ID: 917968717

View in Genome Browser
Species Human (GRCh38)
Location 1:180194159-180194181
Sequence CTGTGGGGCTGGCAGCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 1, 2: 3, 3: 41, 4: 378}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917968703_917968717 22 Left 917968703 1:180194114-180194136 CCACGGCAGGATGGGGGGCGGCA 0: 1
1: 0
2: 0
3: 18
4: 159
Right 917968717 1:180194159-180194181 CTGTGGGGCTGGCAGCCTGAAGG 0: 1
1: 1
2: 3
3: 41
4: 378
917968713_917968717 -7 Left 917968713 1:180194143-180194165 CCTGGGGAGGCAACGGCTGTGGG 0: 1
1: 0
2: 1
3: 31
4: 285
Right 917968717 1:180194159-180194181 CTGTGGGGCTGGCAGCCTGAAGG 0: 1
1: 1
2: 3
3: 41
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917968717 Original CRISPR CTGTGGGGCTGGCAGCCTGA AGG Intronic
900183776 1:1323928-1323950 CTGAGGGGCTGGGGGGCTGAGGG + Intronic
900183791 1:1323968-1323990 CTGAGGGGCTGGGGGACTGAGGG + Intronic
900183798 1:1323984-1324006 CTGAGGGGCTGGGGGACTGAGGG + Intronic
900183819 1:1324040-1324062 CTGGGGGGCTGGGGGGCTGAGGG + Intronic
900183857 1:1324136-1324158 CTGGGGGGCTGGGGGGCTGAGGG + Intronic
900183865 1:1324152-1324174 CTGAGGGGCTGGGGGGCTGAGGG + Intronic
900345817 1:2209811-2209833 CTGGAAGGCTGGGAGCCTGAAGG - Intronic
900605614 1:3522363-3522385 CTGAGGGGGTGACAGCCAGAGGG + Intronic
900804635 1:4759407-4759429 CTCTGGGGCTGGAAGCTGGATGG + Intronic
900987417 1:6081209-6081231 CTGTGGTGGTGGCTGCCTCATGG - Intronic
901045243 1:6392438-6392460 AGGTGGGGAGGGCAGCCTGAAGG - Intronic
901236545 1:7670375-7670397 CTGTGGGGATGGCAAGGTGAGGG - Intronic
901535795 1:9882432-9882454 ATGTGCGGCTGGGAGCCTGGAGG + Intronic
901610700 1:10495682-10495704 CTGAGGCGCTCGCACCCTGAGGG - Intronic
901643193 1:10703412-10703434 CTGAGGGGCAAGCAGGCTGAGGG - Intronic
902545906 1:17190315-17190337 CATCAGGGCTGGCAGCCTGAGGG - Intergenic
902899920 1:19507766-19507788 CTTAGAGGCTGGCAGGCTGAGGG - Intergenic
902943594 1:19817547-19817569 CTGTGGTCCTGGCAGCCCCAGGG - Intergenic
904311586 1:29632789-29632811 CTGGGGGGCTGGAGGGCTGAGGG - Intergenic
904337112 1:29805171-29805193 CTCTGTGTCTGGCAGCCTGATGG + Intergenic
904475429 1:30761948-30761970 AGGTGGGGCTTGCAGCCAGAAGG - Intergenic
905175094 1:36130442-36130464 CTGTCTGTCTGGCAACCTGAAGG + Intergenic
906009338 1:42509167-42509189 CTTTGGGGCTGGAAGCAAGATGG - Intronic
906108649 1:43309162-43309184 CTGTGAAGCAGGCGGCCTGAGGG - Intronic
906938467 1:50235167-50235189 CTGTAGGGCTGGAACCCTCATGG + Intergenic
909192767 1:72574629-72574651 CTCTGGTGCTGTCAGCCTGTAGG + Intergenic
909898964 1:81109260-81109282 CTGAAGGGCTGGCAGGCAGAGGG + Intergenic
911027204 1:93448224-93448246 CTGTGGAGCCGACAGACTGAAGG + Exonic
912775765 1:112505576-112505598 TTGTGGGGCTGCCAGGCAGAGGG - Intronic
913112890 1:115671856-115671878 CTGTGGGGAAGGCAGCCAGAGGG + Intronic
915108473 1:153548598-153548620 CTGCGGGGCCTGAAGCCTGATGG - Intronic
915364184 1:155304960-155304982 CTGTGGGGCCAGGAGGCTGACGG + Intergenic
917067667 1:171114301-171114323 CTGTGGGAATGGCAGCCCCAAGG - Exonic
917071139 1:171152204-171152226 CTGTGGGGATGGCAGCTCCAAGG - Exonic
917515327 1:175702424-175702446 CTGTGGGTCTGGAAGCTGGAAGG - Intronic
917880492 1:179330661-179330683 CTGTGAGGCTAGAAGCATGATGG + Intronic
917968717 1:180194159-180194181 CTGTGGGGCTGGCAGCCTGAAGG + Intronic
919593922 1:199538175-199538197 CTGTGGGGCAGGGAGCAAGATGG - Intergenic
919872032 1:201829179-201829201 CCGCGGGGCTGGCGGGCTGAGGG + Exonic
920194654 1:204218779-204218801 TTGTGGGGTTGGCAGCTTGTGGG - Intergenic
920846109 1:209594263-209594285 TCATGGGGCTGCCAGCCTGAAGG - Intronic
921334042 1:214068254-214068276 TTGTGAGGCTGGGAGCCTGTGGG + Intergenic
921888405 1:220329307-220329329 CTTTGGGGCTGGCAGCCACCTGG + Intergenic
922334129 1:224605359-224605381 CTGTGGGGCTAGAAGCAAGATGG - Intronic
