ID: 917967563

View in Genome Browser
Species Human (GRCh38)
Location 1:180188103-180188125
Sequence CAGGGTCTTCCAGCTAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 230}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917967557_917967563 -1 Left 917967557 1:180188081-180188103 CCAGAGAACTAAAGCACCTTGCC 0: 1
1: 0
2: 3
3: 49
4: 305
Right 917967563 1:180188103-180188125 CAGGGTCTTCCAGCTAGTGAGGG 0: 1
1: 0
2: 2
3: 38
4: 230
917967556_917967563 0 Left 917967556 1:180188080-180188102 CCCAGAGAACTAAAGCACCTTGC 0: 1
1: 0
2: 3
3: 45
4: 339
Right 917967563 1:180188103-180188125 CAGGGTCTTCCAGCTAGTGAGGG 0: 1
1: 0
2: 2
3: 38
4: 230
917967555_917967563 1 Left 917967555 1:180188079-180188101 CCCCAGAGAACTAAAGCACCTTG 0: 1
1: 0
2: 2
3: 35
4: 263
Right 917967563 1:180188103-180188125 CAGGGTCTTCCAGCTAGTGAGGG 0: 1
1: 0
2: 2
3: 38
4: 230
917967554_917967563 26 Left 917967554 1:180188054-180188076 CCGTTTCATAGAAGGTGAAACAA 0: 1
1: 0
2: 4
3: 44
4: 616
Right 917967563 1:180188103-180188125 CAGGGTCTTCCAGCTAGTGAGGG 0: 1
1: 0
2: 2
3: 38
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917967563 Original CRISPR CAGGGTCTTCCAGCTAGTGA GGG Intronic
900227193 1:1538871-1538893 CAAGGTCACACAGCTAGTGAAGG - Intronic
902163828 1:14553589-14553611 CAGGGCCATGCGGCTAGTGAAGG + Intergenic
902381465 1:16054605-16054627 AACGGTCTTCCAGTTAGTGGGGG - Intronic
902450716 1:16495139-16495161 CAGGGTCACACAGCTGGTGAGGG - Intergenic
902502151 1:16918200-16918222 CAGGGTCACACAGCTGGTGAGGG + Intronic
902650379 1:17833429-17833451 CAGGGTTTTGCAGCTAGTGAGGG - Intergenic
902932791 1:19743180-19743202 CAGGGTCACCCAGCTAGTCAGGG - Intronic
904375774 1:30081493-30081515 TAAGGACTTCCAGCTAATGAAGG - Intergenic
905025024 1:34844049-34844071 CACGGTCTCACAGCTAGTGAGGG + Intronic
905326307 1:37154525-37154547 CAGGGTCTTGCAGCTAGCTGGGG - Intergenic
905583272 1:39098354-39098376 CAAGGTCTCCCAGCCAGTAAGGG + Intronic
905804996 1:40869935-40869957 CAGGGCCACACAGCTAGTGATGG + Intergenic
905895009 1:41540033-41540055 CAGCGTCTTACAGGTGGTGAAGG + Intronic
905922716 1:41730021-41730043 CAAGGTCCTCCAGCTAGTCGGGG + Intronic
906148421 1:43573541-43573563 CAGGCTCTTCCAGCCAGAGCTGG - Intronic
906849681 1:49234885-49234907 AACGGTCTTACAGCTAGTCAGGG - Intronic
907483934 1:54764087-54764109 CAGGGTCACCGAGCGAGTGAAGG - Intronic
907571272 1:55486311-55486333 CAGTCTATTCCAGGTAGTGACGG + Intergenic
908228260 1:62078147-62078169 CAGACTCTTCCAGCTGGGGATGG + Intronic
910080443 1:83335328-83335350 CAGGGTCTTCCATTTAATGGAGG - Intergenic
