322-44398344 GTGTCCCCATCACTGGGGTCGGG + Exonic
1148024539 17:44577301-44577323 CTGTCACCCAGGCTGGGGTACGG - Intergenic
1149614538 17:57987662-57987684 CGGTCCCCCACGGTGGGGTGAGG - Intronic
1149781758 17:59403123-59403145 CTGTCACCCAGGCTGGAGTCTGG - Intergenic
1150745379 17:67812534-67812556 CTGTCACCCAGGCTGGGGTACGG + Intergenic
1150766091 17:68003406-68003428 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1151324011 17:73367952-73367974 CTGTCCCCCGCACTAGGGTGGGG + Intronic
1151599002 17:75094886-75094908 CTGCTCCCAACGCTGGGGTCAGG - Intronic
1151709780 17:75797270-75797292 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
1151826578 17:76527288-76527310 CTGTCCCCCATCCCCGGTTCTGG - Intergenic
1151913891 17:77103476-77103498 CTGCCCTCCAGCCTGGGGTGAGG - Intronic
1151940479 17:77288534-77288556 CTGATCCGCACCCTGGGGCCGGG + Intronic
1151982954 17:77525109-77525131 CTACCCCCTACCCTGGGGACAGG + Intergenic
1152092600 17:78255424-78255446 CTGTCCCCCAGCCTGGCACCTGG - Intergenic
1152228534 17:79103586-79103608 CTGAACCCCACCTTGGGGTAGGG + Intronic
1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG + Intronic
1152558832 17:81067834-81067856 CTGTGCCCCAACCGGGGGACAGG - Intronic
1152612779 17:81323748-81323770 CGGTTCCACACCCTGGGGCCGGG + Intronic
1152642301 17:81454323-81454345 CTGTCCCCCAGGCTGGGAGCTGG - Intronic
1152693090 17:81730020-81730042 CTGTCACCCAGGCTGGGGTGCGG - Intergenic
1153769938 18:8407404-8407426 CTCTGCGCCACCCTGGGCTCTGG + Intergenic
1154023367 18:10684499-10684521 CTGTCGCCCAGGCTGGGGTGCGG + Intronic
1154109770 18:11557385-11557407 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1154122879 18:11665742-11665764 CTGTCACCCACCCTTGGGGCAGG - Intergenic
1154390426 18:13931929-13931951 CTTTCCCTCACTCTGGGGCCAGG + Intergenic
1154450606 18:14473053-14473075 CTGTCCCCCACCTTTGTTTCTGG - Intergenic
1157535758 18:48456221-48456243 CTGTCCCACAATCTGGGCTCAGG - Intergenic
1157579333 18:48764404-48764426 CTGCCCCCCATCTTGGGCTCTGG + Intronic
1157613747 18:48975423-48975445 GCGGCCCCCACCCTGGGGCCAGG + Intergenic
1158441231 18:57476075-57476097 GCTTCCCCCACCCTGGCGTCTGG + Intronic
1158706962 18:59801460-59801482 CTGTCCCCCAAGCTGGAGTACGG + Intergenic
1158852658 18:61511021-61511043 CTGTCACCCAAGCTGGGGTGTGG + Intronic
1160019269 18:75167778-75167800 CTCGCCCCCACCCTGGGCTCTGG - Intergenic
1160115945 18:76079883-76079905 CTGTCCCCCAGACTGGAGTGCGG + Intergenic
1160145554 18:76361383-76361405 CCGTCCCCCACCCAAGGGGCTGG + Exonic
1160324092 18:77925450-77925472 CTGTCACCCACGCTGGAGTACGG - Intergenic
1160588688 18:79927665-79927687 CTGTCCCACTCACTGGGGTTGGG - Intronic
1160766294 19:809862-809884 CTGCCGCCCAGCCTGGAGTCTGG - Intronic
1160925638 19:1543754-1543776 CTGTCGCCCAGGCTGGGGTGCGG - Intergenic
1161008818 19:1950174-1950196 CTGTCCCCCAGGCTGGAGTGTGG + Intronic
1161087247 19:2340821-2340843 CTGCCCACCACCCTTGGGACCGG - Intronic
1161118469 19:2512421-2512443 ATGGCCACCTCCCTGGGGTCCGG + Exonic
1161199762 19:3008043-3008065 CTGTCCCCCAGGCTGGAGTACGG - Intronic
1161504266 19:4635698-4635720 CTGTCACCCTCCCTGGGGTCGGG - Intergenic
1161588143 19:5116718-5116740 CCTGCCCCCACCCTGGGGTCTGG - Intronic
1161723720 19:5916913-5916935 CTGTCCCCCACCTGTGGTTCTGG - Exonic
1161849100 19:6729810-6729832 CTGACCCCCACTCTGGGCACTGG + Intronic
1161975845 19:7607506-7607528 CCTTCCCCCACCCTGGGGCCTGG + Intronic
1162061333 19:8097253-8097275 CTGTTCCCAGCCCTGGGGCCTGG - Intronic
1162303335 19:9856776-9856798 CTGCGCCCACCCCTGGGGTCAGG - Intronic
1162325758 19:9998138-9998160 CTCTCCAGCACCCTGGGGTGGGG + Exonic
1162459615 19:10806754-10806776 CTGTCACCCACACTGGAGTGCGG - Intronic
1162518141 19:11162419-11162441 CTGTCGCCCAGGCTGGGGTACGG + Intergenic
1162701253 19:12516687-12516709 CTGTCACCCATGCTGGGGTGCGG + Intronic
1163143824 19:15367833-15367855 CTGCCCCCTAGCCTGGTGTCTGG - Intronic
1163326814 19:16609273-16609295 CTGTCACCCAGACTGGAGTCCGG - Intronic
1163771018 19:19191453-19191475 CTGTCGCCCAGGCTGGGGTGCGG - Intronic
1163831267 19:19548208-19548230 CTGTCCCCTTCCCTAGGGTGGGG + Intergenic
1164573918 19:29394271-29394293 CTGGCCCTCTCCCTGGGGTCTGG + Intergenic
1164690949 19:30210386-30210408 CTGTGCCCCACGCTGGGCCCCGG - Intergenic
1165013318 19:32864066-32864088 CTGACCCCTGCCCTGGGCTCAGG + Intronic
1165108397 19:33487583-33487605 CTGCCCCCCACCCCGGGTGCTGG - Intronic
1165144806 19:33724336-33724358 CGAGCCCCCACCCGGGGGTCAGG + Intronic
1165196328 19:34106776-34106798 CTGTCACCCAGCCTGGAGTGCGG - Intergenic
1165200148 19:34136838-34136860 CTGTCCCCCAGGCTGGAGTGCGG - Intergenic
1165662127 19:37590378-37590400 CTGTCCCCCAGGCTGGAGTGCGG - Intronic
