ID: 917968836

View in Genome Browser
Species Human (GRCh38)
Location 1:180194706-180194728
Sequence CTGCTAGGGCAGAGGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 393}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917968823_917968836 16 Left 917968823 1:180194667-180194689 CCCCTGCTCCGTCTTCTGGCTGT 0: 1
1: 0
2: 0
3: 12
4: 262
Right 917968836 1:180194706-180194728 CTGCTAGGGCAGAGGGAGCTGGG 0: 1
1: 0
2: 3
3: 43
4: 393
917968822_917968836 19 Left 917968822 1:180194664-180194686 CCTCCCCTGCTCCGTCTTCTGGC 0: 1
1: 0
2: 0
3: 37
4: 358
Right 917968836 1:180194706-180194728 CTGCTAGGGCAGAGGGAGCTGGG 0: 1
1: 0
2: 3
3: 43
4: 393
917968825_917968836 14 Left 917968825 1:180194669-180194691 CCTGCTCCGTCTTCTGGCTGTTG 0: 1
1: 0
2: 0
3: 16
4: 164
Right 917968836 1:180194706-180194728 CTGCTAGGGCAGAGGGAGCTGGG 0: 1
1: 0
2: 3
3: 43
4: 393
917968817_917968836 29 Left 917968817 1:180194654-180194676 CCCTCTCCCGCCTCCCCTGCTCC 0: 1
1: 1
2: 14
3: 265
4: 2357
Right 917968836 1:180194706-180194728 CTGCTAGGGCAGAGGGAGCTGGG 0: 1
1: 0
2: 3
3: 43
4: 393
917968824_917968836 15 Left 917968824 1:180194668-180194690 CCCTGCTCCGTCTTCTGGCTGTT 0: 1
1: 0
2: 1
3: 12
4: 200
Right 917968836 1:180194706-180194728 CTGCTAGGGCAGAGGGAGCTGGG 0: 1
1: 0
2: 3
3: 43
4: 393
917968830_917968836 -10 Left 917968830 1:180194693-180194715 CCCCTTACTCAAACTGCTAGGGC 0: 1
1: 0
2: 0
3: 6
4: 78
Right 917968836 1:180194706-180194728 CTGCTAGGGCAGAGGGAGCTGGG 0: 1
1: 0
2: 3
3: 43
4: 393
917968827_917968836 8 Left 917968827 1:180194675-180194697 CCGTCTTCTGGCTGTTGGCCCCT 0: 1
1: 0
2: 1
3: 20
4: 261
Right 917968836 1:180194706-180194728 CTGCTAGGGCAGAGGGAGCTGGG 0: 1
1: 0
2: 3
3: 43
4: 393
917968818_917968836 28 Left 917968818 1:180194655-180194677 CCTCTCCCGCCTCCCCTGCTCCG 0: 1
1: 0
2: 5
3: 151
4: 1476
Right 917968836 1:180194706-180194728 CTGCTAGGGCAGAGGGAGCTGGG 0: 1
1: 0
2: 3
3: 43
4: 393
917968819_917968836 23 Left 917968819 1:180194660-180194682 CCCGCCTCCCCTGCTCCGTCTTC 0: 1
1: 1
2: 2
3: 75
4: 821
Right 917968836 1:180194706-180194728 CTGCTAGGGCAGAGGGAGCTGGG 0: 1
1: 0
2: 3
3: 43
4: 393
917968820_917968836 22 Left 917968820 1:180194661-180194683 CCGCCTCCCCTGCTCCGTCTTCT 0: 1
1: 0
2: 8
3: 160
4: 1495
Right 917968836 1:180194706-180194728 CTGCTAGGGCAGAGGGAGCTGGG 0: 1
1: 0
2: 3
3: 43
4: 393

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917968836 Original CRISPR CTGCTAGGGCAGAGGGAGCT GGG Intronic
900322935 1:2093938-2093960 GGGCCAGGGCAGAGGGAGCCAGG + Intronic
900495306 1:2973414-2973436 GTGCTGGGGCAGAGGGAGGAGGG + Intergenic
900607628 1:3530958-3530980 CTGCTAGGCTGGAGGGAGCAGGG - Intronic
900831222 1:4967131-4967153 CAGCTGGAGCAGAGGGAGCAGGG - Intergenic
901612294 1:10508564-10508586 CTTCTGGGGGGGAGGGAGCTGGG - Intronic
901666774 1:10830631-10830653 CTCCTGGGGCAGGGGGCGCTGGG + Intergenic
902232389 1:15036279-15036301 CGGGCAGGGCAGAGGGAGCTGGG - Intronic
902404768 1:16176585-16176607 ATGCAGGGGCAGTGGGAGCTTGG - Intergenic
903004700 1:20290947-20290969 CTGCCAGGGCAGCGGGCGCAGGG + Exonic
903275637 1:22219573-22219595 CGGCCAGGGCAGAAGGACCTTGG - Intergenic
903464944 1:23545445-23545467 CTGCTGGGACAGAGGGAGTTGGG + Intergenic