912469337 1:109895855-109895877 CAGGGTCTTCCTGCTGAAGAAGG - Intergenic
913001599 1:114586045-114586067 CATGGTCTGTCAGCTAGTGAAGG + Intronic
913247818 1:116885682-116885704 CAGGAGCTTCCAGGTAATGAAGG - Intergenic
913558934 1:119998480-119998502 CAGAGTCTTCCTGCTAGTGCTGG - Intronic
913638921 1:120791997-120792019 CAGAGTCTTCCTGCTAGTGCTGG + Intergenic
914279538 1:146157959-146157981 CAGAGTCTTCCTGCTAGTGCTGG - Intronic
914540578 1:148608889-148608911 CAGAGTCTTCCTGCTAGTGCTGG - Intronic
914626062 1:149462329-149462351 CAGAGTCTTCCTGCTAGTGCTGG + Intergenic
914759772 1:150589146-150589168 CAGGGTCACTCAGCTAGTAAGGG - Intergenic
916577416 1:166080069-166080091 CAAGATCTTTCCGCTAGTGAGGG + Intronic
917967563 1:180188103-180188125 CAGGGTCTTCCAGCTAGTGAGGG + Intronic
917976962 1:180245883-180245905 CAGGGGTTTCCACCCAGTGAGGG - Intronic
918398738 1:184143096-184143118 CAAGCTCATACAGCTAGTGAGGG + Intergenic
919958982 1:202447295-202447317 CAAGGTCACACAGCTAGTGAGGG + Intronic
923219288 1:231878551-231878573 CAGGTTCTTGAAGCAAGTGAAGG + Intronic
1064660359 10:17601648-17601670 CAGACTCTTCCAGGCAGTGAGGG - Intronic
1065147026 10:22779995-22780017 CAGGGACTTCCAGCATATGAGGG - Intergenic
1065404113 10:25343989-25344011 CAGTGGCTTCCAGTTAGTGTAGG - Intronic
1067233098 10:44425660-44425682 CAGGGTCATGCATCTGGTGAGGG - Intergenic
1069024587 10:63525212-63525234 CAGGGTCATTCAGCTGGTTAAGG - Intronic
1069334968 10:67337753-67337775 CATGATCTTTCTGCTAGTGAAGG - Intronic
1069866425 10:71506503-71506525 CAGGGTCCCCCAGCCAGAGATGG + Intronic
1070798295 10:79230004-79230026 CAGGGTCACACAGCTAGGGAGGG + Intronic
1071287052 10:84158677-84158699 CAGGGTCTTGCAGGCAGAGAAGG - Intergenic
1071910442 10:90226288-90226310 CAGGGACTTAAAGCTAGTGGTGG + Intergenic
1072659184 10:97352374-97352396 CACGGTCTGGCATCTAGTGATGG + Intergenic
1073321064 10:102616541-102616563 CAGGGCCTTTCAACTGGTGAAGG + Intronic
1074470170 10:113719767-113719789 CCAGGTCACCCAGCTAGTGAAGG - Intronic
1074675357 10:115842797-115842819 CAGGGTAAGACAGCTAGTGAGGG - Intronic
1074713840 10:116200369-116200391 GAAGGTCTTACAGCTAGTGAAGG - Intronic
1074720624 10:116261902-116261924 CAAGGTCACCCAGCTAGTTACGG + Intronic
1075853445 10:125607662-125607684 CAGGGCCTACCAGCTAGTCGGGG - Intronic
1076210613 10:128641460-128641482 CAGTGTCTACCAGTTAGTGAAGG + Intergenic
1076563209 10:131381059-131381081 CAGGGTCTTCCTGCCTGAGAGGG - Intergenic
1079307575 11:19337224-19337246 CAAGGTCATACAGCTAGTTAGGG - Intergenic
