ID: 917968653

View in Genome Browser
Species Human (GRCh38)
Location 1:180193940-180193962
Sequence GGTGCCTGTCACTCACACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 168}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917968653_917968667 22 Left 917968653 1:180193940-180193962 CCTGGGTGTGAGTGACAGGCACC 0: 1
1: 0
2: 2
3: 22
4: 168
Right 917968667 1:180193985-180194007 ATCCAGGTTTAGGAGTTTTGGGG 0: 1
1: 0
2: 1
3: 11
4: 188
917968653_917968672 29 Left 917968653 1:180193940-180193962 CCTGGGTGTGAGTGACAGGCACC 0: 1
1: 0
2: 2
3: 22
4: 168
Right 917968672 1:180193992-180194014 TTTAGGAGTTTTGGGGGGATGGG 0: 1
1: 0
2: 1
3: 37
4: 324
917968653_917968671 28 Left 917968653 1:180193940-180193962 CCTGGGTGTGAGTGACAGGCACC 0: 1
1: 0
2: 2
3: 22
4: 168
Right 917968671 1:180193991-180194013 GTTTAGGAGTTTTGGGGGGATGG 0: 1
1: 0
2: 3
3: 26
4: 302
917968653_917968664 12 Left 917968653 1:180193940-180193962 CCTGGGTGTGAGTGACAGGCACC 0: 1
1: 0
2: 2
3: 22
4: 168
Right 917968664 1:180193975-180193997 AGGGAAGGGGATCCAGGTTTAGG 0: 1
1: 0
2: 1
3: 27
4: 303
917968653_917968657 -7 Left 917968653 1:180193940-180193962 CCTGGGTGTGAGTGACAGGCACC 0: 1
1: 0
2: 2
3: 22
4: 168
Right 917968657 1:180193956-180193978 AGGCACCCAGGTTAGTGGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 164
917968653_917968663 6 Left 917968653 1:180193940-180193962 CCTGGGTGTGAGTGACAGGCACC 0: 1
1: 0
2: 2
3: 22
4: 168
Right 917968663 1:180193969-180193991 AGTGGCAGGGAAGGGGATCCAGG 0: 1
1: 0
2: 4
3: 62
4: 511
917968653_917968668 23 Left 917968653 1:180193940-180193962 CCTGGGTGTGAGTGACAGGCACC 0: 1
1: 0
2: 2
3: 22
4: 168
Right 917968668 1:180193986-180194008 TCCAGGTTTAGGAGTTTTGGGGG 0: 1
1: 0
2: 1
3: 10
4: 170
917968653_917968662 -1 Left 917968653 1:180193940-180193962 CCTGGGTGTGAGTGACAGGCACC 0: 1
1: 0
2: 2
3: 22
4: 168
Right 917968662 1:180193962-180193984 CCAGGTTAGTGGCAGGGAAGGGG 0: 1
1: 0
2: 2
3: 36
4: 372
917968653_917968673 30 Left 917968653 1:180193940-180193962 CCTGGGTGTGAGTGACAGGCACC 0: 1
1: 0
2: 2
3: 22
4: 168
Right 917968673 1:180193993-180194015 TTAGGAGTTTTGGGGGGATGGGG 0: 1
1: 0
2: 2
3: 29
4: 338
917968653_917968656 -8 Left 917968653 1:180193940-180193962 CCTGGGTGTGAGTGACAGGCACC 0: 1
1: 0
2: 2
3: 22
4: 168
Right 917968656 1:180193955-180193977 CAGGCACCCAGGTTAGTGGCAGG 0: 1
1: 0
2: 0
3: 19
4: 208
917968653_917968666 21 Left 917968653 1:180193940-180193962 CCTGGGTGTGAGTGACAGGCACC 0: 1
1: 0
2: 2
3: 22
4: 168
Right 917968666 1:180193984-180194006 GATCCAGGTTTAGGAGTTTTGGG 0: 1
1: 0
2: 0
3: 9
4: 139
917968653_917968670 24 Left 917968653 1:180193940-180193962 CCTGGGTGTGAGTGACAGGCACC 0: 1
1: 0
2: 2
3: 22
4: 168
Right 917968670 1:180193987-180194009 CCAGGTTTAGGAGTTTTGGGGGG 0: 1
1: 0
2: 0
3: 12
4: 172
917968653_917968658 -3 Left 917968653 1:180193940-180193962 CCTGGGTGTGAGTGACAGGCACC 0: 1