903547693 1:24136996-24137018 CTGCAAGGGGAGGGGCAGCTGGG - Intronic
903976059 1:27150996-27151018 CTGAGAGTGCAGAGGGAGCATGG + Intronic
904648599 1:31987363-31987385 CTGGTAGGGCAGAGTGAGGAGGG - Intergenic
904756483 1:32771222-32771244 CGGCTAGAGCAGGGGCAGCTGGG - Exonic
904819418 1:33231811-33231833 TTAGTAGGGCTGAGGGAGCTGGG - Intergenic
905870923 1:41404289-41404311 CTGGTTGGGCAGGGGGAGTTCGG - Intergenic
906522917 1:46477816-46477838 CTGCAAGGGATGAGTGAGCTTGG + Intergenic
907038292 1:51236182-51236204 CTGCTAGTGGAGAGGGGGATGGG + Intergenic
907045523 1:51297959-51297981 CCGTTAGGGCAGAGGGAGCTGGG - Intronic
907309412 1:53530730-53530752 CTGTGAGGGCTGAGGGAGGTTGG - Intronic
909543127 1:76813172-76813194 ATGATAAGGCAAAGGGAGCTGGG + Intergenic
912727353 1:112069837-112069859 GTCCTAGGGCAGAGGGAGAGTGG - Intergenic
913938406 1:125079041-125079063 CTCTTAGGGCATAGGGAGGTTGG - Intergenic
914350532 1:146835973-146835995 CTGCTGCAGGAGAGGGAGCTGGG - Intergenic
915841338 1:159215887-159215909 TTTCTGGGGCAGAGGGAGCCTGG - Intergenic
916090613 1:161305638-161305660 CTGCCAGAGCAGGGGGACCTAGG - Exonic
916757147 1:167783167-167783189 CTCTTAGGGCAGAGGAAGGTAGG + Intronic
916986997 1:170202328-170202350 TTGAAAAGGCAGAGGGAGCTTGG - Intergenic
917968836 1:180194706-180194728 CTGCTAGGGCAGAGGGAGCTGGG + Intronic
920502266 1:206492884-206492906 CTGGCAGGGCAGAGGCAGCGAGG + Exonic
921588960 1:216981118-216981140 CAGCAAGGGCAGAGGTAGCATGG - Intronic
922479739 1:225931237-225931259 CTACTTGGGGAGAGGGAGGTGGG + Intergenic
922611278 1:226930663-226930685 TTGCCTGGGGAGAGGGAGCTGGG + Intronic
922764920 1:228151720-228151742 CTGCTGGGGCAGAGTGGGCATGG + Intronic
924858333 1:247896499-247896521 CTTCTGGGGAAGAGAGAGCTAGG + Exonic
1062964012 10:1593382-1593404 TGGCTAGGGCAAGGGGAGCTGGG - Intronic
1065625461 10:27624863-27624885 CTGCTTGGGCAGGGGCTGCTGGG + Intergenic
1066451428 10:35533537-35533559 CACCTGGGACAGAGGGAGCTGGG - Intronic
1066656828 10:37704677-37704699 CTGCCAGGGCAGAGTGAGTTGGG + Intergenic
1066754502 10:38697170-38697192 CTACTAAGGGAGAGGGAGGTAGG + Intergenic
1066950034 10:42108517-42108539 CTCTTAGGGCATAGGGAGGTTGG - Intergenic
1067047359 10:42992096-42992118 CTGCTAGTGCAGAGGAAGTGAGG - Intergenic
1069528549 10:69196586-69196608 CTGCTCGGGGATAAGGAGCTTGG + Intronic
1069695416 10:70382251-70382273 GTGCCAGGGAATAGGGAGCTCGG - Intronic
1070793335 10:79202738-79202760 CAGCCTGGGCAGTGGGAGCTGGG - Intronic
1070804919 10:79265281-79265303 CAGGTAGGGCAGGGTGAGCTGGG + Intronic
1073349987 10:102812830-102812852 CTGGTAGGTCAGAGGGATCAGGG - Exonic
1074338161 10:112599223-112599245 CTGCAAGGCCAGAGTGAGGTAGG + Intronic
1074927500 10:118088164-118088186 ATGCAAAGTCAGAGGGAGCTGGG - Intergenic
1075602558 10:123781136-123781158 CAGCTAAGCCAGTGGGAGCTGGG + Intronic
1075746330 10:124730434-124730456 CTGCTGTGGCAGAGGGAACCTGG - Intronic
1075798299 10:125136206-125136228 CTCCTAGGGGAGGGTGAGCTGGG + Intronic
1076140830 10:128077543-128077565 CTGAGAGGGCAGATGGGGCTGGG + Intronic
1077368595 11:2171287-2171309 CAGCTGGGGCAGAGGGAGGCAGG + Intronic
1077628984 11:3797928-3797950 CGACTCGGGCTGAGGGAGCTCGG + Intronic