1165776370 19:38406746-38406768 CTGTCACCCAGCCTGGAGTGTGG - Intronic
1166076108 19:40414699-40414721 CTGTGCCGCCCCCCGGGGTCTGG - Intergenic
1166094549 19:40530729-40530751 CGGACCCCCACCCTGGGGGAGGG + Intronic
1166758194 19:45207517-45207539 CTGTCACCCACACTGGAGTGTGG - Intronic
1166827266 19:45617207-45617229 CTGTCGCCCAGACTGGAGTCCGG - Intronic
1166996721 19:46722999-46723021 CTGTCCCCCACCCTGGGGCAGGG - Intronic
1167021324 19:46878355-46878377 CTGTCACCCAGGCTGGGGTGCGG + Intergenic
1167074422 19:47240023-47240045 CTGTCCCGCACTCTCGGGTGAGG + Intergenic
1167199124 19:48051914-48051936 CTGTCGCCCAGCCTGGAGTGGGG + Intronic
1167263735 19:48473126-48473148 GCATCCCCCACCCTGGGGGCAGG + Intronic
1167269280 19:48498691-48498713 CTGTCCCCCGGCTTGGGGCCCGG + Exonic
1167398180 19:49245469-49245491 CTGTCACCCAGCCTGGAGTGCGG + Intergenic
1167487641 19:49772530-49772552 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
1167883371 19:52480857-52480879 CTGTCACCCAGACTGGGGTGCGG - Intronic
925309286 2:2870898-2870920 CTGTTCCGTACCCTGGGGCCTGG - Intergenic
925858969 2:8156782-8156804 CTCTTCCCCACCATGGGGTCAGG + Intergenic
926171813 2:10557485-10557507 CTGTCGCCCACGCTGGAGTGTGG - Intergenic
926699464 2:15793566-15793588 CTCTCCACATCCCTGGGGTCTGG - Intergenic
927199551 2:20569911-20569933 CAGTCTCCCTCCCTGGGATCAGG + Intronic
927464269 2:23325325-23325347 CTGTCCCCCAGGCTGGAGTGTGG - Intergenic
927484998 2:23482435-23482457 CTGACCCCCAGCCTGTGCTCTGG + Intronic
928112575 2:28522530-28522552 GTGTCCCACATCCTGGGCTCTGG - Intronic
928146719 2:28785109-28785131 CTGCCCCCCAGCCTGGTGACAGG - Intronic
928965773 2:36973992-36974014 CTGTCACCCAGGCTGGAGTCCGG + Intronic
929276555 2:40032147-40032169 CTGTCACCCACACTGGAGTACGG - Intergenic
929469732 2:42179637-42179659 CTGTCGCCCAGGCTGGGGTGCGG + Intronic
929516921 2:42611776-42611798 CTGTCCCCCAGGCTAGGGTGTGG - Intronic
929608143 2:43249443-43249465 CTTTCCCCTTCCCTGTGGTCAGG + Intronic
930008321 2:46915525-46915547 CTGTGCCCCACCGGGGGCTCTGG - Intronic
932064321 2:68537126-68537148 CTGTCTCCCAACCTGGAGTGTGG - Intronic
932178741 2:69626534-69626556 CTGTCTCCCAGCCTGGAGTGAGG + Intronic
932203869 2:69859695-69859717 CTGTGGCCCAGGCTGGGGTCCGG - Intronic
932406662 2:71517394-71517416 CTATGCCCCACCCTCAGGTCAGG + Intronic
932750397 2:74367930-74367952 TGGACCCCCACCCTGGGGTGAGG + Intronic
932887114 2:75558551-75558573 CTTTCCCCCAACCTGGGGCAGGG + Intronic
934174948 2:89570509-89570531 CTGTCGCCCAGCCTGGAGTGCGG + Intergenic
934285264 2:91644859-91644881 CTGTCGCCCAGCCTGGAGTGCGG + Intergenic
934552098 2:95268904-95268926 CTGTCTCCTCCCCAGGGGTCAGG + Intergenic
935139014 2:100334551-100334573 CACTCCCCCTCCCTGGGGCCTGG + Intergenic
935363456 2:102267112-102267134 CTGGTCCCTGCCCTGGGGTCAGG + Intergenic
936091082 2:109501798-109501820 CTGGCCCCCACCCTGGGCCAGGG - Intronic
936564535 2:113572761-113572783 CTGTCACCCAGCCTGGAGTGCGG - Intergenic
937035828 2:118781128-118781150 CTGTCACCCAGGCTGGAGTCTGG + Intergenic
937134413 2:119540576-119540598 CTGTCCCCTCCCCTTGAGTCTGG - Intergenic
937954936 2:127416831-127416853 CTGTCTCCCAACCTGGGGTGGGG + Intergenic
937980515 2:127611967-127611989 CTGAGCCCCTCCCTGGGGGCTGG + Intronic
938090731 2:128432939-128432961 CTGTCCCCCAAGCTGGAGTATGG + Intergenic
938369617 2:130761085-130761107 CTGTCCTCCACTCGGAGGTCAGG + Intronic
938846951 2:135219906-135219928 CTGTCACCCAGGCTGGGGTGCGG + Intronic
939002466 2:136752230-136752252 CTGTCACCCAGGCTGGAGTCTGG - Intergenic
939629594 2:144516684-144516706 CTCCCTCCCACCCCGGGGTCTGG + Intronic
940136595 2:150443306-150443328 CTGTCCCCCAGGCTGGAGTGCGG - Intergenic
940151146 2:150602390-150602412 CTGTCACCCAGGCTGGAGTCCGG + Intergenic
940656673 2:156495311-156495333 CTGTTGCCCAGCCTGGGGTGCGG - Intronic
941168651 2:162110503-162110525 CTGCCCCCCAGCCTGGTGACAGG + Intergenic
941169226 2:162117520-162117542 CTGTTGCCCAGCCTGGGGTGTGG + Intergenic
941828084 2:169921952-169921974 CTGTCCCCCAGACTGGAGTACGG - Intronic
941951284 2:171160169-171160191 CCATCCCCCACCCCAGGGTCTGG + Intronic
942034088 2:171993999-171994021 CTGTCACCCACACTGGAGTGTGG - Intronic
942673602 2:178403382-178403404 CTGTCTCCCAACCTGGAGTGCGG - Intergenic
944413327 2:199462531-199462553 GTGTCCCCCGCCCTGCGCTCCGG - Intronic
944416403 2:199483892-199483914 CTGTCACCCAAGCTGGGGTGTGG + Intergenic
944560509 2:200932374-200932396 CTGTCACCCAGCCTGGAGTGTGG + Intronic
944661832 2:201927975-201927997 CTGTCACCCACACTGGAGTGCGG + Intergenic
945411809 2:209518515-209518537 CTGTCCCGCACCCTCTGTTCAGG - Intronic
946743943 2:222827443-222827465 CTGTCACCCAGCCTGGAGTGTGG - Intergenic