1: 0
2: 2
3: 22
4: 168
Right 917968658 1:180193960-180193982 ACCCAGGTTAGTGGCAGGGAAGG 0: 1
1: 0
2: 3
3: 35
4: 284
917968653_917968660 -2 Left 917968653 1:180193940-180193962 CCTGGGTGTGAGTGACAGGCACC 0: 1
1: 0
2: 2
3: 22
4: 168
Right 917968660 1:180193961-180193983 CCCAGGTTAGTGGCAGGGAAGGG 0: 1
1: 0
2: 2
3: 16
4: 303
917968653_917968665 20 Left 917968653 1:180193940-180193962 CCTGGGTGTGAGTGACAGGCACC 0: 1
1: 0
2: 2
3: 22
4: 168
Right 917968665 1:180193983-180194005 GGATCCAGGTTTAGGAGTTTTGG 0: 1
1: 0
2: 0
3: 11
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917968653 Original CRISPR GGTGCCTGTCACTCACACCC AGG (reversed) Intronic
900567115 1:3338973-3338995 GGTGCCTGTCACTGTCACAACGG - Intronic
900857897 1:5200625-5200647 GGTGCCTATCATTTACAGCCTGG - Intergenic
901395485 1:8978051-8978073 GGTGCATGCCACTAACGCCCTGG + Intergenic
902716110 1:18273902-18273924 GGTGCATTTCAGCCACACCCAGG - Intronic
902992590 1:20199573-20199595 GGTGCCTGTGACTCACACCTTGG - Intergenic
903295207 1:22339302-22339324 TGTGCCTGACACCCTCACCCGGG + Intergenic
905948075 1:41920329-41920351 AGAGCCTGTCACTCTCTCCCTGG + Intronic
906057490 1:42928376-42928398 TGTGCCTGGCACTCACACACAGG - Intronic
907758722 1:57337046-57337068 GGTGCCAGACACTGAGACCCAGG - Intronic
912432567 1:109636781-109636803 GGTCCTTGTCAATCACACCCGGG - Intergenic
915366962 1:155322053-155322075 GCTGCCTCTCCCTCAGACCCAGG + Exonic
916179200 1:162069720-162069742 GGTGCCTGTCACGGAGACGCTGG - Intergenic
917287773 1:173439667-173439689 GGTGCCAGTCAGTGACACCAGGG + Intergenic
917334834 1:173916307-173916329 GGTGCCTGTCTTTCTCTCCCAGG - Intronic
917968653 1:180193940-180193962 GGTGCCTGTCACTCACACCCAGG - Intronic
924799146 1:247314695-247314717 GGTGCCTGGCCCCAACACCCGGG - Intronic
924809717 1:247390251-247390273 GATGATTGTCACTAACACCCAGG + Intergenic
1062926313 10:1317959-1317981 GTTACCTGGCACTCACACCGGGG - Intronic
1065115211 10:22477417-22477439 GGTGCCTTTGGGTCACACCCGGG - Intergenic
1065624209 10:27614185-27614207 GGTCACTGTCACTCACCTCCAGG + Intergenic
1069953430 10:72035259-72035281 CGTGCCTGGGACTCAAACCCAGG - Intergenic
1070682959 10:78462029-78462051 GGTCCCTGTCACTCTGCCCCAGG - Intergenic
1072754803 10:98012250-98012272 GGAGCCTGTGGCACACACCCAGG + Intronic
1073796014 10:106989242-106989264 GGAGCCTTTCACTGACACCCAGG - Intronic
1075557602 10:123444732-123444754 GGTGCCTGGCAGGCACACTCAGG - Intergenic
1076367214 10:129929347-129929369 GGCACCTGCCACCCACACCCAGG + Intronic
1076503131 10:130952528-130952550 GGTGTCTGTCTCTGTCACCCAGG + Intergenic
1076805876 10:132858494-132858516 GCTGCCAGCCACTCCCACCCTGG - Intronic
1077446331 11:2592719-2592741 GGAGCCTGACACTCACAGCCCGG + Intronic
1077501303 11:2910869-2910891 GGTGCCTGTCAGGCACTCCAGGG + Intronic
1079809523 11:24979776-24979798 AGTATCTGTCCCTCACACCCGGG + Intronic
