ID: 917967645

View in Genome Browser
Species Human (GRCh38)
Location 1:180188437-180188459
Sequence GGCACTGTCGCCTTAGAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917967637_917967645 15 Left 917967637 1:180188399-180188421 CCCAGTTGTCCAGAGCTCCTTAA 0: 1
1: 0
2: 0
3: 11
4: 112
Right 917967645 1:180188437-180188459 GGCACTGTCGCCTTAGAAGGCGG 0: 1
1: 0
2: 0
3: 6
4: 93
917967636_917967645 22 Left 917967636 1:180188392-180188414 CCTTGCTCCCAGTTGTCCAGAGC 0: 1
1: 0
2: 2
3: 24
4: 210
Right 917967645 1:180188437-180188459 GGCACTGTCGCCTTAGAAGGCGG 0: 1
1: 0
2: 0
3: 6
4: 93
917967638_917967645 14 Left 917967638 1:180188400-180188422 CCAGTTGTCCAGAGCTCCTTAAT 0: 1
1: 0
2: 1
3: 6
4: 106
Right 917967645 1:180188437-180188459 GGCACTGTCGCCTTAGAAGGCGG 0: 1
1: 0
2: 0
3: 6
4: 93
917967640_917967645 -2 Left 917967640 1:180188416-180188438 CCTTAATTCATCCATCCTTCTGG 0: 1
1: 0
2: 2
3: 16
4: 242
Right 917967645 1:180188437-180188459 GGCACTGTCGCCTTAGAAGGCGG 0: 1
1: 0
2: 0
3: 6
4: 93
917967639_917967645 6 Left 917967639 1:180188408-180188430 CCAGAGCTCCTTAATTCATCCAT 0: 1
1: 0
2: 1
3: 9
4: 200
Right 917967645 1:180188437-180188459 GGCACTGTCGCCTTAGAAGGCGG 0: 1
1: 0
2: 0
3: 6
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917967645 Original CRISPR GGCACTGTCGCCTTAGAAGG CGG Intronic
908646197 1:66280730-66280752 GGCATTGTGGCTTTAGAAGGGGG - Intronic
911527327 1:99003916-99003938 GGCACTTTCACCTGAAAAGGAGG + Intronic
916413208 1:164567976-164567998 TGCACTGTTGGCTGAGAAGGGGG + Intronic
917094729 1:171388781-171388803 GGCATTAGCTCCTTAGAAGGTGG - Intergenic
917967645 1:180188437-180188459 GGCACTGTCGCCTTAGAAGGCGG + Intronic
917975004 1:180232812-180232834 GGCCCAGTGGCCTAAGAAGGGGG + Intronic
918060151 1:181053924-181053946 GGAACTGTCCCCCTAGAAGTTGG + Intronic
1064918464 10:20488603-20488625 GTCAATGTCTCGTTAGAAGGTGG - Intergenic
1069642725 10:69966273-69966295 GGCTGTGTCTTCTTAGAAGGTGG - Intergenic
1074517870 10:114187883-114187905 GGCTCTGTCATCTTACAAGGAGG - Exonic
1074898617 10:117797809-117797831 GGCATTATCTCCTTGGAAGGTGG - Intergenic
1075335755 10:121607934-121607956 AGCACGGTCTCTTTAGAAGGTGG + Intergenic
1077101033 11:822464-822486 GTCACTCTCGCCCGAGAAGGGGG - Exonic
1080347244 11:31338665-31338687 GGAACTGTCACCAAAGAAGGGGG + Intronic
1083203495 11:61133684-61133706 GGACCTGTCACCTTTGAAGGTGG - Intronic
1083617792 11:64035215-64035237 GGCACTGCCCCCTTAATAGGTGG + Intronic
1084721117 11:70906290-70906312 GGGACTGTCGCCTTTGAGTGTGG + Intronic
1084905459 11:72342796-72342818 GCCACAGTCTCCGTAGAAGGCGG + Intronic
1086690649 11:89786422-89786444 GGCACTGTTGCCTTAGACACTGG + Intergenic
1086697869 11:89865085-89865107 GGCACAGTTGCCTTAGACGCTGG - Intergenic
1086708293 11:89979403-89979425 GGCACAGTTGCCTTAGACGCTGG + Intergenic