1081852914 11:46286012-46286034 CAGGGTCACACAGCAAGTGAGGG - Intronic
1083248025 11:61445066-61445088 CAGGGCCTGGCATCTAGTGAGGG - Intronic
1085011717 11:73145969-73145991 CAAGGTCACACAGCTAGTGAAGG + Intergenic
1085540799 11:77268043-77268065 AAAGATGTTCCAGCTAGTGAAGG - Intronic
1086421683 11:86643861-86643883 CATGGTCTTCCAGATAGTAAGGG - Intronic
1088772916 11:113053814-113053836 CAGGGACTTCCAGGGACTGAGGG - Intronic
1089166642 11:116482585-116482607 CAGGGTCCCCCAGTTGGTGAAGG - Intergenic
1091343321 11:134836705-134836727 CAAGGTCTCCCAGCTAGTCATGG - Intergenic
1096979638 12:55721070-55721092 CAGATGCTTCCAGCTAGGGAGGG + Intronic
1097178467 12:57157036-57157058 CAGAGTGTACCTGCTAGTGAGGG + Intronic
1101446330 12:104739174-104739196 CAGGGTGTTCCAGGTGGAGAGGG - Intronic
1101725316 12:107383869-107383891 CAGGGTCTTCCATCTGCTCAGGG + Intronic
1102435618 12:112920903-112920925 CAGGGTCACCCAGCTGGTCAGGG + Intronic
1103397409 12:120618798-120618820 CAGGGGCGTCCAGCCAGTGAGGG + Intergenic
1104037429 12:125107321-125107343 CAGGGCCTCCCAGCTGATGATGG + Intronic
1104304239 12:127594821-127594843 CAGGGCCTTCCAGACAGTCAGGG - Intergenic
1113317715 13:109201325-109201347 CAAGGTTTTGCAGCTATTGATGG + Intronic
1113444426 13:110354860-110354882 CAGGGTCTTCCAGATAGTCCAGG - Intronic
1114369172 14:22066601-22066623 CAAGGTATTTCAGATAGTGATGG + Intergenic
1115420338 14:33186807-33186829 CAGTGTTTCCCAGCTAGGGATGG + Intronic
1117310206 14:54514047-54514069 CAGGATCTTCAAGCAAGAGAAGG - Intronic
1118172478 14:63401609-63401631 AAGGGTCTTCCAGCTAGGCAGGG + Intronic
1118911493 14:70065536-70065558 CAAGGTCACCCAGCTAGTGAGGG - Intronic
1119208141 14:72809870-72809892 CAGAGTCATTCAGCTAGTGAGGG - Intronic
1119485953 14:74986714-74986736 CAAGGTCACCCAGCTTGTGAGGG + Intergenic
1119934515 14:78579033-78579055 CAGAGACTTTCAGCTAGAGAGGG + Intronic
1122164860 14:99814972-99814994 CAGGGTCACACAGCTAGGGAGGG + Intronic
1122877135 14:104673280-104673302 CCAGGTCACCCAGCTAGTGATGG - Intergenic
1123034199 14:105465266-105465288 CAGGAGCTCCCAGCTAGAGAAGG - Intronic
1124349094 15:28942616-28942638 CAGGGTCTTCCTGCCAGCGCGGG + Intronic
1124641691 15:31399981-31400003 CAGGGGCTTCCCACTAGGGAGGG + Intronic
1126705086 15:51398873-51398895 CAGGCTCTGCCAGCCAGTGACGG + Intronic
1127366437 15:58294936-58294958 CAAGGTCATGCAGCAAGTGAAGG - Intronic
1128338762 15:66805265-66805287 CAAGGTATTGCAGTTAGTGAGGG + Intergenic
1128712152 15:69879976-69879998 CAGGGCCTACCAGCGGGTGAGGG - Intergenic
1129161727 15:73751620-73751642 CAGGGTCTTCCAGATGTGGAAGG + Exonic