1077767740 11:5179402-5179424 TTGCAATGGCAGACGGAGCTGGG + Intronic
1078835512 11:15025743-15025765 CAGCTGTGGCAGAGGGAGCAGGG - Intronic
1079131091 11:17747362-17747384 CTGCCAGGGGAGAGGGAGGGAGG + Intronic
1079624927 11:22605690-22605712 TAGCTAGGGCAGAGGGAGTTGGG + Intergenic
1083592234 11:63902581-63902603 CTGCTGGGCCAGAGGGAGGATGG - Exonic
1083891559 11:65598250-65598272 CTCCTAAGGCAGCTGGAGCTCGG + Exonic
1084362586 11:68678358-68678380 GTGCTAGGGGAGCGGGTGCTTGG + Intergenic
1085127227 11:74010225-74010247 CTGCTGGAGCCAAGGGAGCTGGG + Intergenic
1085333141 11:75669193-75669215 CTGCCAGGGCGGAGGGTGGTGGG - Intergenic
1085449463 11:76623235-76623257 AGCCTGGGGCAGAGGGAGCTGGG - Intergenic
1085505372 11:77055928-77055950 CTGCTGGGGTAGCGGGATCTGGG + Intergenic
1085695954 11:78704960-78704982 CTGCAGGGACAGAGGGAGCTGGG - Intronic
1085743048 11:79093288-79093310 CTGGACTGGCAGAGGGAGCTTGG + Intronic
1085745217 11:79109335-79109357 CTGTGAGGGCAGAGGCAGCCAGG + Intronic
1085755737 11:79199924-79199946 CTGCAAGGGCAGAGAATGCTGGG - Intronic
1086919600 11:92571317-92571339 ATGCTGGGGCACAGGCAGCTAGG + Intronic
1086941873 11:92806790-92806812 TTGCTAGGGGAGAGGGAAGTTGG + Intronic
1089757271 11:120696030-120696052 CTGCTAGAGGAGGGAGAGCTGGG - Intronic
1089977913 11:122748436-122748458 CTCCGAGTGCACAGGGAGCTGGG - Intronic
1090213701 11:124941726-124941748 CTCCTAGGGGATAGGGAGCTGGG + Intergenic
1090398122 11:126432450-126432472 ATGCTGGGGCAGGGAGAGCTTGG + Intronic
1090803927 11:130190712-130190734 CGGGTAGGGCTGTGGGAGCTTGG + Intronic
1091187761 11:133661890-133661912 CTGCCACAGCAGAGGGAGCGGGG + Intergenic
1091896899 12:4112486-4112508 CTGCTTTGACAGAGGGAGCCAGG - Intergenic
1092158052 12:6297363-6297385 CTGCTATGGAAGCAGGAGCTTGG + Intergenic
1093668046 12:21838122-21838144 GTGACAGAGCAGAGGGAGCTGGG + Exonic
1094331839 12:29302449-29302471 CTGGCAGGGCAGCTGGAGCTGGG + Intronic
1096181530 12:49553768-49553790 CTTGTAGAGCAGAGGCAGCTAGG + Intronic
1096221100 12:49828475-49828497 CTGCTAGGGAGGAGGGAGGCGGG - Intronic
1096226498 12:49869748-49869770 CTCCCAGGGAAGTGGGAGCTGGG - Exonic
1096405221 12:51339168-51339190 CTGATAGGTAAGAGGGAGCAGGG + Intronic
1096535964 12:52274881-52274903 CTTCTAGGGCAGATGGAGTGTGG - Intronic
1096617925 12:52844757-52844779 CTTCAAGGGGAGAAGGAGCTGGG - Intronic
1096984267 12:55745796-55745818 CTGAGAGGGTAGAGGGAACTAGG - Intronic
1097406077 12:59191999-59192021 TTGGTAAGGCTGAGGGAGCTAGG + Intergenic
1100003260 12:89862883-89862905 CTGCTAGGGCACATGAAGTTAGG - Intergenic
1100877353 12:98975838-98975860 GTGGTTGGGCAGAGGGAGCAGGG + Intronic
1102921127 12:116792461-116792483 CTGCTAGGGCCGAGGAGGCGGGG + Intronic
1104592025 12:130092437-130092459 GTGCTATGGAAGAGGGAGCCAGG + Intergenic
1104664066 12:130635041-130635063 CCCCTGGGGCAGGGGGAGCTGGG - Intronic
1104745141 12:131205733-131205755 CTGCAATGTCAGAGGGACCTGGG - Intergenic
1104997488 12:132667688-132667710 CTCCCAGAGCAGAGGGAGCCAGG + Intronic
1105233880 13:18527288-18527310 CTCTTAGGGCATAGGGAGGTTGG + Intergenic
1106029904 13:25990568-25990590 CAGCTGGGGCAGAGGGAGGGAGG + Intronic
1107651066 13:42545709-42545731 ATGCTAGGGCTGAGTGAGCCAGG + Intergenic