922609731 1:226916971-226916993 CTGTGAAGCTTGCAACCTGAAGG + Intronic
922998283 1:229984349-229984371 ATGTGGGGCTGACAGCGGGAAGG - Intergenic
923280600 1:232439394-232439416 CTTTGGGTCTGGCGACCTGATGG - Exonic
923402598 1:233629452-233629474 CTGAGAGGCTGGCACCCTCACGG - Intronic
924622784 1:245676926-245676948 ATTTGGGGCTGGCACCATGATGG - Intronic
1063371855 10:5527390-5527412 CTCTGGGGCTGGATTCCTGAGGG + Intergenic
1066745933 10:38604252-38604274 CAGTGGGAGTGGCTGCCTGAGGG + Intergenic
1067407171 10:46033660-46033682 CTCTGGGGCTGCCAGCCAAAGGG - Intronic
1067510557 10:46891530-46891552 CTGTGGTGCTGGCAGCCATCTGG - Intergenic
1067651696 10:48160332-48160354 CTGTGGTGCTGGCAGCCATCTGG + Intronic
1067756838 10:49011831-49011853 CTGGGTGGCTGGCTGCCTGTGGG + Intergenic
1067771549 10:49130256-49130278 CTGTGGAGCTTATAGCCTGAGGG - Intergenic
1069618314 10:69820440-69820462 CTGGGGGCCTGGCACCCAGAAGG - Intronic
1070407741 10:76112136-76112158 AGGAGGGGCTGGCAGCCTGGAGG + Intronic
1072445372 10:95494614-95494636 CTCTGGTGCTGGCTGCCTGAAGG - Intronic
1073056719 10:100707863-100707885 CTTTGGGGCTGGAAGACAGACGG - Intergenic
1073100833 10:101005792-101005814 CTCTGGGGGTGGCAGGCTGAGGG - Intronic
1074511470 10:114116536-114116558 CTGTGGGGCTGGCCACCTCTGGG - Intergenic
1074959274 10:118425465-118425487 ATGTGGAGCTTGCAGACTGACGG + Intergenic
1075078678 10:119368488-119368510 CAGTGGGGCTGTGAGCCTGGTGG - Intronic
1075745260 10:124723149-124723171 CTGTAGGGGTGGCAGCTTGCTGG - Intronic
1075762296 10:124865972-124865994 CTGGGGGCTTGGCAGCCTGCTGG - Intergenic
1075806065 10:125189639-125189661 CTGGGGGGCTTCCAGCCAGAGGG + Intergenic
1076088476 10:127657547-127657569 CTGTGGGGCTGGAGTCCTGCAGG - Intergenic
1076151202 10:128163262-128163284 CTGTGGAGCTGGGAACCTAAGGG - Intergenic
1077096103 11:799777-799799 CCCTGGGGCTGGCAGCCAGCGGG + Intronic
1077351878 11:2096874-2096896 CTGTGGGGCAGACAGCCTGGGGG - Intergenic
1077356882 11:2122792-2122814 GGGTGGGGCTGTCAGCCTGTGGG + Intergenic
1077476781 11:2794233-2794255 CGGTGGGGCTGGCAGACTGGGGG - Intronic
1077486607 11:2841622-2841644 CTGTGGGGCTGTTGGCCTGCAGG + Intronic
1077511666 11:2968083-2968105 CTGTGGGGCTGTCTGGCTCATGG - Intronic
1077691384 11:4345813-4345835 CTGTTGGCCTGAAAGCCTGAGGG + Intergenic
1078357973 11:10647031-10647053 CTGAGGGGCTGGCAGGCAGAAGG + Intronic
1080568557 11:33535134-33535156 CTTTGTGGCTGCCAGACTGAAGG + Intergenic
1081154789 11:39677001-39677023 CTGTGAGGCAGGAAGCCTGCTGG - Intergenic
1081709796 11:45209323-45209345 CTGGGGGGCAGGCAGCCGGCTGG - Intronic
1084144870 11:67259753-67259775 CGGAGGGCCTGGCAGCCTCATGG - Intergenic
1084675265 11:70630327-70630349 CTGTGAGGGTGGCAGACAGAAGG + Intronic
1084887017 11:72217354-72217376 CTGTGGGGAAGGCAACTTGAAGG + Intronic
1085515965 11:77112212-77112234 CAGTGGGGCTGCCAGCCTTGGGG + Intronic
1087380409 11:97398407-97398429 CTGTGGTGGTGGCAGCCTTGAGG - Intergenic
1089046090 11:115503501-115503523 CTGTGGGGCGGGCGGGCTGCGGG + Intronic
1089170434 11:116507874-116507896 ATATGGGGGTGGGAGCCTGAAGG - Intergenic
1089601212 11:119616514-119616536 CTGTGGGGAGGGCAGGCTCAAGG + Intergenic
1089695666 11:120214882-120214904 CTGTGGCTCGGTCAGCCTGATGG - Intronic
1089711475 11:120317816-120317838 CAGTGGGGCAGGCAGCCTCCTGG + Intronic
1090003229 11:122979569-122979591 CTTTGGGGCGAGCAGACTGACGG - Intronic
1090596551 11:128326993-128327015 CTCTGGGGCCGCCTGCCTGAGGG - Intergenic
1090597488 11:128335224-128335246 CTCTGGAGCTTGGAGCCTGAAGG + Intergenic
1091597295 12:1886648-1886670 CTGAGGGGCTGGCAGCAGAAAGG + Intronic
1096882588 12:54684871-54684893 GAGAGGGGCTGGCAGCCTGAGGG + Intergenic
1097167103 12:57091706-57091728 CTGGGGGGCTGGCAGCAGGTGGG + Exonic
1098522362 12:71447787-71447809 CTGTGGAACTGGCTGCTTGAAGG + Intronic
1102241125 12:111325531-111325553 CTAGGGGGCAGGAAGCCTGATGG - Intronic