1129703217 15:77779963-77779985 CAGGGTCTTACACACAGTGACGG + Intronic
1129779331 15:78259866-78259888 CAGGGTCACACAGCCAGTGAGGG + Intergenic
1130805441 15:87316285-87316307 CAGGGTCTATCATTTAGTGAAGG + Intergenic
1133368504 16:5229864-5229886 CAAGGTCACCCAGCTAGTAAAGG - Intergenic
1133532102 16:6664863-6664885 CAAGGTCTGCCAGCTGGTGAAGG - Intronic
1134309518 16:13062969-13062991 TAGGGTCACTCAGCTAGTGAGGG - Intronic
1134842249 16:17411090-17411112 CAAGGTCTTCCAGCAAGTAAGGG - Intronic
1135586118 16:23672416-23672438 CAAGGTCATACAGCTAGTGATGG + Exonic
1136530616 16:30866154-30866176 CAGCGTCTTTCAGGGAGTGATGG + Intronic
1137583580 16:49650294-49650316 CATGGTCTCACAGCTAATGATGG - Intronic
1138249735 16:55492669-55492691 CAATATCTTGCAGCTAGTGAAGG - Intronic
1139153087 16:64408220-64408242 CAGGGACATGCTGCTAGTGATGG - Intergenic
1141002920 16:80324904-80324926 CAAGCTCTTCCAGCTGGGGATGG + Intergenic
1141221232 16:82070863-82070885 CATGGTCTTCCAGGTATTGCAGG + Intronic
1141508928 16:84500205-84500227 CAGTGTCCTTCAGCTAATGATGG - Intronic
1141860647 16:86713831-86713853 CCAGGCCTTCCAGCTACTGATGG + Intergenic
1141999014 16:87653366-87653388 CAGGGTTCTCCAGTGAGTGAGGG + Intronic
1143006492 17:3838701-3838723 CAGGGTCATGTAGCTAGTAAAGG - Intronic
1143270180 17:5669507-5669529 CAGGGTCACCCAGCAAGTCAGGG + Intergenic
1146019458 17:29264801-29264823 CAGGGTCCTCTAGCCAGTGAGGG + Intronic
1149287151 17:55177295-55177317 CAGGGTGTTACAGCCAGAGAAGG - Intergenic
1150276193 17:63899334-63899356 CAGGGTCTTTTAGCCAGTGCTGG + Intergenic
1151460629 17:74252199-74252221 GAGGGACATGCAGCTAGTGAAGG - Intronic
1152002536 17:77655613-77655635 CAGGGTCTCCCAGCTAGGTGGGG - Intergenic
1153685432 18:7540278-7540300 TAGGGGCTTCCAGCTACAGATGG - Intergenic
1157247831 18:46070105-46070127 CAGGGTCACCTAGCTAGTAAGGG + Intronic
1157522675 18:48356163-48356185 CAGGGTTTTCCAGCTAGGGAAGG + Intronic
1158664721 18:59422102-59422124 GAGGGTCACCCAGCTAGTAATGG + Intergenic
1159598841 18:70409534-70409556 CAGGGTCACATAGCTAGTGAGGG + Intergenic
1161078196 19:2296765-2296787 CAGGGTCTTGCAGCTGGGCACGG - Intronic
1163112175 19:15168139-15168161 CAGAGCCTTCCAGCTACTAAGGG - Intronic
1163533831 19:17865907-17865929 CAGGGACTTCCAGGCAGTTACGG - Intergenic
1163783658 19:19263269-19263291 CAAGGTCTCACAGCCAGTGAGGG - Intergenic
1164801083 19:31077324-31077346 CAGGGTCTCTTAGCTAATGAGGG - Intergenic
1166376687 19:42331345-42331367 CAGGGTCCTCCAGCTGGTCATGG + Intronic
1166565590 19:43763603-43763625 CAGGGTCATACAGCCAGTCACGG - Intergenic