1083170570 11:60921967-60921989 GGTGCCTGACCCTTCCACCCGGG + Exonic
1083292052 11:61695905-61695927 GGAGCCTGTCATCCACACTCTGG - Intronic
1084558948 11:69891998-69892020 GGTGCCTGTCACTCGAACGCTGG + Intergenic
1084716019 11:70873908-70873930 TGTTCCTGTCACTGACGCCCGGG - Intronic
1085657602 11:78331147-78331169 GGTGTCTGTCTCTGTCACCCAGG - Intronic
1087068442 11:94049538-94049560 GGTGCCAGACACTGACTCCCAGG + Intronic
1090475883 11:127019510-127019532 CATGCCTGCCACTCACACACTGG - Intergenic
1091392374 12:133464-133486 GGGGCTTGTCACTCAGCCCCAGG - Intronic
1092123209 12:6058604-6058626 GCTGCCTGCCACTCAGGCCCTGG + Intronic
1094829027 12:34291459-34291481 GGTGCTTGTCTCTCCCACGCGGG - Intergenic
1094837133 12:34327404-34327426 GGTGCATTTCACTCCCACCAGGG - Intergenic
1097232691 12:57522277-57522299 TCTGCCTGTCACTGACAACCTGG - Intronic
1098146515 12:67503181-67503203 GGTGCCTCTCTCTGTCACCCAGG + Intergenic
1098280268 12:68855331-68855353 GGTACCTGTGAGTCACATCCAGG + Exonic
1098900367 12:76105897-76105919 GGAGTCTCTCACTCTCACCCAGG + Intergenic
1099054409 12:77820695-77820717 AGTGCTTGTCACACACACACTGG - Intergenic
1099279025 12:80619145-80619167 GGTGCCTGAAAATCACACCTGGG + Intronic
1101025368 12:100598929-100598951 TGTTGCTGCCACTCACACCCTGG + Intronic
1101881040 12:108626035-108626057 GGTGACTGTAACTCACTCACGGG + Intronic
1102524081 12:113498945-113498967 GGTGCCTGCTACTCACAGACAGG + Intergenic
1103794529 12:123494276-123494298 GATGCCTGTCAGTCACACAGGGG - Intronic
1103931507 12:124453273-124453295 GGCCCCTGTCCCTCACCCCCAGG + Intronic
1108527301 13:51296804-51296826 GCTTCCTGTCACTCACAATCAGG + Intergenic
1111816718 13:93163123-93163145 GGTGTCTGTAACTCAATCCCTGG - Intergenic
1116873139 14:50086487-50086509 GGTGCCTGAGACTCACATCTAGG - Intronic
1117954612 14:61112878-61112900 GGTGCCTGTCATTCACTGCCTGG + Intergenic
1121439024 14:93937155-93937177 GGGGCCTGTCTCCCACACCAGGG + Intronic
1121621745 14:95354773-95354795 GGAGTCTGTCTCTCTCACCCAGG - Intergenic
1122405622 14:101499098-101499120 GGGGCTTGTCAGTCTCACCCAGG + Intergenic
1126352200 15:47755972-47755994 GTATCCTGTCACTCACGCCCTGG + Intronic
1126590793 15:50337739-50337761 GGGGTCTGTCTCTGACACCCAGG - Intronic
1132092140 15:98955603-98955625 GATGGCTCTCCCTCACACCCAGG + Intronic
1132896628 16:2232385-2232407 GGGGCCTGCCACCCACACACTGG - Intronic
1133472138 16:6085558-6085580 TGTGCCCGACCCTCACACCCAGG + Intronic
1135566692 16:23516681-23516703 GGTGCCTGCCACTCCCCACCTGG + Intronic
1136020896 16:27439085-27439107 GGTGTCTGTGATTCACACTCTGG + Intronic
1136460684 16:30408194-30408216 GGTATGTGTCACACACACCCTGG + Exonic
1137349997 16:47705343-47705365 GGTGCCACTCACTCACACACAGG - Intergenic
1139037919 16:62970092-62970114 GGTGCCTGCCCCTTACAACCAGG + Intergenic
1139483274 16:67242482-67242504 GGCACATGTCCCTCACACCCCGG + Intronic