1103447255 12:121002234-121002256 CTGGGGGCCTGGCTGGCTGAGGG + Exonic
1103508021 12:121454457-121454479 CTCTGGGGCTGGGAACCAGAGGG - Intronic
1103909774 12:124345824-124345846 CTGTGGGGCTGTGAGGCGGAAGG - Intronic
1104513845 12:129405495-129405517 CTGTGGGGCAAGCAGGCTGTGGG + Intronic
1106641535 13:31588956-31588978 CTTTGGGCCTGGTAGCTTGAGGG - Intergenic
1107405523 13:40108987-40109009 CAGTGGGGAGGGCAGCCTGCAGG - Intergenic
1108117496 13:47145390-47145412 CTGTGTGTCTGGCTCCCTGATGG - Intergenic
1108493900 13:51005870-51005892 CTGTGGGGCTGGCATGATGGTGG + Intergenic
1108854440 13:54775589-54775611 CACTGGGGATGGCAGGCTGATGG - Intergenic
1109222204 13:59651660-59651682 GTGAGGGGTAGGCAGCCTGAAGG - Intergenic
1110055706 13:70967761-70967783 CCGTGGTGCTGCCAGCCTGGAGG + Intergenic
1111494982 13:89035778-89035800 CTGGTGGGCTGTCAGACTGAGGG - Intergenic
1112448563 13:99489293-99489315 CTGTTGGGATGGCACCCTGAGGG + Intergenic
1113583772 13:111448811-111448833 CTGTGGGGCTGGCACCCACCTGG - Intergenic
1113961752 13:114130236-114130258 CTGCAGGGCTGGCTGCCTGAGGG - Intronic
1114483466 14:23049125-23049147 GTGTGCCGCTGCCAGCCTGACGG - Exonic
1115909510 14:38240099-38240121 CTGTGAGGCAGGGGGCCTGATGG + Intergenic
1117377004 14:55126206-55126228 CTGGGTGGCTGGCAGACTTAGGG - Intronic
1118193575 14:63603715-63603737 ATGTGGGGCTTACAGACTGATGG - Intronic
1118978297 14:70695942-70695964 ATTTGGGCCTGGAAGCCTGATGG - Intergenic
1119331809 14:73800543-73800565 CAGTGTGGCTGCCAGCCTGAGGG + Intergenic
1119404453 14:74388897-74388919 CTGTGGGTGTGGCTGCCAGATGG - Intergenic
1119888925 14:78168082-78168104 CTGTGGGGCAGGCATCCTACGGG + Intergenic
1119916329 14:78405648-78405670 CTGCAGGGCTGGGAGCCTGGCGG + Intronic
1121455923 14:94038827-94038849 CTGAGGGGATAGCAGCCTGAAGG + Intronic
1121469905 14:94144712-94144734 CTTTGGGGCTGGCAACCTCGGGG + Intergenic
1121510472 14:94509468-94509490 TTGTGGGGCTGGGAGCCTAGAGG - Intronic
1122930574 14:104931449-104931471 GGGTGGGGGTGGCACCCTGAAGG + Intronic
1123036218 14:105473038-105473060 CTGTGGGGCTTGCTACCTGTGGG - Exonic
1123215960 14:106809697-106809719 CTGTGGACCTGGCAGGCTGAGGG - Intergenic
1123899438 15:24861939-24861961 CTGTGTGGCAGGAAGACTGATGG + Intronic
1125610036 15:40963712-40963734 ATGTGGGGCTGGAAGCCACATGG + Intergenic
1126335510 15:47582763-47582785 TTGAGAGGCTGGCAGGCTGAGGG - Intronic
1126341584 15:47646341-47646363 GTGTGTGCCAGGCAGCCTGAAGG + Intronic
1128107137 15:65053479-65053501 CTGTGGGTCGGGAAGCCTGTAGG + Exonic
1128217639 15:65945383-65945405 GTGTGGGGCTGCAGGCCTGAGGG + Intronic
1128616524 15:69114706-69114728 CGGTGAGGCAGGCAGCCTCAAGG + Intergenic
1129439975 15:75574343-75574365 TTGCGGGGCAGGCAGGCTGAGGG + Intronic
1129880563 15:79003753-79003775 CAGTGGGGCTGGGAGGCTGGGGG + Intronic
1130080018 15:80724691-80724713 CTGTGGGTCTGGGAGGGTGATGG + Intronic
1130979867 15:88804847-88804869 CTGTGGGGCTGGCTGCCAGGAGG + Intronic
1131071277 15:89467698-89467720 CTGTTGGGATTGCACCCTGAGGG - Intergenic
1131523805 15:93136814-93136836 CTGGGGAGCAGACAGCCTGAAGG + Intergenic
1131846535 15:96495160-96495182 CTGTGGGGCTGGAATCATGAGGG + Intergenic
1132621783 16:871218-871240 CTCTGGGCCAGGCAGCCTGAAGG - Exonic
1132949225 16:2551226-2551248 CCTTGGTGGTGGCAGCCTGAGGG + Intronic
1132965363 16:2650902-2650924 CCTTGGTGGTGGCAGCCTGAGGG - Intergenic
1133232176 16:4372002-4372024 CTGTGGGGCTGGGGGGCTGCGGG + Intronic
1136186491 16:28591567-28591589 CTGTGGGGCAGGCAGACAGGAGG - Intronic
1136188976 16:28604291-28604313 CTGTGGGGCAGGCAGACAGGAGG - Intergenic
1136292983 16:29287030-29287052 CTGGGGGTCTTGGAGCCTGACGG + Intergenic
1136548940 16:30971584-30971606 CTGGGGGGCGGGGAGGCTGAGGG - Exonic
1136737131 16:32475392-32475414 CAGTGGGAGTGGCTGCCTGAGGG - Intergenic
1137789583 16:51163850-51163872 ATGTGGGGCTGACAGTCTGGTGG - Intergenic