1168514497 19:57000481-57000503 CAGGGTCTTCCAACTTGTACAGG - Intergenic
925597126 2:5565949-5565971 AAGGTACTTCCAGCTAGTGAGGG - Intergenic
925977418 2:9150826-9150848 CATGGTTTTCCAGCCAGTGTTGG - Intergenic
928666251 2:33553264-33553286 CAAGGTCTCATAGCTAGTGAGGG - Intronic
929993919 2:46813115-46813137 CAGAGTCACCCAGCTAGTGAGGG + Intergenic
931102384 2:59017020-59017042 AAGGCTCTTCCTGCCAGTGAAGG + Intergenic
931220853 2:60286557-60286579 CAAGGTCTCACAGCTTGTGAAGG - Intergenic
932766583 2:74474486-74474508 CTGGATTTTCCAGCTAGAGATGG + Exonic
934769605 2:96899470-96899492 CAGGGTCTTGCAGCCTGTCAGGG - Intronic
937359139 2:121217146-121217168 CAGGGTCCCACAGCTACTGATGG - Exonic
939617038 2:144373266-144373288 CAAGGTCATACAGCTAGGGAGGG + Intergenic
940735123 2:157442126-157442148 AAGGGTATTCCAGATATTGAAGG - Intronic
941601838 2:167552151-167552173 CAAGGTCATCCAGTTAGTTAGGG - Intergenic
944442577 2:199757407-199757429 CAGGCGGTTCCAGCTAATGATGG + Intergenic
948493107 2:238326626-238326648 CAGGGTCTTCCTTCTTTTGAGGG + Intronic
948625574 2:239266082-239266104 GAGGGGCTGCCAGCCAGTGAAGG + Intronic
948781129 2:240322622-240322644 CCGTGACTTCCAGCTAATGATGG + Intergenic
948928394 2:241115132-241115154 AGGGTTCTTCCAGCTTGTGATGG - Exonic
1168898498 20:1340327-1340349 CTGGGTCTGCCAGCTACAGAAGG - Intronic
1170882665 20:20310878-20310900 CAGGGTGTTCCATGGAGTGAGGG + Intronic
1173534779 20:43801125-43801147 CATGGTCATTCAGCTAGTAAGGG + Intergenic
1173670902 20:44798335-44798357 CAAGGTCATACAGCTAGTGAGGG - Intronic
1173793152 20:45841067-45841089 CAGGGTCTTCCAGCTCCTGGTGG - Exonic
1173843128 20:46172058-46172080 CAAGGTCTCCCAGCTAGTATGGG - Intergenic
1174551899 20:51368184-51368206 CAGCTTCTTCCAGCTTCTGATGG + Intergenic
1175476516 20:59278842-59278864 CAGAGTCTTTCAGAGAGTGATGG + Intergenic
1175669595 20:60890620-60890642 CAAGGTCATGCAGCTAGTAAGGG + Intergenic
1178341942 21:31793166-31793188 CAAGGTCTCCCAGGTTGTGAGGG + Intergenic
1178551220 21:33541614-33541636 CAAGGTCTTCCTGCTAGTATGGG - Intronic
1178581916 21:33845144-33845166 GTGGGGGTTCCAGCTAGTGAAGG + Intronic
1178906671 21:36642472-36642494 CAGGGAGTTCCAAGTAGTGAGGG + Intergenic
1181294599 22:21826353-21826375 CAGTGTCTCTCAGCTAGTGAGGG - Intronic
1181998171 22:26899467-26899489 CAGGGTCACCCAGCTATTTAGGG - Intergenic
1182711234 22:32324711-32324733 CAGGGTCACACAGCTTGTGAGGG - Intergenic
1183395576 22:37569086-37569108 CTGGGTCCTCCAGCTGGTGGGGG - Exonic
1184515654 22:44960452-44960474 CAGTGACTTCCAGCCAGTGGAGG - Intronic