947211719 2:227714845-227714867 CTGTCACCCAGGCTGGAGTCTGG + Intronic
947581127 2:231319325-231319347 GTGTCCCCCATCCTAGGATCAGG + Intronic
947739891 2:232480241-232480263 CTGCCCAGCACCCTGGGGTGGGG + Exonic
948232193 2:236356690-236356712 CTGACCTCCGCCCTGGAGTCAGG - Intronic
948283902 2:236769439-236769461 CTGTGCCCCAACCTGGGCCCAGG - Intergenic
948444564 2:238022204-238022226 CTGTCCCCCAGGCTGGAGTCCGG + Intronic
948776177 2:240290141-240290163 CTGTGCCCCACGCTGGGGAACGG + Intergenic
948883394 2:240871455-240871477 CAGTCCACCGCCCTGGGGCCAGG - Intronic
1169094644 20:2886020-2886042 CTGTCGCCCACACTGGAGTGTGG - Intronic
1169195664 20:3680980-3681002 CTGAGCCCTATCCTGGGGTCAGG - Intronic
1169246483 20:4029217-4029239 CTGTCGCCCAGGCTGGGGTGCGG + Intergenic
1169288663 20:4330621-4330643 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1169841301 20:9940792-9940814 ATTTCCCCAACCCTGGAGTCTGG - Intergenic
1170248383 20:14249893-14249915 CTATCCCCCACCCCCGTGTCTGG - Intronic
1170292732 20:14788803-14788825 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
1171972315 20:31572101-31572123 CTGTCCCCCAGGCTGGAGTGCGG - Intronic
1172411829 20:34730102-34730124 CTGTCCCCCAGGCTGGGGTGTGG + Intronic
1172485113 20:35293171-35293193 CTCTCACCACCCCTGGGGTCAGG - Intergenic
1172689501 20:36780548-36780570 TTGTCCCCCACCCCAGGGCCAGG + Exonic
1172774351 20:37398415-37398437 CTCTCCTCCACCCTGGCCTCCGG - Intronic
1172816920 20:37694367-37694389 CTCTTCCTCACCCTGGGGCCTGG + Intronic
1172959323 20:38787416-38787438 CTGACCTCCAGCCTGGGGACAGG - Intergenic
1173252735 20:41373273-41373295 CTGTCCCCCTCTCTTGGGTTGGG - Intergenic
1173520963 20:43700177-43700199 GTGTCCCCAGCCCTTGGGTCAGG - Intronic
1173872572 20:46351141-46351163 CTGGTCCCCAGCCTGGGATCTGG - Intronic
1174118819 20:48247165-48247187 CTGTCCCTTTCCCTGGGGACAGG - Intergenic
1174402225 20:50282253-50282275 GTGTCCCCCAGCCAGGGGGCGGG + Intergenic
1174494003 20:50926061-50926083 CTGTCTCCCAGGCTGGGGTGCGG - Intronic
1174829921 20:53803313-53803335 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1175801328 20:61802700-61802722 CTGCCTCCCAGCCTGGGGGCCGG + Intronic
1176155455 20:63617834-63617856 GTGTCACCCACCCAGGCGTCTGG - Intronic
1176445589 21:6817329-6817351 CTGTCCCCCACCTTTGTTTCTGG + Intergenic
1176823756 21:13682362-13682384 CTGTCCCCCACCTTTGTTTCTGG + Intergenic
1177153006 21:17473449-17473471 CTGTCACCCACGCTGGAGTGCGG - Intergenic
1177348769 21:19907232-19907254 CTGTCACCCAGCCTGGAGTGCGG - Intergenic
1177958743 21:27635362-27635384 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1178302528 21:31464971-31464993 CTGTCCCCCAAGCTGGAGTGCGG - Intronic
1178497425 21:33099165-33099187 CTGTACCCCAGCCGGGGGACAGG + Intergenic
1178608211 21:34057552-34057574 CAGACCCCCTCCCTGGGGTAGGG + Intergenic
1179219076 21:39390394-39390416 CTGTCTGCCACCCGGGGGTTGGG + Intronic
1179727162 21:43347063-43347085 CTGGCCCCCTCACTGTGGTCTGG - Intergenic
1180073327 21:45449538-45449560 CTCTCCCCCACGGTGGGGGCAGG - Intronic
1180096624 21:45558322-45558344 CAGGCCCACACCCTGGGGCCAGG - Intergenic
1180613278 22:17111097-17111119 CTGTCCCCACCCCTGAGCTCTGG - Exonic
1180632130 22:17236967-17236989 CTGTCCCCCAGGCTGGGTTCAGG - Intergenic
1180793869 22:18592356-18592378 CCTTCCCCCACCCTGGGGCAGGG - Intergenic
1180947012 22:19700899-19700921 CTGTCACCCAGCCTGGAGTGCGG - Intergenic
1181227871 22:21402964-21402986 CCTTCCCCCACCCTGGGGCAGGG + Intergenic
1181567335 22:23747184-23747206 CTGTCCCCCACTCTGGGGGTTGG - Intronic
1181570951 22:23767628-23767650 CAGCCCTCCAGCCTGGGGTCTGG - Intronic
1181647174 22:24238190-24238212 CTGTCCCCCAGGCTGGGGTGTGG - Intronic
1182020003 22:27073688-27073710 CTGTCCCCCTGCCTGGAGGCTGG - Intergenic
1182119663 22:27778697-27778719 CTGTCCTCCTCCCCGAGGTCTGG + Intronic
1182142504 22:27973204-27973226 CTGTCACCCAGGCTGGGGTGTGG + Intergenic
1182272909 22:29166894-29166916 CTGTCACCCAGCCTGGAGTGCGG - Intronic
1182315010 22:29439907-29439929 CTCTTCCCAACCCTGGGGTGAGG - Intronic
1182377825 22:29860880-29860902 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1182521874 22:30889400-30889422 CTGCCCTCCACCCTGAGGACTGG - Intronic
1182541440 22:31044941-31044963 CTGTCCCCCAGGCTGGAGTGAGG + Intergenic
1182555287 22:31125706-31125728 CTGTCCCCCACCTTCCGGCCTGG + Exonic
1182694994 22:32192426-32192448 CTCTTCCCAACCCTGGGGTAAGG + Intronic
1183285973 22:36964282-36964304 CTTTCCCCTCCCCTTGGGTCTGG + Intergenic
1183592327 22:38787000-38787022 CTGCCCCCCTCCCAGGGGGCTGG - Intronic
1183596971 22:38818716-38818738 CCCTTCCCCACCCAGGGGTCGGG + Exonic
1183789462 22:40054177-40054199 CTGTCACCCACACTGGAGTGTGG - Intronic