1139515709 16:67451245-67451267 CTGGGGGGCTGCCAGCCGGGTGG + Intronic
1141690357 16:85593242-85593264 CTGTGGGGCAGCCAGCTGGAGGG + Intergenic
1141985539 16:87577351-87577373 CTATGGGGCAGGCAGCCTGTGGG + Intergenic
1142066481 16:88065847-88065869 CTGTGGGGCTGGGATCCTGTGGG - Intronic
1142373992 16:89697533-89697555 CTGTGTGCCTGGTAGCCTGGGGG + Exonic
1203015940 16_KI270728v1_random:354185-354207 CAGTGGGAGTGGCTGCCTGAGGG + Intergenic
1203034275 16_KI270728v1_random:627343-627365 CAGTGGGAGTGGCTGCCTGAGGG + Intergenic
1144256723 17:13475740-13475762 CTGTGAGGCTGGAAGCAAGATGG - Intergenic
1144496612 17:15749832-15749854 CTGAGGGGCTGAAAGGCTGAGGG + Intergenic
1144606263 17:16667477-16667499 CTGAGGGGCTGAAAGGCTGAAGG + Intergenic
1145206848 17:20989061-20989083 CTCTGGGGCTCCCAGCCTGTGGG + Intergenic
1145937954 17:28726192-28726214 GTGTGGGGCTGGCGGCCGGCGGG - Exonic
1146052027 17:29561991-29562013 CAGTGGGGCTGGCTCGCTGAGGG - Exonic
1146214267 17:30966249-30966271 CTGTGAGGCTAGCAGCAAGATGG + Intergenic
1146729501 17:35181872-35181894 CTGGGGGCCTGGCAGCCATAGGG + Intronic
1146883762 17:36457682-36457704 CTGTGGGGCTGACTCCCAGAAGG + Intergenic
1147258292 17:39195023-39195045 CTCTGGGGCTGGCAAGATGAGGG - Intronic
1147753216 17:42750148-42750170 CTGTGGGGTTGGAGGCTTGAGGG - Intergenic
1148018052 17:44536456-44536478 CAGAGGGGCTGTCAGCCAGATGG + Intergenic
1148104382 17:45111606-45111628 CTGTGGGGGTGGCAGCATAGAGG + Exonic
1148506041 17:48127882-48127904 CTGTGGGGCTGGCCAGCTGTCGG - Intergenic
1150525378 17:65917056-65917078 CTCTGAGTCTGGCAGCCTAATGG + Intronic
1151539405 17:74757575-74757597 CTGTGTGACGGGCAGCCTGGGGG - Intronic
1151703554 17:75755458-75755480 GGGTGGGGCTGGCAGACTCACGG + Intronic
1152568582 17:81111366-81111388 CTTTGGGGCTGACAGCCTTGTGG + Intronic
1152844874 17:82593564-82593586 CTGTGGGGCCGGGAGCCAGAAGG - Intronic
1153588884 18:6652377-6652399 CACTGGGCCTGGCAACCTGAGGG - Intergenic
1153660061 18:7318098-7318120 CTGTGGGCCTGGGAGACAGAAGG - Intergenic
1153752396 18:8246201-8246223 GTGTGGTGCTGGCAGCCTTGTGG - Intronic
1154170761 18:12048406-12048428 CTGCGGGGCTGGCCGCTTGAGGG - Intergenic
1157773681 18:50373784-50373806 GACAGGGGCTGGCAGCCTGAAGG + Intergenic
1158547793 18:58410679-58410701 ATTTGGGGCTGGGAGTCTGAAGG + Intergenic
1158675254 18:59512611-59512633 CTGTGGTGCTGGCAGGCCCAGGG + Intronic
1159314527 18:66754537-66754559 CTGTGGGGAATGAAGCCTGAGGG - Intergenic
1160387293 18:78504365-78504387 CTGTCGGGCTGGCATCCTCAGGG - Intergenic
1160776599 19:859457-859479 CTGTGAGCCTGACAGCCTGCTGG - Intergenic
1160785363 19:897870-897892 CTGCAGGGCAGGGAGCCTGAGGG - Intronic
1160858160 19:1226642-1226664 CAGTGAGGCTGGCCGCCTGCAGG + Exonic
1161620966 19:5296877-5296899 CTGTGGGGAGGGCAGACTGTGGG + Intronic
1161765080 19:6202961-6202983 CTGTGGGGAGGACAGACTGAGGG + Intergenic
1161843506 19:6696546-6696568 CTGAGGGGCTGGCAGGGTAAGGG - Intronic
1162449172 19:10744221-10744243 CTGTGGGGCAGGGAGCCTGGGGG + Intronic
1162560775 19:11417044-11417066 CAATGGGGCTGGGAGCCTGCAGG + Exonic
1162945255 19:14039528-14039550 CTGTGGCAGTGGCAGCCGGACGG + Exonic
1164311263 19:24048393-24048415 CTGTAGACCTGGCAGCCAGAAGG - Intronic
1164466372 19:28490592-28490614 CTGGAGGGCAGGCAGCCTGTGGG + Intergenic
1164518777 19:28960752-28960774 CTGTGAGGCTGGAAGCAAGATGG - Intergenic
1165093101 19:33396766-33396788 CTCTGGGGCTTGCAGGCGGAGGG + Intronic
1165096761 19:33413787-33413809 CTGTGAGGCTTACAGCCTGGGGG + Intronic
1165189580 19:34051429-34051451 CTGTGGGGCTGACCACCTGTTGG - Intergenic
1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG + Intergenic
1165953661 19:39488808-39488830 CTGTAGGGCTGCCAGAATGAGGG + Intronic
1167212063 19:48139571-48139593 GTGGGGGGCCAGCAGCCTGAAGG - Intronic
1168139310 19:54374685-54374707 CTCTGGGGCTGGGAGCCTTCTGG - Intergenic