1184564954 22:45286243-45286265 CAGGGACATCCAGTTAGTGAGGG + Intronic
1184734374 22:46389436-46389458 CAGGGCCCTGCAGCTGGTGAGGG - Exonic
949143170 3:661044-661066 CAAAATCTTCCAGCAAGTGATGG - Intergenic
949473552 3:4420913-4420935 CAGGGTCACCCAGCTAATGTTGG - Intronic
950422140 3:12905519-12905541 CAGGGTCTGACCGCTAGAGAGGG + Intronic
950634724 3:14306760-14306782 CAGGGCCCTCCAGCCAGAGAGGG - Intergenic
951694454 3:25431050-25431072 CAGGGTGGTACAGCTAGTTAGGG + Intronic
951855186 3:27187996-27188018 CAAGTTCATCCAGCTAGTTAGGG - Intronic
951950779 3:28198314-28198336 CTTGCTCTTCCAGTTAGTGAAGG - Intergenic
954850903 3:53599559-53599581 CAGGGTCTCACAGCTTGTTATGG - Intronic
955405586 3:58623720-58623742 CAGGGTCACCCAGCTAGTAAGGG - Intronic
955405935 3:58625828-58625850 CAGGGTCATGCAGCTAGTGGGGG - Intronic
956343225 3:68249281-68249303 AAGGGTCTGCCCGGTAGTGAGGG - Intronic
959919658 3:111856998-111857020 CAGGGTCTTGAAGGAAGTGAGGG + Intronic
960205127 3:114887609-114887631 CTGGCTCTTCCAGCTTCTGATGG - Intronic
961106798 3:124249523-124249545 CAGGGTCCTCCAGCTGGCTAGGG + Intronic
966390997 3:179451959-179451981 CACGGTCCTACAACTAGTGATGG - Intergenic
966424577 3:179767323-179767345 CAAGGTCTCATAGCTAGTGATGG + Intronic
969055212 4:4397404-4397426 CAAGGTCACCCAGCTAATGAGGG + Intronic
969234980 4:5859349-5859371 CAGGGTCTCACAGCTGGTAATGG + Intronic
970139183 4:12961849-12961871 CAGGGTCTTCCCATGAGTGATGG + Intergenic
971135044 4:23859394-23859416 TAGGGTCTTCCAGCAAAGGAAGG + Intronic
972146064 4:36027284-36027306 CAAGGTCATGCAGCTGGTGAAGG + Intronic
973757870 4:54093036-54093058 CAAGGTCACACAGCTAGTGATGG - Intronic
977125711 4:93164983-93165005 CAGGGTCTTCCTGCTAAGCAAGG - Intronic
977281042 4:95040845-95040867 CAGACTCTTCCAGTGAGTGAAGG + Intronic
980948511 4:139347710-139347732 AAGAGTCTTGCAGATAGTGATGG - Intronic
981319531 4:143375460-143375482 CAGGTGCTACCATCTAGTGAAGG - Intronic
982803341 4:159731857-159731879 CAGGGTCTTATAGCCAGTAAGGG + Intergenic
983428723 4:167620315-167620337 CAGGGTCCTGCTGCTGGTGAAGG + Intergenic
984909725 4:184662395-184662417 CAAGGTCCTACAGCTAGTAATGG + Intronic
985487371 5:159000-159022 CAGGGCCTTCCAGCTGGCGAAGG - Intronic
985872157 5:2565442-2565464 GAGAGTCTTCCAGCCAGTGTGGG - Intergenic
986197361 5:5550308-5550330 CAGGTTTTTCGAGCTGGTGAAGG + Intergenic
986643023 5:9890416-9890438 CAGGGTCTTGCAGCTTCTGTAGG + Intergenic
988659898 5:33253997-33254019 CAAGGTCATCTAGCTAGTGAAGG - Intergenic
988989542 5:36656281-36656303 CAGGGTCTCCCTGCTAGCAAGGG + Intronic