1108727962 13:53201857-53201879 ATCCCAGGGCAGAGGCAGCTGGG - Intergenic
1109391972 13:61705505-61705527 CTGATGGTGCAGATGGAGCTGGG - Intergenic
1111008451 13:82281114-82281136 CTGCTAAGCCAGATGGACCTTGG + Intergenic
1111909625 13:94296080-94296102 GTGCTAGGGCAGAGGGAAGAGGG + Intronic
1112695718 13:101945706-101945728 CTGCTAATGCAGTGGGAGGTAGG - Intronic
1113259860 13:108549780-108549802 CTTCTAGTGCAGGAGGAGCTGGG - Intergenic
1114482444 14:23044197-23044219 CTTCTAGGGGAGTGGGAGCAGGG - Exonic
1121964981 14:98295681-98295703 CAGCTAGGGATGAGGGTGCTGGG - Intergenic
1122804470 14:104249671-104249693 CTGGTGGGACAGAAGGAGCTAGG + Intergenic
1122859644 14:104576806-104576828 CCCCTACGGCAGAGGGAGCTGGG + Intronic
1124609845 15:31200952-31200974 CTGCTGGGGAAGAAGGAGCCTGG + Intergenic
1125675275 15:41498875-41498897 CTGCTGGGGCAGTTGGAACTTGG + Intronic
1126563736 15:50073232-50073254 CTGTCAGGGCCTAGGGAGCTAGG - Intronic
1128294069 15:66502630-66502652 CTGGTAGGGCTGAGGCAGCCAGG + Exonic
1128741807 15:70088978-70089000 CTGCAAGGGCAGAGGGGCCTTGG + Intronic
1129149979 15:73682559-73682581 GTCCTTGGGCTGAGGGAGCTAGG - Intergenic
1129170578 15:73805061-73805083 CTGCAAGGGGAGAGGGAGGCAGG + Intergenic
1129273624 15:74432269-74432291 CTGGGAGGGCAAAGGAAGCTTGG + Intronic
1129519741 15:76178142-76178164 CTGCTGGGACAGAGGAAGCCTGG + Intronic
1129686226 15:77687540-77687562 CTGCTAGGGCAGAGGGAATCTGG - Intronic
1130275397 15:82473553-82473575 GAGCTAGGACAGAGGGAGCCTGG + Intergenic
1130467757 15:84200948-84200970 GAGCTAGGACAGAGGGAGCCTGG + Intergenic
1130496508 15:84472594-84472616 GAGCTAGGACAGAGGGAGCCTGG - Intergenic
1130581728 15:85143321-85143343 CAGCTAGGGCCAAGGCAGCTAGG + Intergenic
1130590049 15:85205546-85205568 GAGCTAGGACAGAGGGAGCCTGG + Intergenic
1132669237 16:1095919-1095941 CTCCTCCGGCAGAGGGAGCCTGG + Intronic
1133000633 16:2849793-2849815 CTGGTGGGGCAGAGGTAGCGAGG + Intergenic
1133456962 16:5950852-5950874 GTGCCAGGAGAGAGGGAGCTAGG + Intergenic
1133838016 16:9383726-9383748 GTGCTAGGACAGAGAGAGATGGG - Intergenic
1134797356 16:17053789-17053811 CTGCCATGGCAAAGGGAGGTGGG + Intergenic
1136114643 16:28087175-28087197 CTGGAAGGGCAGCAGGAGCTGGG + Intergenic
1136728183 16:32379677-32379699 CTGCTAAGGGAGAGGGAGGTAGG - Intergenic
1136935429 16:34459021-34459043 CTCTTAGGGCATAGGGAGGTTGG - Intergenic
1136938264 16:34496656-34496678 CTCTTAGGGCATAGGGAGGTTGG - Intergenic
1136949108 16:34693482-34693504 CTCTTAGGGCATAGGGAGGTTGG + Intergenic
1136961554 16:34851901-34851923 CTCTTAGGGCATAGGGAGGTTGG + Intergenic
1136964389 16:34889549-34889571 CTCTTAGGGCATAGGGAGGTTGG + Intergenic
1137093527 16:36224015-36224037 CTCTTAGGGCATAGGGAGGTTGG + Intergenic
1137218508 16:46424561-46424583 CTCTTAGGGCATAGGGAGGTTGG - Intergenic
1137290906 16:47051314-47051336 CTAGCAGGGCAGAAGGAGCTGGG - Intergenic
1138294825 16:55877133-55877155 GTGGGAGGGCAGAGGGAGCTTGG - Intronic
1139983506 16:70879566-70879588 CTGCTGCAGGAGAGGGAGCTGGG + Intronic
1140726805 16:77820915-77820937 CTGCTAGGGCAGGGACTGCTGGG - Intronic
1141029245 16:80573472-80573494 CTGCTGGGGGAGAGCCAGCTGGG + Intergenic
1141989988 16:87603859-87603881 CAGCAAGGGCAGAGGGGGCTGGG + Intronic