1184214833 22:43059724-43059746 CTGTCCCCCAAGCTGGAGTGCGG + Intronic
1184494115 22:44827377-44827399 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
1185074104 22:48673925-48673947 CTGGCCCCGGCTCTGGGGTCGGG + Intronic
1185267946 22:49914405-49914427 CCGAACCCCACCCTGGGGGCTGG + Intronic
1185305962 22:50116408-50116430 CTGTCACCCAGCCTGGAGTGCGG - Intronic
1185370393 22:50458266-50458288 CTGTCACCCACGCTGGAGTGCGG - Intronic
1185410002 22:50676867-50676889 CTGACCCCAACCATGGGGCCAGG - Intergenic
950069142 3:10138143-10138165 CTGTCGCCCAGGCTGGAGTCCGG + Intergenic
950075231 3:10182317-10182339 CTGTCGCCCAGCCTGGAGTGCGG + Intronic
950296673 3:11838249-11838271 CTGTCGCCCAGGCTGGGGTGCGG + Intronic
950407216 3:12812258-12812280 CTGTCCCCCAGGCTGGAGTACGG + Intronic
950634258 3:14303836-14303858 CTCACCCCCACCCTGTGCTCTGG - Intergenic
950655921 3:14436235-14436257 CTGTCACCCAGCCTGGAGTGAGG + Intronic
951166678 3:19490574-19490596 CGGTGCCACACCCTGGGGCCTGG - Intronic
951526486 3:23657687-23657709 CTGTCACCCATACTGGGGTGTGG - Intergenic
951557849 3:23938682-23938704 ATGTCCCCTACCCTTGGATCTGG + Intronic
951609780 3:24479263-24479285 CTGTCCCCCAGACTGGAGTGCGG - Intronic
952325673 3:32318601-32318623 CTGTCACCCAGCCTGGAGTGCGG + Intronic
952378072 3:32783496-32783518 CTGTCACCCACGCTGGAGTGCGG + Intergenic
952454450 3:33459841-33459863 CTGTCACCCAGCCTGGAGTACGG + Intergenic
952642623 3:35615225-35615247 CTGTCCCCCAGGCTGGAGGCTGG - Intergenic
953376973 3:42436847-42436869 CTGTCGCCCAGGCTGGAGTCTGG - Intergenic
954036075 3:47851930-47851952 CTGTCCCATTCCCTGGGATCTGG - Exonic
954222187 3:49161672-49161694 CATTCCCCCTCCCTGGGGTAGGG - Intergenic
954368987 3:50160549-50160571 CTGCCCCTCACCCTGGGCCCAGG - Intronic
954398080 3:50303498-50303520 TAGGCCCCCATCCTGGGGTCAGG - Exonic
954660765 3:52225696-52225718 CTGTCCTCCTCACTGGGGGCAGG - Exonic
954883817 3:53854735-53854757 TTCTACCCCACCCTGGGGTGAGG + Intronic
955204401 3:56882548-56882570 CTGTCGCCCAGGCTGGGGTGCGG + Intronic
955338545 3:58107064-58107086 CTGTCGCCCAGGCTGGGGTACGG + Intronic
955568799 3:60279993-60280015 CTGTCACCCACGCTGGAGTGCGG - Intronic
957054679 3:75434856-75434878 CGGTCCCCGTCCCTGGGGCCTGG - Intergenic
957203609 3:77166593-77166615 CTGTCGCCCAGGCTGGGGTGCGG + Intronic
961139433 3:124543336-124543358 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
961300166 3:125916857-125916879 CGGTCCCCATCCCTGGGGCCTGG + Intergenic
961481775 3:127185008-127185030 CTGTCCCCCTACCTGAGGCCTGG - Intergenic
961888339 3:130111217-130111239 CGGTCCCCGTCCCTGGGGCCTGG - Intronic
962303396 3:134263638-134263660 CTGTCGCCCACGCTGGAGTGCGG - Intergenic
962754843 3:138459285-138459307 CTGATCCCCACCCTGGGGGCTGG - Intronic
963137681 3:141922614-141922636 CTGTCACCCAACCTGGAGTGTGG - Intronic
963187414 3:142434718-142434740 CTGTCTCCCACGCTGGAGTTTGG - Intronic
963249728 3:143092057-143092079 CTGTCACCCAGGCTGGGGTGTGG - Intergenic
963321249 3:143811823-143811845 CTGTCACCCAGCCTGGAGTGTGG - Intronic
964960723 3:162420922-162420944 CTGTCACCCAGCCTGGAGTGCGG - Intergenic
965189470 3:165509438-165509460 CTGTCACTCACCCTGTGTTCTGG + Intergenic
965487142 3:169292294-169292316 CTGTCACCCAGGCTGGGGTGTGG - Intronic
966731150 3:183152305-183152327 CTCTCCCTCATCCTGGGGCCAGG - Intronic
967065674 3:185913017-185913039 CTGTCCCCCAGGCTGGAGTACGG - Intergenic
967721936 3:192825176-192825198 CTGTCGCCCAGGCTGGGGTGCGG + Intronic
967805328 3:193710711-193710733 CTGGCCTCCACTCTGCGGTCCGG - Intergenic
968575178 4:1362676-1362698 CTGTCCCTCACCTTGAGGGCGGG + Intronic
968582165 4:1400251-1400273 GTGTCCCCCACTTTGGTGTCAGG - Intergenic
968656392 4:1780139-1780161 CTGTCCTTGACCCTGGGGCCTGG - Intergenic
968704676 4:2072358-2072380 CTGTCCCCCTGCTTGGGGTCTGG - Intronic
968719703 4:2192385-2192407 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
968728612 4:2259621-2259643 CTGGACCCCACCCTGGAGGCAGG + Intronic
968745146 4:2356133-2356155 CTCTCCCCACCCCAGGGGTCTGG - Intronic
968811480 4:2801396-2801418 CGGTTCCCCAACCCGGGGTCTGG + Intronic
968936409 4:3612669-3612691 CTGTTCCCCTGCCTGGGATCAGG - Intergenic
968997491 4:3955164-3955186 CGGTCCCCGTCCCTGGGGCCTGG - Intergenic
969071638 4:4544101-4544123 CCGGCCCCCTCCCTGGGTTCTGG - Intergenic
969387848 4:6867848-6867870 CTGTCCCCCACACTGGGATCTGG - Intronic
969756526 4:9153529-9153551 CGGTCCCCGTCCCTGGGGCCTGG + Intergenic
970048144 4:11878971-11878993 CTGTCGCCCACGCTGGAGTGCGG - Intergenic
971352820 4:25868113-25868135 CTTTCCCCCACCCTGAGCTGGGG + Intronic
971612818 4:28746997-28747019 CTGTCCCTCACGCTGGAGTGCGG - Intergenic
971791458 4:31175045-31175067 CTGTCCCCCAGGCTGGAGTGGGG + Intergenic