1086715151 11:90053238-90053260 GGCACTGTTGCCTTAGACACTGG - Intergenic
1088914122 11:114214168-114214190 GGCACTGTCCCCTTACTATGGGG - Intronic
1089217099 11:116841062-116841084 GGCACTGGCACCCTAGAGGGAGG + Intergenic
1091723979 12:2833167-2833189 GGGACTTTCTCATTAGAAGGCGG + Intronic
1094848350 12:34371273-34371295 GGCACTTTCGCCTTTGAGAGGGG + Intergenic
1094856920 12:34407002-34407024 GGCACTTTCGCCCTTGGAGGGGG - Intergenic
1098387640 12:69935696-69935718 GGCACTGTCGCATTGGGAGATGG - Intronic
1099251474 12:80260441-80260463 GGGACTGGTGCCTTAGAAAGAGG - Intronic
1101345113 12:103879319-103879341 GACAATGTTGGCTTAGAAGGTGG - Intergenic
1120860520 14:89251158-89251180 GCCACTGGTGCCTTAGAAGGTGG + Intronic
1122827904 14:104380293-104380315 GGGACTGTGGCCTTATAAGAAGG - Intergenic
1122892916 14:104741345-104741367 GGCACTGTGGCCTTGGAAAGCGG - Intronic
1123513624 15:21017580-21017602 GGCACTGGCGCCATAGCAGTAGG + Intergenic
1125151743 15:36540412-36540434 GGCATTGTCTTCTTAGAGGGTGG + Intergenic
1133006253 16:2883329-2883351 GGCGCTGTCGCCGGAGAGGGAGG + Exonic
1133182637 16:4069675-4069697 GGGAGAGTCGCCTTAGAAGATGG - Intronic
1140420825 16:74817446-74817468 GGTGCTGGTGCCTTAGAAGGTGG + Intergenic
1146732801 17:35209896-35209918 GACACTGAAGCCTCAGAAGGTGG + Intergenic
1147990658 17:44330934-44330956 GCCTCTGTGGCCTGAGAAGGTGG + Intergenic
1148466576 17:47868684-47868706 GGCCCTGGCTCCTTGGAAGGAGG - Intergenic
1148597714 17:48870160-48870182 GGCACTGTGGCCATGGAAGCAGG - Intergenic
1157195801 18:45619312-45619334 GGCACTGTGTCCTGAGCAGGAGG - Intronic
1157318149 18:46610730-46610752 GTCCCTGTGGCCTTGGAAGGGGG - Intronic
1160625372 18:80200877-80200899 GGCACTGTGCCCTTTGGAGGTGG - Intronic
1161577595 19:5063448-5063470 GGCACTGTCCCTTTAGATGAAGG + Intronic
1162365255 19:10244740-10244762 TGCATTGTCACCTAAGAAGGTGG + Intergenic
1164226091 19:23247566-23247588 TGCAGTGTCTCCTGAGAAGGTGG - Intronic
1164770575 19:30805591-30805613 GGCACTGCCTCCTTAGAACCAGG - Intergenic
1167911147 19:52702594-52702616 TGCTCTGTCGCCTTGGATGGAGG - Intergenic
1167918747 19:52763536-52763558 TGCTCTGTCGCCTTGGATGGAGG - Intergenic
1168199659 19:54805460-54805482 GCCACTGTGGGCTTTGAAGGTGG + Intronic
1168206282 19:54852674-54852696 GCCACTGTGGGCTTTGAAGGTGG + Intronic
925079889 2:1055766-1055788 GGCACGGTCACCTTAGAAAATGG - Intronic
931835327 2:66092964-66092986 AGCACTGTCGACTAAGAAGGTGG + Intergenic
932303888 2:70687770-70687792 GGCACTGACCCCTAAGAAGTGGG + Intronic
932751936 2:74376738-74376760 GGGACTGAAGCCTAAGAAGGTGG - Exonic
933839068 2:86271716-86271738 AGCACTGACTCCTTAGCAGGGGG + Intronic
935343005 2:102074623-102074645 GTCACTTTCGCCTTTGAAAGAGG - Intronic
937243050 2:120474762-120474784 GGCACTGTGGCCTTAGGGAGTGG + Intergenic