1142188277 16:88705216-88705238 CTCCTGGTACAGAGGGAGCTGGG - Intronic
1202998256 16_KI270728v1_random:138077-138099 CTGCTAAGGGAGAGGGAGGTAGG + Intergenic
1142718656 17:1762284-1762306 GAGAGAGGGCAGAGGGAGCTGGG + Intronic
1144838836 17:18173157-18173179 CTCCTGGGGGTGAGGGAGCTGGG + Intronic
1145814902 17:27788682-27788704 CTGCTTGGGCAAAGGGGTCTAGG - Intronic
1146616176 17:34359013-34359035 TTGGTAGGGAAGAGGGTGCTTGG + Intergenic
1147324029 17:39661914-39661936 CTGCTATGGCAGAGTAGGCTGGG - Intronic
1148442593 17:47719491-47719513 GTGCTAGGGCAGAGTGCTCTGGG + Intergenic
1148553727 17:48565402-48565424 CTGCTAGGGAGCAGGGAGCCTGG + Intronic
1148719166 17:49738487-49738509 CTGCCAGGGGAGAGGGAGTCAGG - Intronic
1148795541 17:50194996-50195018 CTCCTAGGGCAGGGTGGGCTGGG + Intronic
1148872207 17:50665155-50665177 CAGCCAGGACAGAGGGACCTAGG - Exonic
1148887872 17:50786677-50786699 CAGCGGGAGCAGAGGGAGCTGGG + Intergenic
1149551602 17:57544512-57544534 CTGCCAGGGCAGTAGCAGCTGGG + Intronic
1150058979 17:62047548-62047570 CTGTTAGGGGATAGGGAGCATGG + Intronic
1150069415 17:62138936-62138958 CTGCCAGTGCAGATGGAGCTGGG - Intergenic
1150344163 17:64391250-64391272 CTGCTGGGGCAGGCTGAGCTTGG + Intronic
1151965721 17:77430216-77430238 CGGCTCGGGCAGAGAAAGCTGGG - Intronic
1152157043 17:78641311-78641333 CTGGTTGACCAGAGGGAGCTTGG - Intergenic
1152473379 17:80502783-80502805 CTGGAAGGGCAGAGCGTGCTGGG + Intergenic
1152811644 17:82385435-82385457 CGGGGAGGGCAGAGGGGGCTGGG - Intergenic
1203184093 17_KI270729v1_random:95565-95587 CTTTTAGGGCATAGGGAGGTTGG + Intergenic
1153660688 18:7323259-7323281 CTTCCAGGGGAGAGGGAGCTGGG - Intergenic
1153953530 18:10076718-10076740 CTGTTGGCACAGAGGGAGCTTGG - Intergenic
1154515662 18:15162587-15162609 CTCTTAGGGCATAGGGAGGTTGG - Intergenic
1154937217 18:21073348-21073370 CTGATATGGCAGGGGGAGCAGGG + Intronic
1155410707 18:25541767-25541789 ATCCTTGGGCAGATGGAGCTAGG + Intergenic
1155691704 18:28632753-28632775 TGGCTAGGGCAGAAGGAGCATGG + Intergenic
1156090759 18:33466119-33466141 CTACTGTGGCACAGGGAGCTGGG + Intergenic
1156473259 18:37390566-37390588 GTGCTAGGGTGGAGGGGGCTTGG + Intronic
1157606012 18:48926388-48926410 TTGCTAGGGTACCGGGAGCTGGG + Intronic
1157856582 18:51110319-51110341 CTTGTGGGGCGGAGGGAGCTGGG + Intergenic
1158068263 18:53439460-53439482 CAGCAAGTGTAGAGGGAGCTAGG - Intronic
1158315834 18:56210440-56210462 ACTCTAGGGGAGAGGGAGCTTGG + Intergenic
1158545028 18:58388911-58388933 CTGCTATGGCAGGTGGAGCCTGG + Intronic
1159020480 18:63138990-63139012 GGGCCAGGGCAGAGGAAGCTTGG + Intronic
1160106963 18:75987347-75987369 CTTCTAGGGCAGAGACAGATAGG - Intergenic
1160727112 19:622273-622295 CTGCCAGTGCAGATGGAGCTGGG - Exonic
1161013864 19:1973565-1973587 CAGCCAGGGCTGAGGGACCTGGG - Intronic
1161026956 19:2041321-2041343 CGCCTGGGGCAGAGGGGGCTGGG + Intronic
1161118540 19:2512698-2512720 CTGCCAGGGCAGAGGGAGGAGGG - Exonic
1161296509 19:3523100-3523122 TGGCCAGGGCAGAGGCAGCTGGG - Intronic
1161859088 19:6784340-6784362 CAGCTGGGGATGAGGGAGCTGGG + Intronic
1162141804 19:8589696-8589718 CAGCTTGGGCAGAGGGAGTGGGG + Intronic
1162771036 19:12949415-12949437 TCCCAAGGGCAGAGGGAGCTAGG + Intronic