972507892 4:39738712-39738734 CTGTCACCCAGCCTGGAGTGCGG + Intronic
972603475 4:40593030-40593052 CTGTCGCCCAGGCTGGAGTCCGG + Intronic
972823695 4:42731929-42731951 CTGTACCCCAGCCTGGGGCCTGG + Intergenic
973936742 4:55853893-55853915 CTGTCTCCACGCCTGGGGTCGGG + Exonic
974797139 4:66767097-66767119 CTGTCTACCATTCTGGGGTCTGG - Intergenic
975966962 4:79985311-79985333 CTGTCGCCCAGGCTGGAGTCCGG - Intronic
976304452 4:83546019-83546041 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
976651629 4:87440807-87440829 CTGTCACCCACGCTGGAGTGCGG - Intronic
977255399 4:94734985-94735007 CTGTCCCCCAGGCTGGAGTGTGG + Intergenic
977568789 4:98609350-98609372 CTCTCCCCCAGCCAGTGGTCGGG - Intronic
978312262 4:107397396-107397418 CTGGCCCCTGCTCTGGGGTCAGG + Intergenic
978435126 4:108676112-108676134 CTGTCACCCAAGCTGGGGTGCGG + Intergenic
979658160 4:123221190-123221212 CTGTCACCCAGGCTGGGGTGCGG + Intronic
980092355 4:128455778-128455800 CTGTCCCCCAGCCTGGGCTATGG + Intergenic
980109115 4:128617677-128617699 CTGTCCCCCAGGCTGGAGTGCGG - Intergenic
981614740 4:146634681-146634703 CTATCCCCCACCCCTGGGTGAGG - Intergenic
981674385 4:147324381-147324403 CTGGCACACACCCTGGGGGCAGG - Intergenic
981716542 4:147757835-147757857 CTGTTCCCTTCCCTGGGATCTGG + Intronic
982075484 4:151732416-151732438 CTGCCCCCAACCCTGTGCTCTGG + Intronic
982235465 4:153248030-153248052 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
982263257 4:153514847-153514869 CTGTCCCCCAGGCTGGAGTGTGG + Intronic
982281104 4:153684394-153684416 CTGCACCCCTTCCTGGGGTCGGG + Intergenic
983227537 4:165099139-165099161 CTGTCACCCAGGCTGGAGTCTGG + Intronic
985145151 4:186888995-186889017 CTGTCGCCCAGGCTGGAGTCCGG - Intergenic
985619697 5:947762-947784 CTGCCACCCACACTGGTGTCTGG - Intergenic
985884137 5:2663366-2663388 CTGTCCCCAACACTGGGGCAGGG + Intergenic
985909161 5:2865568-2865590 CTGTCACCCAGCCTGGAGTGCGG + Intergenic
986175147 5:5345991-5346013 CTGTCCCCCAGGCTGGAGTGCGG - Intergenic
986692175 5:10322121-10322143 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
988554001 5:32221013-32221035 CAATCCCCCACCCAGGGGCCAGG - Intergenic
988606931 5:32686589-32686611 CTGTCCCCCAGACTGGAGTATGG - Intergenic
989041045 5:37229500-37229522 CTGTCCCCCAGGCTGGAGTGCGG - Intronic
989519167 5:42380906-42380928 CTGTCGCCCAGCCTGGAGTGCGG + Intergenic
989794475 5:45449872-45449894 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
989989057 5:50739770-50739792 CTGTCACCCACGCTGGAGTGAGG + Intronic
990571157 5:57080101-57080123 CTGTCCCCCAGGCTGGTGTGTGG - Intergenic
991060072 5:62365054-62365076 CTGTCACCCAGGCTGGGGTGTGG - Intronic
991135787 5:63180320-63180342 CTGTCACCCAGGCTGGGGTGCGG - Intergenic
991425398 5:66486649-66486671 CTGTCACCCAGGCTGGAGTCTGG - Intergenic
991663065 5:68969659-68969681 CTGTCTCCCACCCAGTGCTCTGG - Intergenic
991705737 5:69356612-69356634 CTGTCGCCCAGCCTGGAGTACGG - Intronic
992315304 5:75546700-75546722 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
992405374 5:76452389-76452411 CTGTCCCCCTTCCTGGGGGGAGG - Intronic
992690170 5:79234290-79234312 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
993071282 5:83166916-83166938 CTGTCACCCAGACTGGGGTGCGG + Intronic
993289098 5:86041803-86041825 CTGTCCCTCACGCTGGAGTGTGG + Intergenic
993377149 5:87162006-87162028 CTGTCACCCACGCTGGAGTGCGG + Intergenic
993831014 5:92758091-92758113 CTGTCCCCCAGGCTGGAGTGAGG + Intergenic
995224818 5:109690197-109690219 CTGCCGCCCTCCCCGGGGTCGGG - Exonic
997515725 5:134488279-134488301 CTGTCGCCCAGCCTGGAGTGCGG + Intergenic
997635110 5:135399006-135399028 CTGTCCCCGCCGCTCGGGTCCGG - Intronic
997977402 5:138448426-138448448 CTTTCCCTCCCCCTGGGTTCCGG - Intergenic
998453871 5:142255452-142255474 CTGTCACCCAGCCTGGAGTATGG - Intergenic
999475790 5:151897928-151897950 CTGTCCACCACCTTTTGGTCAGG + Intronic
999765641 5:154738553-154738575 CTGTCCCCCAGTCTGGAGTGCGG - Intronic
1000021420 5:157322298-157322320 CTGACACCCACCCAGGGCTCTGG + Intronic
1000074860 5:157775402-157775424 CTGTCACCCAGCCTGGAGTGCGG - Intergenic
1000185663 5:158855506-158855528 CTCTTCCCCACCCTGGGTCCTGG + Intronic
1001258455 5:170203893-170203915 CTGTCACCCACGCTGGAGTGTGG - Intergenic
1001762987 5:174223068-174223090 CTGTGCCCCGCCCTGGGGAGGGG - Intronic
1002136407 5:177110491-177110513 CTGTCTCCCACTCTCTGGTCTGG + Intergenic
1002187731 5:177462343-177462365 CTGCTCCCCACCCGGGGGCCAGG + Intronic
1002329333 5:178430769-178430791 GTGTCCCAGACCCTGGGATCTGG + Intronic
1002471397 5:179438223-179438245 CTGCCCCCAACCGTGGTGTCTGG - Intergenic
1002624206 5:180513405-180513427 CTGTCGCCCAGCCTGGAGTCTGG + Intronic