990454817 5:55974889-55974911 CAAGGTCCTACAGCTAGTAAGGG + Intronic
990532259 5:56686170-56686192 CAAGGTCACACAGCTAGTGAAGG - Intergenic
992213706 5:74505642-74505664 TAGGGTTTTCCAGGAAGTGAAGG - Intergenic
993635098 5:90333416-90333438 CAGGGGCTTCCAGATACTTAGGG - Intergenic
993698272 5:91087828-91087850 CAAGGTCACACAGCTAGTGAAGG + Intronic
997955707 5:138277024-138277046 CAAGGTCATCCAGCTAGTGTCGG - Intergenic
998097786 5:139406652-139406674 CAGCCTGTTCCAGCTGGTGAAGG - Intergenic
998523658 5:142823133-142823155 CAGTGTCATTCAGCTGGTGAAGG + Intronic
999623912 5:153500159-153500181 CAGGATCTTCAAACTAGTCAGGG - Intronic
1000715957 5:164644659-164644681 CAGGGTATGCCAGGTTGTGATGG - Intergenic
1001051300 5:168416564-168416586 CAGGGTCTGGGAGCAAGTGAGGG - Intronic
1001480919 5:172088772-172088794 CTGGGTCTTCCAGTTAGGCAGGG - Intronic
1003308224 6:4947372-4947394 GAGGGTCTGTCAGCTTGTGAGGG - Intronic
1004219915 6:13737785-13737807 GAAGGTCTTCCAGCTGATGATGG - Intergenic
1004353536 6:14911860-14911882 CAGGGTCTTAGGGCTAGGGAAGG + Intergenic
1006082871 6:31577426-31577448 AGGGGTCTTCCAGCTGGAGAAGG + Exonic
1006514037 6:34536269-34536291 CAGGCTGTTCCATTTAGTGATGG + Intergenic
1006916397 6:37596740-37596762 CAAGGTCATACAGCCAGTGAGGG - Intergenic
1008317167 6:50058825-50058847 CAGGGTTTTCCACCTAAGGAAGG + Intergenic
1010037576 6:71344035-71344057 CAGGGTTCTCCAGGTAGAGATGG - Intergenic
1010521150 6:76839231-76839253 AAGGCTCTACCATCTAGTGAGGG - Intergenic
1011779600 6:90772070-90772092 CAGGGTCTTGCAGTTGGGGAGGG - Intergenic
1012814497 6:104004850-104004872 TAGAGTCTTTCTGCTAGTGATGG - Intergenic
1013332881 6:109123375-109123397 CAGGGTCATGCAGCTATTAAGGG - Intronic
1018946152 6:168347933-168347955 CAGGGTCTCCCCGCAGGTGAGGG - Intergenic
1018999386 6:168736003-168736025 CAGGGTCATCCAGGAAGTGTAGG - Intergenic
1020013340 7:4817953-4817975 CGGGGGCTTCCAGAAAGTGAGGG + Intronic
1022109284 7:27218643-27218665 CAAGGTCATCCAGCTACTAAGGG + Intergenic
1023938828 7:44757409-44757431 GAGGGTCTTGCAGCATGTGAGGG - Exonic
1026141976 7:67714191-67714213 GAGGGTATTCCAGATGGTGACGG - Intergenic
1027298218 7:76800596-76800618 CAGGGTCTTCCATTTAATGGAGG - Intergenic
1027776193 7:82467573-82467595 CAGGGGCTTCCAAGTAGTGCTGG - Intergenic
1031313789 7:120231939-120231961 CACGGTCTTTCAGTTAGTAAGGG + Intergenic
1032658177 7:133954622-133954644 CAGAGGCTTCCTGCTGGTGAAGG - Intronic
1032918704 7:136521371-136521393 CAAGGTCTTGCAGCTAATAAAGG + Intergenic
1034268237 7:149791378-149791400 CATAGGCTTCCAGCTGGTGAGGG + Intergenic