1168158707 19:54493556-54493578 CTCTGGGGCTGGGAGCCTTCTGG + Intergenic
1168456017 19:56509085-56509107 TTGGTGGGCTGGCAGCCTGTAGG + Intronic
927135909 2:20096461-20096483 CTTTGTGTCTGGCAGCCTGAGGG - Intergenic
928104307 2:28457849-28457871 CCTTGGGGCTGGCAGCCTAAAGG + Intronic
928478187 2:31652937-31652959 TTGTGAGACTGGGAGCCTGAAGG + Intergenic
928855231 2:35795554-35795576 TTGAAGGGCTGGCAGCCTCAGGG - Intergenic
931717857 2:65043302-65043324 CTCAGGAGCTGGCAGGCTGAAGG - Intergenic
932576792 2:72966784-72966806 CTGTGGGCCTGGCAGCAAGAAGG - Intronic
932948240 2:76262492-76262514 CTGGGGTGGAGGCAGCCTGAAGG - Intergenic
934188266 2:89764510-89764532 CAGTGGGAGTGGCTGCCTGAGGG - Intergenic
934308336 2:91843444-91843466 CAGTGGGAGTGGCTGCCTGAGGG + Intergenic
934503233 2:94874603-94874625 CTCGGGGGCAGGGAGCCTGAGGG + Intronic
934661025 2:96143792-96143814 CAGTGGGGCAGGCAGGCAGAGGG + Exonic
934855570 2:97727355-97727377 CTTTTGGACTGTCAGCCTGAGGG + Intronic
935206851 2:100903732-100903754 CTGTGGGAGTGGGAGGCTGAAGG - Intronic
935627189 2:105180964-105180986 CTGTTGAGCAGGCAGCCTGTTGG + Intergenic
936087791 2:109481045-109481067 CAGAGGGACAGGCAGCCTGAGGG + Intronic
937347052 2:121132568-121132590 GTCTGGGGCTGGCTGCCTCAGGG + Intergenic
937840724 2:126521604-126521626 CTGTGTCTCTGTCAGCCTGAAGG - Intergenic
944677517 2:202046741-202046763 CTGTTGGGCTGATAGACTGATGG + Intergenic
945171181 2:206996749-206996771 CTGTGGGGCTGACAGCTGAATGG + Intergenic
945833376 2:214811022-214811044 CTGTGGGGTTGGGACCATGATGG - Intergenic
946021627 2:216644219-216644241 ATGTGGGGCTGGCAGCCAGAAGG - Intronic
946193840 2:218021849-218021871 CTGGGTGGCTGGCTGCCTGCTGG - Intergenic
946339555 2:219058971-219058993 GTGCGGGGCTAGAAGCCTGACGG - Intronic
947621394 2:231593500-231593522 TGGTGGTGCTGGCAGCCTGAGGG - Exonic
948363316 2:237437793-237437815 ATCTGGAGCTGGCAGCCTGCGGG - Intergenic
948423820 2:237875923-237875945 CTGTGGGGCTGGGCACCAGATGG - Intronic
948460986 2:238129899-238129921 CTGTTGGGCTGGGAGCCGTAGGG + Intronic
948627039 2:239275731-239275753 GGGTGTGCCTGGCAGCCTGAGGG - Intronic
948639624 2:239367075-239367097 CTGTGTGGCTGGGGGCCTGGGGG - Intronic
949035385 2:241813716-241813738 CTGTGGGGCCAGCTGCCTGCAGG + Intronic
1168949155 20:1784692-1784714 TTGTGGGGCTGGAAGGCTGAAGG + Intergenic
1169209114 20:3755795-3755817 CTGTAGGGCTGGGACCCTCAAGG - Intronic
1171293020 20:23993498-23993520 CTGGTGGGCTGGGAACCTGATGG - Intergenic
1171382339 20:24743161-24743183 CAGTGGTGGAGGCAGCCTGATGG - Intergenic
1172098749 20:32473409-32473431 CTGGGAGGCTGGCAGCACGAGGG + Intronic
1172151010 20:32790387-32790409 GTGTGGGGCTGTCAGCATTAGGG + Intronic
1172600210 20:36178035-36178057 CTGTGATGCTGACAGCCAGAAGG + Exonic
1173822934 20:46030450-46030472 CGGGGGGCCTGGGAGCCTGAGGG - Intronic
1174112282 20:48205034-48205056 CTGGGGGTCTGGCAGCAGGAGGG + Intergenic
1174285087 20:49467041-49467063 CTGTGGGCCAGGCAACCTGCTGG - Intronic
1174600981 20:51724624-51724646 CTGTGGGGCTGACATTCAGAAGG - Intronic
1175414495 20:58792825-58792847 AGATGGGGCTTGCAGCCTGATGG - Intergenic
1175919056 20:62441542-62441564 TAGAGGGGCTGGCAGCCTTAGGG + Intergenic
1175986725 20:62767827-62767849 CTGTGGGGCTGTCAGCCCTCAGG - Intergenic
1176170012 20:63692478-63692500 CTGTGGGGCAGGGGGCTTGAGGG + Intronic
1176908626 21:14535389-14535411 ATGTGGGGCTGGCAGCATGAAGG + Intronic
1178096736 21:29223270-29223292 CGCTGGGGCTGGCAGTCTGGGGG - Intronic
1178553957 21:33569720-33569742 CCATGGGACTGGAAGCCTGAGGG + Intronic
1179010399 21:37551965-37551987 TGCTGGGGCTGGCAGCCTGAAGG - Intergenic
1179972904 21:44846076-44846098 CTCTGGCCCTGGCAGCCTGGAGG + Intergenic
1181022077 22:20108798-20108820 CTGTGTGCCTGGGACCCTGAAGG - Intronic
1181041309 22:20193957-20193979 CTGCAGGCCGGGCAGCCTGAGGG + Intergenic