1140220476 16:73040193-73040215 GTTGCCTGTCACAGGCACCCAGG - Intronic
1141510056 16:84506050-84506072 GGTGCCTGTCACCTGCAGCCAGG + Intronic
1142245848 16:88969729-88969751 GGCACCTGCCACTCGCACCCTGG - Intronic
1145902299 17:28496830-28496852 GGTGCCAGGCACCCACACTCAGG + Intronic
1146400158 17:32495342-32495364 GGTCCCTGCCTGTCACACCCCGG + Intronic
1147754932 17:42761640-42761662 GCTCCTTGTCACTCACACCCAGG - Intronic
1148908282 17:50925636-50925658 GGTGCCTGGCTCACACCCCCAGG + Intergenic
1149985695 17:61345300-61345322 TGTGCTTGTCACTCCCGCCCTGG + Intronic
1152009050 17:77699629-77699651 GGTGGCTGTCACTGCCACCAGGG + Intergenic
1158877993 18:61751546-61751568 GCTGCCTATCACCCACACCCAGG - Intergenic
1159092827 18:63868944-63868966 GGAGCCTGTCTCTGTCACCCAGG - Intergenic
1159811583 18:73023894-73023916 GGTGCCTGTGACACAGCCCCAGG - Intergenic
1160242119 18:77132031-77132053 GGCGCCTGCTAATCACACCCCGG - Intronic
1160911041 19:1473924-1473946 GGGGCCTGCCACACACAGCCTGG - Exonic
1161398634 19:4058181-4058203 GGTCTCTGTTACTCACAGCCAGG - Intronic
1162197550 19:8997183-8997205 GGAGCCTGGCTCTCTCACCCAGG - Intergenic
1166669452 19:44701250-44701272 GGTGCCCGCCACACCCACCCTGG + Intronic
1167552184 19:50168988-50169010 GGTGCCTGCCATTCAATCCCAGG - Intergenic
925296243 2:2779541-2779563 TGTTCCTGTCACGCCCACCCTGG + Intergenic
925745212 2:7038330-7038352 GGTGTCTGTCACTCACATGGCGG + Intronic
925818183 2:7773796-7773818 GGTGCTTCTCTCTTACACCCTGG + Intergenic
929773937 2:44916069-44916091 GAAGCCTGTCACTCATGCCCTGG - Intergenic
931205112 2:60139451-60139473 GGTCCCTGTCACTCCCACTCTGG + Intergenic
933553678 2:83806814-83806836 GGTGCTTTTCTCTCACATCCAGG + Intergenic
936015395 2:108955013-108955035 TGTGCCAGTCACTCATAGCCTGG - Intronic
944114041 2:196168394-196168416 GGTGCTTGTCACTCACAAGACGG + Intronic
946186391 2:217983086-217983108 GGTCCCTGTCACTCACAGACTGG - Intronic
947105475 2:226663769-226663791 GATGCGTGTCACTCCCTCCCAGG - Intergenic
947454394 2:230240002-230240024 GGTACCTGTCACCCAAACACAGG - Intronic
1173387436 20:42601947-42601969 GTTGCTTGTTATTCACACCCAGG - Intronic
1174057677 20:47809851-47809873 AGTGGCTGTGACTCACACCCTGG + Intergenic
1174354492 20:49989022-49989044 GGTCCCTGACAGTGACACCCAGG - Intergenic
1175599403 20:60260594-60260616 CGTGCCTGGCACACACAACCAGG - Intergenic
1180041132 21:45280741-45280763 GCTGCCTGTCCCTCACTCGCTGG + Intronic
1180212252 21:46301981-46302003 GGTCTCTGTGACTCACACTCAGG + Exonic
1181176726 22:21042061-21042083 GGTTTCTGTCACCCACAGCCTGG + Intergenic
1181518340 22:23430891-23430913 GCTTCCTGGCAGTCACACCCTGG - Intergenic
1182462232 22:30491182-30491204 GGTGCTTATCATTCACCCCCAGG - Intronic
1183183571 22:36278171-36278193 GGTCCCGGCCACTCACAGCCCGG + Intergenic
1184555411 22:45230068-45230090 TGTTCCTGTCACTGTCACCCAGG - Intronic
950445060 3:13032335-13032357 TGAGCCTTTCACACACACCCCGG + Intronic