1003023728 6:2534720-2534742 GTGTCCCCTCCCCAGGGGTCTGG - Intergenic
1003952056 6:11125564-11125586 CTGTCACCCAGGCTGGAGTCTGG - Intronic
1003997649 6:11559228-11559250 CTGTCACCCAGGCTGGGGTGTGG + Intronic
1004546882 6:16606563-16606585 CTGTCGCCCAGGCTGGAGTCCGG + Intronic
1005457421 6:26034251-26034273 CTGTCGCCCACGCTGGAGTGTGG - Intergenic
1006100717 6:31684462-31684484 CTGTCACCCAAGCTGGAGTCCGG + Intergenic
1006315813 6:33290841-33290863 CCTCCCCCCACCATGGGGTCAGG - Exonic
1006414744 6:33896748-33896770 CTCGCCACCACCCTGGGTTCTGG - Intergenic
1006664573 6:35683198-35683220 CTGTCCCCCAGGCTGGAGTATGG + Intronic
1006719868 6:36143105-36143127 ATGTCCCCCACCTTGCAGTCTGG - Intronic
1006858596 6:37153915-37153937 CTGTCGCCCAAGCTGGGGTGCGG - Intergenic
1007069673 6:39027196-39027218 CTGTCACCCAGGCTGGAGTCTGG - Intronic
1007072453 6:39047645-39047667 CTGTCTCCTTCCCTGGGCTCAGG + Intergenic
1007074897 6:39060181-39060203 CTGACCCCCACCCAGGTGTGTGG + Intronic
1007290370 6:40781226-40781248 CTGTCCCCCTCCATGGGGGCTGG + Intergenic
1007435667 6:41808948-41808970 CTGTCACCCAGCCTGGAGTGCGG + Intronic
1007466862 6:42058607-42058629 CTCTCCCCCACCCTAAGGTATGG - Intronic
1007752803 6:44080648-44080670 CTGACCCCCAGCCTGGCCTCTGG + Intergenic
1008190173 6:48446750-48446772 CTGTCACCCAGCCTGGAGTGTGG + Intergenic
1010762081 6:79734895-79734917 CTGTCCCCCAGGCTGGAGTGCGG - Intergenic
1011260846 6:85468361-85468383 CCCAACCCCACCCTGGGGTCAGG + Intronic
1011443539 6:87412693-87412715 CTGTCCCCCAAGCTGGGGTGCGG + Intronic
1013067750 6:106700109-106700131 CTGGCCCCAACCCTGGGGTATGG - Intergenic
1013497396 6:110711884-110711906 CCGCCCCCCAGCCTGGGTTCAGG - Intronic
1013555023 6:111247734-111247756 CTGTCACCCAGGCTGGGGTGCGG - Intergenic
1013695721 6:112700475-112700497 CTGTCACCCAGCCTGGAGGCTGG - Intergenic
1014816196 6:125938616-125938638 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1015604265 6:134939035-134939057 CAGTCGCCCACCCTGGGGAGTGG + Intronic
1015744517 6:136496131-136496153 CTTTGCCCCACCCTGGGGTAGGG - Intronic
1016356822 6:143227462-143227484 GTGTCCTCCAGCCTGGGGCCTGG + Intronic
1018370274 6:163162065-163162087 CTGTCCCACAGCCTTGGGTATGG + Intronic
1018807240 6:167270876-167270898 TTGTCCCCCAGCCTGGAGGCCGG - Intergenic
1019014217 6:168867880-168867902 CTGACCTCCAGCCTGGGGTGTGG + Intergenic
1019432292 7:1004704-1004726 CTGCCACCCACCCTGGGGACTGG + Intronic
1019517098 7:1444927-1444949 GGCTCCCCCACCCTGGGGTGTGG + Exonic
1019597455 7:1864737-1864759 CTGGCCCCCTCCCTGGGGTGAGG + Intronic
1019598491 7:1869427-1869449 CTGTGCCCAACCCTGGGCTGGGG - Intronic
1019606818 7:1914087-1914109 ATGTCCCCCATTGTGGGGTCGGG - Intronic
1019607329 7:1916765-1916787 CTGGCCCCCACCGTGGGATCGGG - Intronic
1019704188 7:2489728-2489750 CTGTCACCCAGCCTGGAGTGCGG - Intergenic
1019830430 7:3322844-3322866 CTGTCGCCCAGGCTGGGGTGTGG + Intronic
1019941824 7:4298049-4298071 CAGAGCCCCACCCGGGGGTCAGG + Intergenic
1020103981 7:5412537-5412559 CTGTCTCCCAGGCTGGGGTGCGG - Intronic
1020163836 7:5793197-5793219 CTGTCACCCAGCCTGGAGTGCGG - Intergenic
1021459563 7:20870965-20870987 CTGTCACCCAGGCTGGGGTGCGG - Intergenic
1021709772 7:23404103-23404125 CTGTCACCCAGGCTGGAGTCAGG - Intronic
1021806669 7:24364072-24364094 CTGTCACCCACGCTAGGGTACGG + Intergenic
1023258832 7:38338147-38338169 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1023857382 7:44193057-44193079 CTGTCCTCCTCCCTGGGGTGGGG + Intronic
1024000983 7:45189298-45189320 CTGTCCCCACCCATGGGGTGAGG - Intergenic
1024054881 7:45653634-45653656 CTGAACCCCTCCCTGGGGCCTGG + Intronic
1024272809 7:47655324-47655346 CTGCCTCCCTCCCTGGGGCCCGG - Exonic
1024632214 7:51259248-51259270 CTGTTCCCCAGCCTGGAGTGCGG - Intronic
1024945121 7:54800417-54800439 CTGTCTCCCACACTGTGGTTTGG + Intergenic
1025089850 7:56052828-56052850 CTGTCGACCAGCCTGGAGTCCGG + Intronic
1025739471 7:64183689-64183711 CTGACCCCCCTCCTGGGGACAGG - Intronic
1026079880 7:67208282-67208304 CTGTTCCCCAGGCTGGGGTGCGG - Intronic
1026811736 7:73472977-73472999 CTGTCCCCCAGGCTGGAGTACGG + Intronic
1026815092 7:73504625-73504647 CTGTCGCCCAGGCTGGAGTCCGG - Intronic
1026962673 7:74418389-74418411 CTGTCCCCCACCCCCAGCTCAGG + Intergenic
1027129673 7:75582037-75582059 CTTTCTCCCTCCCTGGGCTCAGG + Intronic
1027360633 7:77405261-77405283 CTGTCACCCAGGCTGGGGTGTGG - Intronic
1027609146 7:80337824-80337846 CAGTCCCCCACCCTCGTGGCAGG + Intergenic
1027768792 7:82380729-82380751 CTGTCACCCACACTGGTGTGCGG + Intronic
1029190775 7:98770581-98770603 CTGTCACCCAGGCTGGGGTGCGG - Intergenic
1029241820 7:99168545-99168567 CTGTCCCCCAGGCTGGGGTGTGG + Intergenic
1029249005 7:99222782-99222804 CTGTCCCCCAGGCTGGAGTGCGG - Intergenic