1162863575 19:13526679-13526701 ATGCTAGTGGTGAGGGAGCTGGG - Intronic
1162909454 19:13841498-13841520 CTGCAAGGGCAGAGGGCCATGGG + Intergenic
1162996626 19:14339913-14339935 CACCTAGGGGCGAGGGAGCTGGG - Intergenic
1163122113 19:15224162-15224184 TTGCTAAGGCAGAGTGAGCGAGG - Intergenic
1163185481 19:15636154-15636176 CTGCTTGAGGAGAGGCAGCTTGG - Intronic
1163229345 19:15989727-15989749 CTGCTAGGACAGAAAGACCTGGG - Intergenic
1163430996 19:17267565-17267587 CTCTTGGGGCAAAGGGAGCTGGG - Intronic
1164061463 19:21679173-21679195 CTACTAGAGCAGAGGGAGGCTGG + Intergenic
1164151514 19:22556966-22556988 CAGCTGGAGCAGAGGGAGCTAGG - Intergenic
1165095424 19:33407333-33407355 CAGCTAGGGCAGGGGGCGCATGG - Intronic
1166347775 19:42177037-42177059 CTGCGAGGGGAGAGGGAGGAAGG + Intronic
1166729256 19:45049310-45049332 GTCCCAGGGCAGAGGGAGCTGGG + Intronic
1167055769 19:47111250-47111272 CTGCTCGAGCAGAAGGAGTTGGG - Intronic
1167112101 19:47468612-47468634 CTGAAAGGGCAGAGAGAGCAAGG - Intronic
1167264804 19:48478203-48478225 CTCCTGGGGCTGAGGGAGGTGGG + Intronic
1167503222 19:49858686-49858708 CGGCCAGGGCAGAGCGAGCCCGG + Intronic
1167669009 19:50839032-50839054 CTCCTGGGTCTGAGGGAGCTGGG + Intergenic
1168152627 19:54457019-54457041 CTGGTATGGCAGGGGAAGCTCGG + Intronic
925033365 2:668958-668980 GTGCTGGGGCAGAGAGACCTTGG - Exonic
925106442 2:1296407-1296429 CTGCTGGGGCAGGGGCACCTTGG - Intronic
925412876 2:3650176-3650198 CTGAGAGGGCAGAGGAAGCCGGG + Intergenic
925610527 2:5697367-5697389 CTGCTAGGCCAGAGGGGCCCCGG + Exonic
927186212 2:20484396-20484418 CTTCTATAGCAGAGGGAGCCAGG + Intergenic
927252017 2:21004383-21004405 CTGGTAGCGCAGATGGAGATCGG + Exonic
928413512 2:31072175-31072197 GGGCGAGGGCAGAAGGAGCTTGG + Intronic
929533179 2:42764784-42764806 CTGCCATGGCACGGGGAGCTGGG + Intergenic
932409266 2:71535533-71535555 CTCTGAGGGCAGAAGGAGCTGGG + Intronic
933005024 2:76981401-76981423 CTGCCATGGCAGAGACAGCTGGG + Intronic
933699342 2:85243588-85243610 CAGCAAGGGAAGGGGGAGCTGGG + Intronic
934317795 2:91941412-91941434 CTGCTAAGGGAGAGGGAGGTAGG + Intergenic
934332050 2:92077595-92077617 CTCTTAGGGCATAGGGAGGTTGG + Intergenic
936033725 2:109092588-109092610 CAGCTATGGCACAGGGAGCAGGG + Intergenic
937299454 2:120830286-120830308 CTCAGAGGGCAGAGGGAGCTAGG - Intronic
937913931 2:127089739-127089761 CTGCTGGGGCAGAAGGTGCTGGG + Intronic
937918831 2:127115638-127115660 CTGGTAGGGCTGATTGAGCTTGG + Intergenic
937984995 2:127634413-127634435 CTGCTGGGACAGAGGTAGGTGGG + Intronic
939922634 2:148135955-148135977 CTGCTAGGGCTGCTGGAGATTGG - Intronic
940593530 2:155761226-155761248 CTGTTGGGGGAAAGGGAGCTAGG + Intergenic
940972970 2:159913637-159913659 CCACCAGGGCTGAGGGAGCTGGG + Intergenic
943192311 2:184694832-184694854 AAGTTAGGGCAGAAGGAGCTAGG + Intronic
944400353 2:199319285-199319307 CTGCAAGGGCATAGGTAGCATGG + Intronic
946062833 2:216959535-216959557 CTGCAAGGGGAGTGGGAGCAGGG + Intergenic
946158420 2:217821761-217821783 CTGCTGGTGGAGAGGGGGCTGGG + Exonic
946194098 2:218022904-218022926 CTACTGAGGGAGAGGGAGCTGGG + Intergenic
947714971 2:232334827-232334849 GTGCTAGGGCTGGGGGAGCGAGG - Intronic
947734047 2:232445778-232445800 GTGCTAGGGCTGGGGGAGCGAGG - Intergenic