1181949185 22:26541851-26541873 CTGTGTGCCTGGCACCCTGCTGG + Intronic
1182230809 22:28836198-28836220 CTGTTGGGCTTTCAGCATGATGG - Intergenic
1182351619 22:29703064-29703086 CTCGGGGGCTGGCAGCATGGTGG - Intergenic
1182466706 22:30521335-30521357 AGGTGGAGCTGGCAGCCAGATGG + Intergenic
1183018141 22:35006686-35006708 GTGTGGGGCCGGCAGCCCAAGGG - Intergenic
1183277798 22:36912220-36912242 CTGTGGGACTGGGAGGCTGCGGG - Intergenic
1183429872 22:37759063-37759085 GTGTGGAGCTGGAAGCCTGCGGG + Intronic
1183464658 22:37973544-37973566 CTGTGGGACTGGGGCCCTGAGGG + Exonic
1183629750 22:39025908-39025930 CTGTGGGGAGGGCAGCCTCGGGG - Intronic
1184117652 22:42431556-42431578 CTGTGGGGTAGGTAGCCTCAGGG - Intronic
1184582695 22:45428223-45428245 GAGTGGGGCTGCCAGCCTAATGG + Intronic
1185033380 22:48457735-48457757 GTGTTGGGCTGGTTGCCTGAAGG + Intergenic
1185183772 22:49380190-49380212 CTGTGGGGCTTAGAGGCTGAAGG + Intergenic
1185233738 22:49699275-49699297 CCGTGGGGGTGGCAGACGGATGG + Intergenic
1185343532 22:50301785-50301807 CTGAGGCGCTGACAGGCTGACGG - Intronic
949562803 3:5218302-5218324 TTGTGGGGCTGGATGCCAGAAGG + Exonic
950183456 3:10930849-10930871 CTGTGGCGCTGGCTCCCTGATGG - Intronic
950296855 3:11839585-11839607 CTGTGAGGCTGGCAGCAAGATGG - Intronic
951984221 3:28600410-28600432 CTTTGGGGCTGAATGCCTGATGG + Intergenic
954293342 3:49661169-49661191 CTGTGGGGCGGAAAGCCTGCTGG - Exonic
954747267 3:52794338-52794360 CTGTGGAGGTCCCAGCCTGAAGG + Intergenic
955399307 3:58579897-58579919 CCCTGGGGCTAGCAGTCTGATGG - Intronic
955890351 3:63643997-63644019 CTGTGGGCTTGGCAGGCTGCAGG - Intergenic
963007186 3:140737393-140737415 CTCAGGGGCTTGCAGGCTGATGG + Intergenic
966624850 3:182004844-182004866 CTGTGGAGCTGGCAGGAAGAAGG - Intergenic
968284977 3:197503200-197503222 CTGTGGGGCTGAGGGCGTGAGGG - Intergenic
968628675 4:1639115-1639137 CTGTGGGGCTGGCATGGTGGTGG - Intronic
968632858 4:1661208-1661230 CTGTGAGGGTGGGAGCCTGGGGG - Intronic
968706482 4:2080651-2080673 CTCTGGGGTGGGCAGCCTCAAGG + Intronic
969057421 4:4410421-4410443 CTGTGAGGCTGGCACAATGATGG - Intronic
969232007 4:5838598-5838620 CTGTGGGACTAGCAGCTTTATGG + Intronic
969298730 4:6284964-6284986 CTGGGGGGCTGGCAGGGTGACGG + Intronic
969701241 4:8768915-8768937 CTGTGGTGCTGGTGGCCTGCAGG - Intergenic
971846438 4:31924574-31924596 CTGTGGGGTGGTCATCCTGAAGG + Intergenic
972093529 4:35318745-35318767 ATTTTGGGCTGGCAGCCTCAAGG - Intergenic
975703945 4:77093241-77093263 CTGTAGGGAAGGAAGCCTGATGG + Intergenic
981353670 4:143762056-143762078 CAGTGGCACTGGCAGCCTGGTGG + Intergenic
982296467 4:153834206-153834228 CCTTGGGGCTGGGAGCTTGAAGG + Intergenic
982514238 4:156324253-156324275 ATCTTGGGCTGGCAGCATGATGG - Intergenic
984615920 4:181897120-181897142 CTTTGGAGCTGGCAGGCTGAAGG - Intergenic
984857234 4:184205683-184205705 TTGTGGGGCAGGCAGCGAGAGGG + Intronic
985100482 4:186453257-186453279 CTGTGGGGCTAGAAGCAAGATGG + Intronic
985537154 5:472088-472110 CTGTGGGACTTGCCGTCTGAGGG + Intronic
985640794 5:1062681-1062703 CTGGGGGGCTGGGGGACTGAGGG + Intronic
985720991 5:1489006-1489028 CTGCGGGGCTGGGAGTTTGAGGG - Intronic
986282531 5:6335351-6335373 ATGTGGTGCTGGCAGCTTGGTGG - Intergenic
988503164 5:31799961-31799983 CTGTGAGTCTGGGAGCCTCACGG - Intronic
989460746 5:41696055-41696077 CTGTGGGGCTGGGAGGGTGGTGG + Intergenic
989949374 5:50279672-50279694 CTGTGGGGCTGGCAGAACAAAGG - Intergenic
990313307 5:54560851-54560873 TTGTAGGGCTGGAAGCCTGAAGG - Intergenic
991547276 5:67796354-67796376 CAGTGTGGCTGAAAGCCTGAAGG - Intergenic
993941367 5:94062930-94062952 CTGTGGGGCTGCCATGCTTAGGG - Intronic
994768830 5:103955720-103955742 TTGTTGGTCTGGCAGCTTGAGGG - Intergenic
995297871 5:110541008-110541030 CTGTTGGGATTGCACCCTGAAGG - Intronic
996615580 5:125437172-125437194 CTGTAGGGGGGGAAGCCTGAGGG - Intergenic