1029443453 7:100600654-100600676 CTGGCCCCCAGGCTGGGCTCAGG - Exonic
1029876274 7:103755569-103755591 CTGTCCCCCAGGCTGGAGTGCGG - Intronic
1029876298 7:103755774-103755796 CTGTCCCCCAGACTGGAGTGCGG - Intronic
1030603285 7:111612781-111612803 CTGTCACCCAGGCTGGAGTCAGG - Intergenic
1031230364 7:119097818-119097840 CTCTCCCCAACCCTGGTTTCTGG + Intergenic
1031929224 7:127667534-127667556 CTGTCCCCCATCCCTGGATCAGG + Intronic
1032018155 7:128392688-128392710 CTGGCCCCCACCCCAGGGGCAGG - Exonic
1032089175 7:128902730-128902752 CTGTCCCCCTCCCTGCCCTCAGG - Intronic
1032703439 7:134402084-134402106 CTGTCACCCAGGCTGGAGTCTGG - Intergenic
1033097308 7:138442520-138442542 CTGGCCCCCACCCCAGGGGCAGG + Intergenic
1033261035 7:139844197-139844219 CTGTCCCCTAGTCTGGTGTCAGG - Intronic
1033632402 7:143171608-143171630 CTGTCGCCCAGGCTGGGGTGCGG - Intergenic
1033681911 7:143603214-143603236 CTGTCTCCCACACTGGGATATGG + Intergenic
1033702978 7:143858699-143858721 CTGTCTCCCACACTGGGATATGG - Intronic
1034143769 7:148850053-148850075 CTGTCCCCCAAGCTGGAGTGCGG + Intronic
1034146245 7:148874858-148874880 CTGTCCCCCAGGCTGGAGTGCGG - Intronic
1034416975 7:150970436-150970458 CCTTGACCCACCCTGGGGTCTGG - Intronic
1034584486 7:152077052-152077074 CTGTCACCCAGGCTGGGGTGTGG - Intronic
1034671955 7:152865649-152865671 GTGGCCCCAACCCTGCGGTCTGG - Intergenic
1034671973 7:152865719-152865741 GTGGCCCCGACCCTGCGGTCTGG - Intergenic
1035018714 7:155788023-155788045 GTTTCCCCCACCCTCGGGCCTGG + Intergenic
1035274969 7:157742629-157742651 CAGTCCCCCACCCTAGATTCTGG - Intronic
1035422508 7:158741454-158741476 CTCTCCCCCAGCGTGGGGTGGGG + Intronic
1035563635 8:627419-627441 CTGCCCCTCTCCCAGGGGTCAGG + Intronic
1036379763 8:8228837-8228859 CGGTCCCCGTCCCTGGGGCCTGG + Intergenic
1036601486 8:10264872-10264894 CTGACCCCCACCCTGCGATTTGG - Intronic
1036849802 8:12193815-12193837 CGGTCCCCGTCCCTGGGGCCTGG - Intronic
1036871166 8:12436088-12436110 CGGTCCCCGTCCCTGGGGCCTGG - Intronic
1036932079 8:12965974-12965996 CTGTCACCCAGGCTGGGGTGCGG - Intronic
1037859362 8:22393706-22393728 CTGTCACCCAGGCTGGGGTGCGG + Intronic
1038330102 8:26601412-26601434 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
1038799429 8:30735800-30735822 CTGTCCCCCAGGCTGGGGTGCGG - Intronic
1038964818 8:32559978-32560000 CTGTCACCCAGCCTGGAGTGTGG - Intronic
1039417674 8:37409543-37409565 CTGCCCCCCACACTGAGGGCAGG - Intergenic
1039701858 8:39970426-39970448 CTGTCCCCCAGGCTGGAGTGTGG + Intronic
1040606002 8:48931826-48931848 TAATCCCCCACCCTAGGGTCTGG + Intergenic
1041322304 8:56625873-56625895 CTGTCCCCCACCCTGCTGCTTGG - Intergenic
1042333889 8:67610334-67610356 CTGTCACCCAAGCTGGAGTCTGG - Intronic
1043177308 8:77038135-77038157 CTGTCACCCAGGCTGGGGTGTGG - Intergenic
1043413862 8:80028918-80028940 CTGTCACCCACGCTGGAGTGTGG - Intronic
1043599983 8:81925690-81925712 CTGTCACCCACGCTGGAGTGCGG + Intergenic
1044650694 8:94491275-94491297 CTGTCGCCCAGGCTGGGGTGCGG - Intronic
1044667194 8:94642275-94642297 CGGTCCCAAACCCTGGGGGCTGG - Intronic
1045307819 8:100973966-100973988 CTGTCACCCAGGCTGGAGTCTGG + Intergenic
1045395014 8:101751792-101751814 CTGACCCCCACCTTTGGGGCAGG - Intronic
1045495614 8:102705855-102705877 CTGTCGCCCAGCCTGGAGTGCGG + Intergenic
1045503070 8:102758061-102758083 CTGACACCCACCCTGGGCTCGGG - Intergenic
1045673976 8:104588601-104588623 CTCTCCACCACCCGAGGGTCTGG + Intronic
1046790685 8:118318772-118318794 CTGACCCCAACCCTGGGGAGGGG + Intronic
1047275564 8:123402397-123402419 CTGGCCCCCACCCCAGGGGCAGG + Intronic
1047309093 8:123677104-123677126 CTGTGCCCCTCCCTGTGGGCTGG + Intergenic
1047747717 8:127857187-127857209 CTGTACTCCACCCTGGGATACGG + Intergenic
1048448754 8:134512969-134512991 CTGTGCCTTACCCTGGGGACTGG + Intronic
1049209172 8:141377398-141377420 CTGTCCCACACACAGGTGTCTGG - Intergenic
1049216029 8:141408823-141408845 CTGGCACCCACCCAGGGCTCAGG + Intronic
1049310677 8:141932076-141932098 CTGTCCCCCACCATGGCTCCCGG + Intergenic
1049353110 8:142174720-142174742 TTGTCTCCCAACCTGGGGGCTGG + Intergenic
1049390943 8:142370529-142370551 CTGTCCCCCAGGCTGGAGTGCGG - Intronic
1049567907 8:143351541-143351563 CTGTCCCCCAGACTGGAGTGCGG - Intronic
1049608434 8:143540917-143540939 CTGTCACCCAGGCTGGGGTGCGG - Intronic
1049678651 8:143905145-143905167 CTGTCACCCAAGCTGGAGTCTGG - Intergenic
1049796275 8:144498626-144498648 CTGCCCCCACCCCTGGGCTCTGG + Intronic
1049840835 8:144770628-144770650 CTGTCTCCCACACTGGGGGTTGG - Intergenic
1050460584 9:5874390-5874412 CTGTCCCCTACCCTGGAGGAAGG + Intergenic
1052294135 9:26878776-26878798 CTGTCCCCCAAGCTGGAGTACGG - Intronic