948205562 2:236161115-236161137 CCGCTGGGGCAGAGGGAGGGTGG - Intergenic
948271454 2:236676951-236676973 CAGGCAGGGCAGGGGGAGCTGGG + Intergenic
948645623 2:239401827-239401849 CTGCTCAGGCGGAGGGAGCCCGG + Exonic
948660160 2:239501973-239501995 GTGCTGGAGCAGAAGGAGCTGGG - Intergenic
948676674 2:239600947-239600969 CTGCTGGAGCACAGGGACCTGGG + Intergenic
948858924 2:240743545-240743567 CTGCGTGGACTGAGGGAGCTAGG + Intronic
949017991 2:241724370-241724392 CTGTTAGGGCGGAGGGCCCTGGG + Intronic
1168793482 20:595899-595921 CTGCAAGGGCAGAGAGAGGCAGG + Intergenic
1169193302 20:3670926-3670948 CTGCTGGGGCTGTGGGAGCTGGG - Intronic
1170767001 20:19298850-19298872 CTTCAAGGGGTGAGGGAGCTGGG + Intronic
1171215206 20:23347426-23347448 CTGCCAGTTCAGAGTGAGCTGGG - Intergenic
1172532318 20:35641063-35641085 CTGCTAGGGCACATTGAGGTTGG - Intronic
1173736866 20:45367998-45368020 CTGATAGTGCTGAGGGAGATAGG + Exonic
1175191375 20:57214297-57214319 CTGCTGGGGCAGGGGGAGTGCGG - Intronic
1175405303 20:58722244-58722266 CTGAGAGGGCAGAGGGTGCAGGG - Intergenic
1175705095 20:61170952-61170974 CTGGATGGGCAGAGGCAGCTGGG - Intergenic
1175888960 20:62307656-62307678 CTGCTGGAGCAGAAGGGGCTGGG - Exonic
1176777865 21:13155565-13155587 CTCTTAGGGCATAGGGAGGTTGG + Intergenic
1176936198 21:14870049-14870071 CTGCTATTGCAGATGGAACTGGG - Intergenic
1177975479 21:27844572-27844594 CTCTTAGGGCATAGGGAGGTTGG + Intergenic
1178366856 21:31995572-31995594 CTGCCCAGGCAGAGGGAGATGGG + Intronic
1178688263 21:34728655-34728677 CTGCTTTGTCAGAGGGACCTGGG - Intergenic
1179173119 21:38988464-38988486 CCTCTAGGGCAGATGGAGCCAGG - Intergenic
1179453826 21:41484686-41484708 CTGCTAGGTCAGAGGGCGTGTGG - Intronic
1180305967 22:11125081-11125103 CTGCTAAGGGAGAGGGAGGTAGG + Intergenic
1180525643 22:16256992-16257014 CTCTTAGGGCATAGGGAGGTTGG + Intergenic
1180527226 22:16303730-16303752 CTCTTAGGGCATAGGGAGGTTGG + Intergenic
1180544486 22:16487264-16487286 CTGCTAAGGGAGAGGGAGGTAGG + Intergenic
1180874573 22:19169262-19169284 CAGCTAGGGCCCAGGGAGCCGGG + Intergenic
1180876389 22:19177079-19177101 CTGATAGGGCTCAGGGACCTGGG - Intronic
1181003102 22:19997179-19997201 CTGCTGGGGGCCAGGGAGCTGGG + Intronic
1182189931 22:28448751-28448773 CTGCTAGGGGAATGGGAGCATGG - Intronic
1183850961 22:40587597-40587619 CTGGTAAGGCAGAGGCAGCCAGG + Intronic
1183977906 22:41523807-41523829 CTGCCAGGTCAGAGGGATCAGGG - Intronic
1184301447 22:43563129-43563151 CTGCCAGGGCAGAAGGAACGCGG + Intronic
1203322728 22_KI270737v1_random:83923-83945 CTCTTAGGGCATAGGGAGGTTGG - Intergenic
952967890 3:38632342-38632364 CTGCTAGGGCAGGGAGACTTGGG - Intronic
953925844 3:46982063-46982085 CTGCCTGGGAAGAGGAAGCTAGG + Intronic
954135115 3:48578882-48578904 ATGCTGGGACAGAGGGGGCTCGG - Intronic
954327405 3:49870993-49871015 CTGCTGTGGGAGAGGGAGTTGGG + Intergenic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
954649221 3:52150076-52150098 ATGCCAGGGAAGATGGAGCTGGG - Intronic
954799772 3:53180571-53180593 CTGCGAGGGGTGAGGGGGCTGGG + Intronic
958742336 3:98090246-98090268 CTGTTGGGGGATAGGGAGCTGGG - Intergenic
959197086 3:103198040-103198062 CAGCTAGGGCTTAGGCAGCTAGG + Intergenic