1037828270 8:22173016-22173038 TAGGGTCTTCCAGATAGCAATGG - Intronic
1039113515 8:34066414-34066436 CAAGGTCATACAGCTAGTAAGGG + Intergenic
1040905950 8:52469966-52469988 AAGGGCCTTCCAGGTAGAGAGGG - Intergenic
1041182218 8:55260607-55260629 GTGGGTCTTCCAGCTGGTGGCGG + Intronic
1044339186 8:91027357-91027379 CAGAGTTTTCCAGCAAGGGAAGG - Intronic
1045362042 8:101441862-101441884 CAAGGTCATCCAGCTAGTATAGG + Intergenic
1046129228 8:109946507-109946529 CTGGGTCTTCAGGCCAGTGATGG - Intergenic
1046514010 8:115235023-115235045 CAGAGTCACACAGCTAGTGATGG + Intergenic
1046674625 8:117094424-117094446 CAGGGTCTCCCCTCTACTGAGGG - Intronic
1047552349 8:125888683-125888705 CAAGGTCATTCAGCTAGTTATGG - Intergenic
1048140430 8:131789017-131789039 CAGGGTCACGCAGCTAGCGAAGG + Intergenic
1048315662 8:133359948-133359970 CAAGGTCTTCAGGCCAGTGAGGG - Intergenic
1048524103 8:135185591-135185613 CAGGGTCCTATAGCTAGTTATGG + Intergenic
1052271330 9:26631261-26631283 CAGGGAATTCTAGCCAGTGATGG + Intergenic
1053474901 9:38375711-38375733 CAGGGACTTCGAGGGAGTGATGG - Intergenic
1059195675 9:112368845-112368867 CTAGGTCTCCCAGCTTGTGATGG - Intergenic
1059702612 9:116790346-116790368 CAAGGTCTTACAGCTAGTAATGG + Intronic
1060025246 9:120165334-120165356 CAGGGTCACCCAGCTCATGAGGG - Intergenic
1060995436 9:127872916-127872938 CAGGGTCTCCCAGAGAGGGAGGG + Intronic
1061256842 9:129458583-129458605 CAGGGTCACCCAGCTGTTGATGG - Intergenic
1061518418 9:131103060-131103082 CAGGGGCTGCCAGCTTCTGATGG + Intronic
1062080145 9:134619433-134619455 CTGAGTCTCCCAGCTGGTGAGGG + Intergenic
1187419962 X:19125483-19125505 CAGGGTCTTTGAACCAGTGATGG + Intergenic
1187698461 X:21942730-21942752 TAGGGTCACCCAGCTAGTAAGGG + Intronic
1190455758 X:50626431-50626453 CAAGGTCTCACAGCTAGTAAAGG - Intronic
1190503129 X:51098664-51098686 GAGGGTCTTACAGGTAGAGATGG - Intergenic
1192804089 X:74494779-74494801 CAGTGTCACCCAGCTACTGAGGG + Intronic
1194843956 X:98780203-98780225 CAGTGTTTTCCATCTGGTGAAGG + Intergenic
1195353108 X:104013244-104013266 CCGGGTCTCCCAGGCAGTGATGG + Exonic
1197426595 X:126304907-126304929 CCAGGTCTTCCAGCTTGTGATGG - Intergenic
1198081485 X:133244240-133244262 CAGGGTCTAACAGCTAATGAGGG - Intergenic
1199626971 X:149750291-149750313 CAGGGTCTTCCAGGGAATGACGG - Intergenic
1200341425 X:155400964-155400986 AAGGGTCTTCTATCAAGTGATGG + Intergenic
1200346193 X:155451857-155451879 CTAGGTCTCCCAGCTTGTGATGG - Intergenic
1202576368 Y:26330800-26330822 CAAGGTCACACAGCTAGTGAGGG - Intergenic