1053489594 9:38488763-38488785 AGGTCTCCCACCCTGAGGTCGGG - Intergenic
1055029407 9:71758403-71758425 CTGTACCCCACCAGGGGGTTGGG - Intronic
1055357686 9:75454241-75454263 GTTCACCCCACCCTGGGGTCTGG - Intergenic
1055949837 9:81720324-81720346 CTGTCACCCAGCCTGGAGTAAGG + Intergenic
1056276580 9:84999788-84999810 CTGACTCCCACCCTGGGGAAGGG + Intronic
1057021101 9:91698164-91698186 CTGCCCCCTACCCTGGGGGAAGG + Intronic
1057345115 9:94243218-94243240 CTGTCACCCAGGCTGGAGTCTGG - Intergenic
1057669937 9:97078071-97078093 AGGTCACCCACCCTGAGGTCGGG - Intergenic
1057840830 9:98484535-98484557 CTCTCCCCAACCCTGGATTCCGG - Intronic
1058890327 9:109355652-109355674 CTGTCCCCCAGGCTGGGGTGTGG + Intergenic
1059340296 9:113594193-113594215 CTGTCCCCCACCCCGCGTCCTGG - Intronic
1060135937 9:121153766-121153788 CTCCCTACCACCCTGGGGTCTGG - Intronic
1060554534 9:124501511-124501533 CAGGGCCCCACCCTGGGATCTGG + Intronic
1060555135 9:124504268-124504290 CTGTCCCCGACCCTCGGGCTGGG - Intronic
1061173073 9:128973417-128973439 CTGTCCCCCAGGCTGGAGTGTGG + Intronic
1061178835 9:129012404-129012426 GTATCCCCGTCCCTGGGGTCAGG - Intronic
1061257424 9:129460714-129460736 CTGCCCACCTCCCTGGGGTCTGG + Intergenic
1061511502 9:131063942-131063964 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
1061519166 9:131107436-131107458 CTGTCCCAGCCCCTGGGGTCTGG - Intronic
1061530143 9:131205082-131205104 CTGTCGCCCAGACTGGAGTCAGG - Intronic
1061662058 9:132136771-132136793 GTGACCCCCACGCTGGGGTCAGG + Intergenic
1061728027 9:132591954-132591976 CTGTTCCCAACCCTGAGGTTGGG + Intergenic
1061798259 9:133100933-133100955 CTGTACCCCAGCCCTGGGTCAGG - Intronic
1061816298 9:133199357-133199379 CTGTCCCCCAGGCTGGAGTGCGG - Intergenic
1061964992 9:134008397-134008419 CTGTCCCCCAGGCTGGAGTACGG + Intergenic
1062040115 9:134400666-134400688 CTGCCCCGCACCCTGGAGGCTGG - Intronic
1062094360 9:134695290-134695312 CTCTCCTGCACCCTGGGGCCTGG + Intronic
1062365127 9:136204763-136204785 CTCCCCGCCACCCTGGGATCTGG + Intronic
1062413125 9:136434638-136434660 CTGTGCCTCATCCTGGGGCCAGG - Intronic
1062485603 9:136773754-136773776 GTCTCCCCCGCCCTGGGGTCAGG - Intergenic
1062586510 9:137252171-137252193 CTGTCCCTCACCCTGGGAATGGG + Intronic
1062626963 9:137447775-137447797 CTGTCCCCCAGCCACGGGGCAGG + Exonic
1203771118 EBV:50601-50623 CAGGCACCCGCCCTGGGGTCCGG - Intergenic
1203523606 Un_GL000213v1:67196-67218 CTGTCCCCCACCTTTGTTTCTGG - Intergenic
1185478445 X:428972-428994 CTGTCACCCAGGCTGGAGTCTGG + Intergenic
1185478550 X:429453-429475 CTGTCACCCAGGCTGGAGTCTGG + Intergenic
1185768559 X:2747137-2747159 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1185958751 X:4523039-4523061 CTGTCGCCCAGCCTGGAGTGCGG + Intergenic
1186211477 X:7254616-7254638 CTGTCGCCCAGCCTGGAGTGTGG + Intronic
1186364875 X:8880657-8880679 CTATACCCTACCCTGGGATCGGG - Intergenic
1186651639 X:11567696-11567718 CTGTCGCCCAGGCTGGAGTCTGG + Intronic
1187201749 X:17140805-17140827 CTGTCGCCCACGCTGGAGTGCGG + Intronic
1187281658 X:17861597-17861619 CTCTTCTCCATCCTGGGGTCTGG - Intergenic
1187399204 X:18944642-18944664 CTGACCCCCACCTTGCTGTCTGG + Intronic
1187455081 X:19434260-19434282 CTGTCACCCAGCCTGGAGTGTGG + Intronic
1189216652 X:39330873-39330895 CTGTCACCCAAGCTGGGGTATGG - Intergenic
1189442390 X:41048970-41048992 CTGTCACCCAAGCTGGGGTGTGG - Intergenic
1190063225 X:47223961-47223983 CTGTCCCCCACCACGGGGCCTGG - Intronic
1192234931 X:69289724-69289746 CTCTCCCCCAGCCTGGGGGAGGG - Intergenic
1192358731 X:70425501-70425523 CTGCTCCCCACCCTGGGACCCGG + Intronic
1194090355 X:89576868-89576890 CCGTCTCACACCCTGGGGACTGG + Intergenic
1194478675 X:94392290-94392312 CTGTCACCCAGCCTGGAGTGTGG - Intergenic
1195057641 X:101161975-101161997 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
1195288955 X:103413426-103413448 CTGTCACCCAGCCTGGAGTGCGG + Intergenic
1196864820 X:120061308-120061330 CTGCCCCCAACCCTGGCCTCTGG - Intergenic
1196878281 X:120175023-120175045 CTGCCCCCAACCCTGGCCTCTGG + Intergenic
1200064342 X:153497414-153497436 CTGGCCCCCACCCTGCCGACCGG + Intronic
1200126154 X:153816007-153816029 CTGGCCCCCACCCTGCCGACCGG - Intronic
1200166216 X:154037281-154037303 CTGTCACCCATGCTGGGGTGTGG + Intronic
1200443005 Y:3232921-3232943 CCGTCTCACACCCTGGGGACTGG + Intergenic
1201335981 Y:12880181-12880203 CTGTCCCCAGCCCCGGGTTCAGG + Intergenic
1201514003 Y:14797331-14797353 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
1201641992 Y:16189905-16189927 CTGTCCCCCAAGCTGGAGTGCGG - Intergenic
1201660823 Y:16395416-16395438 CTGTCCCCCAAGCTGGAGTGCGG + Intergenic
1201669728 Y:16505681-16505703 CTATCACCCAGCCTGGAGTCAGG + Intergenic