997196026 5:131980638-131980660 CTGTGGGGCTGGGAGGCTGAGGG - Intronic
997471032 5:134116933-134116955 AGGTGGGGCTGGCAGGCTGGAGG + Intronic
997623014 5:135312150-135312172 CTGAGTGGGTGGCAGCCTGATGG + Intronic
998428394 5:142049231-142049253 CTGTGGAGCCAGCAGCCTAATGG + Intergenic
999544024 5:152606976-152606998 ATGTGGCCCTGGCTGCCTGAAGG + Intergenic
1001137179 5:169112281-169112303 GTGAGGGGCTCTCAGCCTGAAGG + Intronic
1001281929 5:170392234-170392256 CTGGGAGGCTGGCAGGCTGGGGG - Intronic
1001293048 5:170478470-170478492 TTGTGAGGATGGCAGCCCGAGGG - Intronic
1001327648 5:170740968-170740990 CGGTGGGGCTGGCTGCCTCTCGG - Intergenic
1001442068 5:171750762-171750784 CTGGAGGGCTGGGCGCCTGAAGG - Intergenic
1001577544 5:172773945-172773967 TTGTGGGCCTGGCTGCCAGAGGG + Intergenic
1001926447 5:175640529-175640551 CTGGGGGGCAGGGAGCCTGCTGG + Intergenic
1002050255 5:176566570-176566592 CTGCAGGGAGGGCAGCCTGATGG - Intronic
1005847607 6:29793346-29793368 CTGTGTGGCTGGCAGCCCCTGGG - Intergenic
1006358528 6:33574518-33574540 CTGCTGGCCTGGCAGCCCGAGGG + Intronic
1007364146 6:41378693-41378715 ATGAGGAGCTTGCAGCCTGAGGG - Intergenic
1008537436 6:52517619-52517641 CTGCGGGGCTGTGAGCCTGGTGG + Intronic
1011624743 6:89273648-89273670 CTGAGGGCCTTGCAACCTGAAGG + Intronic
1013996500 6:116314998-116315020 CTCTGGGGCTGGAAGACAGATGG - Intronic
1014899580 6:126946469-126946491 CTGTCTTTCTGGCAGCCTGAGGG - Intergenic
1015436807 6:133199290-133199312 CTCTGGCGCTGGCAGCATCAGGG + Intergenic
1016713969 6:147203639-147203661 CTGGGGGGCTGGGGGCCTGCTGG + Intergenic
1018799414 6:167210656-167210678 CTGTGTGGCCGGCCGCCTGGGGG - Intergenic
1018919735 6:168163249-168163271 CTGAGGGGCTCGCTGGCTGACGG + Intergenic
1019158353 6:170053429-170053451 CAGTGGGGCCGGCTGCCTGTGGG + Intergenic
1019792961 7:3029298-3029320 CTGGGCAGGTGGCAGCCTGAAGG - Intronic
1019869942 7:3751130-3751152 CTGTGTGGCTACCAGCCTGAGGG + Intronic
1020005808 7:4783367-4783389 CTGGAGAGCCGGCAGCCTGAGGG + Exonic
1022633026 7:32103426-32103448 CCGTGATGCTGGCAGCCAGACGG + Intronic
1022701231 7:32762168-32762190 CAGTGGGGCTGGGAGCGTGTGGG - Intergenic
1022862529 7:34382974-34382996 CTGTGGGGGTGGGACCCTCATGG + Intergenic
1022936798 7:35186453-35186475 CAGTGGGGCTGGGAGCGTGTTGG - Intergenic
1023265847 7:38404414-38404436 CTGTGGGGCTGGGAGTGTGGAGG - Intronic
1023871298 7:44264347-44264369 GTGTGGTGGTGGCAGCCTGGGGG + Intronic
1023873718 7:44276030-44276052 CTGGGTGGCTTCCAGCCTGAGGG - Intronic
1023965535 7:44961619-44961641 CTGAGGGGCTGAGGGCCTGAGGG + Intergenic
1023965612 7:44961881-44961903 CTGAGGGGCTGAGAGGCTGAAGG + Intergenic
1026977123 7:74505658-74505680 CTGGGAGGCTGGCAGCCCTAAGG + Intronic
1026991572 7:74588965-74588987 CTGAGGGGCTCCCAGCCAGAGGG - Intronic
1027260643 7:76462127-76462149 CTGAGGGGCTCGCAGGCGGAGGG + Intronic
1027312022 7:76960240-76960262 CTGAGGGGCTCGCAGGCGGAGGG + Intergenic
1027363498 7:77433173-77433195 GTGCGGGGCGGGGAGCCTGACGG + Intergenic
1028373320 7:90119134-90119156 CAGTGGGGCTGGGAGCGTGTCGG + Intergenic
1028482409 7:91322011-91322033 CTGTGTGTCTCCCAGCCTGAAGG + Intergenic
1029663086 7:101976524-101976546 TTGTAGAGGTGGCAGCCTGAGGG + Intronic
1029833031 7:103280553-103280575 CAGTGGGGCTGGGAGCCTGTCGG - Intergenic
1031660130 7:124413559-124413581 CTGTGTTGCTGGCAGCCACAGGG + Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1035909207 8:3547113-3547135 CTGTGTGAATGGCAGCATGAGGG - Intronic
1036199379 8:6754600-6754622 CTGTGGAGCTCGCAGTCTGGTGG + Intronic
1036646002 8:10611718-10611740 ATCTGGGGCTGCCAGCCTGGGGG - Exonic
1036946692 8:13100799-13100821 CACTGGGGCTGGCAGCCAGCAGG + Intronic
1037108888 8:15142515-15142537 CTGTGAGTCTTGCAGGCTGAGGG - Intronic
1037162568 8:15790860-15790882 CTGTGGGGTTCGTATCCTGAAGG + Intergenic
1037373526 8:18205277-18205299 CTGTGGGGGTGGGAGCTTGGTGG + Intronic