951509193 3:23482634-23482656 TGTGCCTGTCATTGACAGCCTGG + Intronic
953327535 3:42025250-42025272 GGGGCCTGTACCTCAGACCCTGG + Intronic
955322755 3:57986011-57986033 GGTTTCTGCCACTCACAACCAGG + Intergenic
956779614 3:72593707-72593729 GGTGCCTGTCATTCTCTGCCAGG - Intergenic
964086750 3:152827921-152827943 GAGGTCTGTCACTCAGACCCTGG + Intergenic
967833210 3:193940149-193940171 GGTGACAGTCACTCAGACACTGG - Intergenic
968124021 3:196145222-196145244 TGTGCCTGTCAATCAGAGCCAGG - Intergenic
968124026 3:196145255-196145277 TGTGCCTGTCAATCAGAGCCAGG - Intergenic
968124036 3:196145321-196145343 TGTGCCTGTCAATCAGAGCCAGG - Intergenic
968124065 3:196145519-196145541 TGTGCCTGTCAATCAGAGCCAGG - Intergenic
968213475 3:196868301-196868323 GGTGCCTGCGACGCACAGCCCGG - Intronic
969576463 4:8038895-8038917 GCTCCCAGTCACTCACAGCCTGG + Intronic
971241393 4:24892172-24892194 GGGGACTCTGACTCACACCCCGG - Intronic
982867015 4:160526072-160526094 GGTGTCTGTCTCTGACACTCAGG + Intergenic
983187885 4:164721412-164721434 AGACCCTGTCACTCACATCCAGG - Intergenic
985485725 5:147066-147088 GGTCCCTGTCACTTGCTCCCAGG - Intronic
992825171 5:80542686-80542708 GGAGTCTGTCTCTCTCACCCAGG + Intergenic
996194829 5:120591251-120591273 GGTGTCTCGCACTCTCACCCAGG - Intronic
1001813471 5:174648247-174648269 GGGGCCTGTCACTGAGAGCCAGG + Intergenic
1002535098 5:179871810-179871832 GGAGCCTCTCTCTCACACTCCGG + Intronic
1002535114 5:179871857-179871879 GGAGCCTCTCTCTCACACTCCGG + Intronic
1002535145 5:179871951-179871973 GGAGCCTCTCTCTCACACTCCGG + Intronic
1002535161 5:179871998-179872020 GGAGCCTCTCTCTCACACTCCGG + Intronic
1002535177 5:179872045-179872067 GGAGCCTCTCTCTCACACTCCGG + Intronic
1002535193 5:179872092-179872114 GGAGCCTCTCTCTCACACTCCGG + Intronic
1002535209 5:179872139-179872161 GGAGCCTCTCTCTCACACTCCGG + Intronic
1002686925 5:181020144-181020166 GGTGGCTGTTACTGAGACCCAGG + Intergenic
1002886665 6:1302907-1302929 GGAGTCTCTCTCTCACACCCAGG + Intergenic
1006738824 6:36293176-36293198 GGTCCCTGTGACTCACACCTGGG + Intronic
1007844306 6:44741025-44741047 TGTGCCAGCCCCTCACACCCTGG + Intergenic
1013709642 6:112881300-112881322 GCCGCCTGTCAGTCACACCCTGG - Intergenic
1019293250 7:260758-260780 GGGGCGGGTCCCTCACACCCTGG + Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1020040161 7:4995781-4995803 TGTGCCTGTTACCCTCACCCAGG - Intronic
1022331276 7:29381668-29381690 GGTGATTCTGACTCACACCCAGG - Intronic
1023224346 7:37953179-37953201 GGTGTATGTCAAGCACACCCTGG - Intronic
1025734623 7:64136102-64136124 GGGACCTGTGATTCACACCCAGG + Intronic
1026341558 7:69438642-69438664 GCTGCCTGACACTCACATGCAGG + Intergenic
1026482710 7:70791919-70791941 GGTGTCTGTCAGACACACACAGG + Exonic
1029341979 7:99952408-99952430 GGAGCCTCTCACTGTCACCCAGG - Intergenic
1029342006 7:99952638-99952660 GGAGCCTCTCACTGTCACCCAGG - Intergenic