941836336 2:170024319-170024341 CGCACTGTCGCCCAAGATGGAGG - Intronic
944522571 2:200586779-200586801 GGCTCTGTCGCCTCAGAAGCTGG + Intronic
948143782 2:235693265-235693287 GGCACTGTGGCCTTAGGAGCTGG + Intronic
948796831 2:240408181-240408203 GGCAATGTCACCTAAGAAAGAGG + Intergenic
948884929 2:240877711-240877733 GACACTGGCTCCTGAGAAGGAGG + Intronic
1168842656 20:919639-919661 GACACTGAGGCCTCAGAAGGCGG - Intergenic
1174090974 20:48047305-48047327 GGCACTGTCACATCAGGAGGTGG + Intergenic
1175995188 20:62809150-62809172 GGCACAGTCTCCTGAGATGGGGG - Intronic
1176013626 20:62915170-62915192 GTCACTGTCCCTTTAAAAGGAGG - Intronic
1177560170 21:22740956-22740978 GGCAGTGTCTCCTCAGAAGAAGG - Intergenic
1178552677 21:33554359-33554381 GGCAGTGTCTCTTTAGGAGGGGG - Exonic
1185062379 22:48613791-48613813 GACTCTGTCGCCATAGAATGTGG + Intronic
955666370 3:61353629-61353651 GTCACTGCCAACTTAGAAGGAGG - Intergenic
959979979 3:112505111-112505133 AAAACTGTAGCCTTAGAAGGCGG - Intergenic
962419392 3:135214820-135214842 AGCAATGTCGCCTGAGAAAGGGG + Intronic
968955284 4:3715933-3715955 GGCACAATCCCCTCAGAAGGAGG + Intergenic
969230438 4:5826747-5826769 GGCACTGTCACCTGATATGGAGG - Intronic
974102718 4:57435734-57435756 GGCACTGTCGGCTGGGGAGGGGG + Intergenic
979679506 4:123444306-123444328 GTCACTGTCCCCTTTAAAGGGGG + Intergenic
986362509 5:6994112-6994134 GTCACTGGAGACTTAGAAGGGGG - Intergenic
989604771 5:43233286-43233308 GTCACTCTTGCCTTAGAAGAAGG - Intronic
991504588 5:67310958-67310980 GGCACTGTAGTCTGAGAATGTGG - Intergenic
992077322 5:73203402-73203424 TGCACTGTGGCCTTGGTAGGAGG - Intergenic
1014785746 6:125616700-125616722 GGGACTGTGGTCTGAGAAGGAGG - Intergenic
1017536004 6:155348861-155348883 GGCTCAATAGCCTTAGAAGGGGG + Intergenic
1021027300 7:15685925-15685947 GGCACTGTCACCTGCGGAGGCGG - Exonic
1025778614 7:64579680-64579702 GGCAGTGTCTCCTGAGAGGGTGG + Intergenic
1039930295 8:41980697-41980719 AGAACTGTCACCTTAAAAGGTGG - Intronic
1039941078 8:42091479-42091501 GGCAGTGTAACCCTAGAAGGTGG + Intergenic
1052763248 9:32614206-32614228 GGCACTATCTCCTTAGATTGGGG - Intergenic
1054890592 9:70246871-70246893 GGGACTGTGGCCATAGGAGGTGG + Intergenic
1056118547 9:83464414-83464436 TGCACTGTCCCATTAGATGGTGG + Intronic
1059948487 9:119437723-119437745 GACACTGTAGGCTTGGAAGGGGG - Intergenic
1060418968 9:123454048-123454070 TGCACTGACGCATTAGCAGGAGG + Intronic
1186473324 X:9837874-9837896 GGCACTGCAGCCTCAGATGGTGG + Intronic
1187527454 X:20066895-20066917 GCCACTGTCCCCTTACATGGTGG + Intronic
1189203152 X:39215151-39215173 GCCACTGCAGCCTTAGAAGAGGG + Intergenic
1197675120 X:129321388-129321410 GGCATTGCAGCCCTAGAAGGTGG - Intergenic
1197987603 X:132283616-132283638 GGCATTGGCGTCTCAGAAGGGGG - Intergenic
1198103061 X:133438548-133438570 GGCACTGTCCCCTTGGAGTGTGG + Intergenic