1037508946 8:19562115-19562137 CTGTGGGGGTGGCAGGATGGTGG - Intronic
1038540365 8:28385901-28385923 CTGTCGGGCCGGCGGCCTGGGGG - Intronic
1039512809 8:38105340-38105362 CCGCGGGCCTGGCAGGCTGAAGG - Exonic
1043592615 8:81847904-81847926 CTGTTGGGATTGCACCCTGAGGG - Intergenic
1044306462 8:90645924-90645946 CGGAGGGGCTGGCCGGCTGAGGG - Exonic
1044418190 8:91960316-91960338 CAGCGGGGCTGGGAGCCCGATGG - Exonic
1044538499 8:93384285-93384307 CTGTGGGGCTTGGAGTCTAAAGG - Intergenic
1047730882 8:127727127-127727149 ATGGCAGGCTGGCAGCCTGAGGG + Intergenic
1048378644 8:133844841-133844863 CTTTGGGGATGACAGCCTCAAGG - Intergenic
1049204117 8:141355447-141355469 CTGTGTGGCTGGGAGCAGGAGGG - Intergenic
1049229102 8:141472955-141472977 CTGTGGGGCGGGCAGGGTCAGGG + Intergenic
1049249687 8:141581719-141581741 CTCTGGGCCTGGCACCCAGACGG - Intergenic
1049261366 8:141640910-141640932 CTGGGGGGCTGCCAGTCAGATGG - Intergenic
1049409441 8:142465892-142465914 CTGTGGGGCTGCCAGCCTCTGGG + Intronic
1049441365 8:142611271-142611293 CTGTGGGGCTGGCAGGGTGTGGG + Exonic
1049585718 8:143431489-143431511 CTGAGGGGCTGCCAGCCCGTGGG - Intergenic
1049658377 8:143808817-143808839 CTGCAGGGCATGCAGCCTGATGG - Exonic
1050726914 9:8660567-8660589 CTGAGGGGCTGGGAGCCAGCTGG - Intronic
1050772278 9:9217136-9217158 CTGTAGGGCTGGCAGTTTAAAGG + Intronic
1052707556 9:32011120-32011142 CTGTGGGACTGGCAGCCAGCTGG - Intergenic
1053344048 9:37364946-37364968 CTGTGTGGCTGTTAGACTGAGGG - Intergenic
1053398674 9:37799222-37799244 CTTTTGGTCTGGCAGCCTCATGG + Intronic
1057217400 9:93236692-93236714 GGGTGCGGGTGGCAGCCTGAGGG - Intronic
1057400823 9:94721458-94721480 CTGTGAGGCTGGAAGCAAGATGG + Intergenic
1057526526 9:95808007-95808029 CTGTTGGGCTGGGAGCTGGAGGG - Intergenic
1057602724 9:96472548-96472570 CGGGGGGGATGGCAGCCCGATGG - Intronic
1060473972 9:123971333-123971355 CTGTGCAGCTGGCAGCAAGAGGG - Intergenic
1061008888 9:127943759-127943781 CTGAGGGGCTGGCTTCCTTATGG - Intronic
1061415670 9:130445582-130445604 CGGTGGGGCTGGCGGCCTCGCGG + Intronic
1061596087 9:131630139-131630161 CGGTGGGGTGGGCAGCATGAGGG - Intronic
1062055435 9:134467465-134467487 CTCTGGGGCGTGCAGCCTCAGGG + Intergenic
1062081357 9:134625465-134625487 CTGTGAGGCTGGAAGCTTGCGGG - Intergenic
1062086931 9:134653840-134653862 CTGTAGGGCTGGGAGTCTGTAGG + Intronic
1062221264 9:135416957-135416979 CTGAGGGGCTGTTAGCCTGGTGG - Intergenic
1062480292 9:136747901-136747923 CTGTAGGGCTGGAAGGCTGGAGG - Intronic
1062528360 9:136987813-136987835 GTGAGGGGCTGGCAGCAGGACGG - Intergenic
1062532755 9:137009109-137009131 CTGTAGGGCTGGGAGGCTGGGGG - Intronic
1062564401 9:137157505-137157527 CTGTGTGGCTGGCAGCCTTTGGG + Intronic
1185648664 X:1632857-1632879 CTGGGGGGCTGGGAGGCTGGGGG + Intronic
1189444382 X:41067148-41067170 CTGTGGGAGTGGCAGCTTGCAGG + Intergenic
1190056093 X:47181820-47181842 CAGTGGGGCTGGTAGCCGGTGGG - Exonic
1190781059 X:53595293-53595315 TAGTGGTGCTGGCAGCATGATGG + Exonic
1190881752 X:54496350-54496372 CTGTGGGGAAAGCAGGCTGAGGG - Intergenic
1193036032 X:76952130-76952152 CTGTTGGGCTGTTAGTCTGATGG - Intergenic
1195706739 X:107742918-107742940 CTGTGGGGCTGGCAGCCTGTGGG - Intronic
1196744159 X:119054391-119054413 CTTTGGCGTTGGCATCCTGAGGG - Intergenic
1197225175 X:123949786-123949808 CTGTGTGGCTGGCTGGCAGAAGG + Intergenic
1197794583 X:130285653-130285675 CTGTTGGGATTGCACCCTGAGGG - Intergenic
1198275679 X:135095785-135095807 CTGGGGGCCTGTCAGCCTGCTGG - Intergenic
1198310838 X:135424948-135424970 CTGGGGGTCTGTCAGCCTGCTGG + Intergenic
1199272224 X:145898065-145898087 CTGTGGGGCTGGGAGTGTGGAGG + Intergenic
1200055221 X:153456701-153456723 CTGTGGGGCTGAGGGCCTGCTGG - Intronic
1200064899 X:153499648-153499670 CTGTGGGAGTGGCTGCCTGAGGG - Intronic
1200111553 X:153743375-153743397 CGGTGGGAGTGGCTGCCTGAGGG + Intronic