1029342031 7:99952869-99952891 GGAGCCTCTCACTGTCACCCAGG - Intergenic
1031521153 7:122767619-122767641 TGTGCCTTTCTCTCACTCCCCGG + Intronic
1035295812 7:157866691-157866713 AGTGCTTGCCACACACACCCTGG + Intronic
1035313606 7:157984538-157984560 GGCCCCTGGCATTCACACCCTGG - Intronic
1036594659 8:10200854-10200876 GGTGGCTGTCACTCAAATCTGGG - Intronic
1036664752 8:10730934-10730956 GGTCAATGTCTCTCACACCCAGG - Intronic
1036704200 8:11034565-11034587 GGTGCATGTCACTCCCTTCCTGG - Intronic
1036808998 8:11854263-11854285 GGTTCCTGTCAGTCACTCCAGGG + Intronic
1037261023 8:17008311-17008333 GGAGCCTCTCTCTCTCACCCAGG - Intergenic
1037535098 8:19816937-19816959 GCTGCCTGCGACTCACTCCCCGG - Intergenic
1039404097 8:37297991-37298013 TGTGTCTGTCCCACACACCCTGG - Intergenic
1039835110 8:41249779-41249801 CGTGCCTGCCACACACACCGGGG - Intergenic
1039949065 8:42153467-42153489 GCTGCCTCTCCCTCGCACCCCGG + Intronic
1040278009 8:46023758-46023780 GGTGCGTGTCTCGCACACCGGGG - Intergenic
1040285515 8:46098615-46098637 GGTGCCTGTGTCTCTCACCGAGG + Intergenic
1040312141 8:46242247-46242269 GGGGCTTTTCACACACACCCCGG - Intergenic
1040425923 8:47286263-47286285 GGTGCCTGAGACGCACACCCAGG - Intronic
1043379494 8:79687466-79687488 GGTGTCTTCAACTCACACCCTGG + Intergenic
1045097104 8:98809329-98809351 GGTGTCTGACACTCACTCCAGGG + Intronic
1048987962 8:139745415-139745437 GGTGCCTGGCTCCCACACCCAGG + Intronic
1049027190 8:140001221-140001243 AGGGCCTGTCACGCACACCAGGG + Intronic
1049096697 8:140552407-140552429 AGTGCCTGTCCCTCCCACACGGG - Intronic
1049161751 8:141102556-141102578 CGTGCCTTTCACTCACTCCCCGG + Intergenic
1053527737 9:38846828-38846850 CCTGCCTGTCCCCCACACCCCGG - Intergenic
1054199960 9:62071257-62071279 CCTGCCTGTCACCCACACCCCGG - Intergenic
1054638395 9:67517100-67517122 CCTGCCTGTCACCCACACCCCGG + Intergenic
1055673467 9:78631128-78631150 GGTTCCTGTCATTCACGCCGGGG + Intergenic
1056137836 9:83646988-83647010 GGTGCCTGTCACATACAGTCTGG - Intergenic
1058323758 9:103669311-103669333 GGTTTCTGTCACTCACTCTCAGG - Intergenic
1060415245 9:123425409-123425431 GGATCCTGTCTCTCACAACCTGG + Intronic
1061217725 9:129231487-129231509 GGAGCCTGTGACTCAAACACAGG + Intergenic
1061841553 9:133361297-133361319 GGAGTCTGTCCCCCACACCCAGG + Intergenic
1061848591 9:133401874-133401896 GGTGGCTGGCAGACACACCCTGG - Exonic
1061960157 9:133983761-133983783 AGTCCCTGTCACTAACAGCCAGG + Intronic
1188043789 X:25402291-25402313 AGTGCCTGCCACTAACACCCTGG - Intergenic
1191251351 X:58261604-58261626 GGTGCCTGTCTCTCACACTGGGG + Intergenic
1193758957 X:85441532-85441554 GGTCCATGGCACTCACACACTGG - Intergenic
1194665663 X:96674814-96674836 GGTTCCTGTAACTGGCACCCAGG + Intergenic
1195702964 X:107718533-107718555 GGTGCCTGGCACTAACACCCTGG + Intronic
1200277912 X:154751321-154751343 GGCGCCTGCCACTCTCACCCAGG + Intronic