960853356 3:122078367-122078389 CTTCTAGAGCAGAGGCTGCTCGG - Intronic
960901112 3:122555371-122555393 ATCCTAGGGAAGAGTGAGCTGGG - Exonic
961450802 3:127001467-127001489 CTGGTAGGGGAGGGGGAGCTGGG + Intronic
961709078 3:128813211-128813233 CTGCTTGGGCAGAGTGGGCGGGG - Intronic
961791388 3:129379121-129379143 CTACTAAGGCATGGGGAGCTGGG + Intergenic
966080117 3:175989900-175989922 CTGCTAGGCCAGGGAGAGCTAGG - Intergenic
966501506 3:180646753-180646775 CTGCTAGTACACAGAGAGCTAGG - Intronic
967009440 3:185418376-185418398 CTGGTAGGGCTGAGGCAGCCAGG + Intronic
967774983 3:193376825-193376847 CCGCTAGGCCTGAGGGAGCTGGG - Intronic
967776960 3:193395018-193395040 CTGCAAAGCCACAGGGAGCTTGG - Intergenic
967903891 3:194486052-194486074 CTGCTAGGGCAAAGGGCCCTGGG + Intronic
968144542 3:196287501-196287523 CAGCGAGGGCAGTGGGAGCCAGG - Intronic
968547506 4:1206401-1206423 CTGCCAGGGCAGGGGGAGGCCGG + Intronic
968562225 4:1290072-1290094 CGGCGAGGGCGGCGGGAGCTGGG + Intronic
969299648 4:6290443-6290465 CTGCTGGGGCAGAGCGTGCAAGG + Intronic
969300766 4:6295651-6295673 CTGCAAGGGCTCAGGGAGCGAGG + Intronic
969369863 4:6724732-6724754 CTGCTAGGGCAGAGTGGCCACGG - Intergenic
969627937 4:8317148-8317170 CACCAAGGGGAGAGGGAGCTGGG + Intergenic
969957613 4:10907893-10907915 CTCCTAGTTCAGAGGGGGCTAGG + Intergenic
969966033 4:10996472-10996494 CTGGTACTGCAGAGAGAGCTGGG + Intergenic
970492903 4:16593694-16593716 CTGCTTGGGGCAAGGGAGCTCGG + Intronic
971377817 4:26069252-26069274 GTGGTGGGGCAGAAGGAGCTAGG + Intergenic
976074719 4:81284741-81284763 CGGCTGGAGCAGAGGGAGCTGGG - Intergenic
976952442 4:90850038-90850060 CGGCTAGAGCTGAGGCAGCTGGG - Intronic
977950269 4:102962699-102962721 CTGCTAAGGGAGAGGGAGGTAGG + Intronic
977979678 4:103307217-103307239 CTGCAATGGCAGAGGGACTTTGG + Intergenic
978894787 4:113873599-113873621 CAGCTATGGCACAGGGAGCAGGG + Intergenic
980423896 4:132600035-132600057 CTGCTGGGACAGATGGAGGTTGG - Intergenic
980808953 4:137851095-137851117 CTGTTGGGGGTGAGGGAGCTAGG - Intergenic
980852088 4:138395428-138395450 CTGCTAGGGCATTTGGAGTTGGG + Intergenic
981315332 4:143335994-143336016 CGGCTAGGGCAGAGGCACCGGGG - Intergenic
981456263 4:144956756-144956778 CTGCTGGGGGATGGGGAGCTAGG - Intergenic
982265658 4:153536209-153536231 CTGATGGGGCAGAGGGAGTGAGG + Intronic
985259012 4:188097681-188097703 CTGGGAGGGCAGTGGGAGCCAGG + Intronic
985425759 4:189828653-189828675 ATGGCAGGGCAGAGGGAGCCTGG - Intergenic
985579427 5:689156-689178 CTGACAAGGCAGAGGGTGCTGGG + Intronic
985594273 5:781215-781237 CTGACAAGGCAGAGGGTGCTGGG + Intergenic
989266970 5:39486304-39486326 CTTTGAAGGCAGAGGGAGCTAGG - Intergenic
990908409 5:60828016-60828038 CTGTTAGGGGAGAGGGAACTAGG - Intronic
991127877 5:63088071-63088093 GGGCTAGGGAAGAGGGAGCTGGG + Intergenic
995727216 5:115193883-115193905 CTGCTGGGGCAGGTGAAGCTTGG + Intergenic
995915116 5:117236245-117236267 CTGGGAGGGCAAAGGGAGTTGGG + Intergenic
997630474 5:135364625-135364647 CTGTTAGGTCAGAGTCAGCTGGG + Intronic
997813374 5:136993737-136993759 CTACCAGTGCAGAGGGAGCCTGG + Intronic
997886836 5:137637746-137637768 CTGCTAAGATAGAGGAAGCTGGG - Intronic
998104145 5:139457605-139457627 CTGCAAGGACAGAGGCAGATAGG + Intronic
998384040 5:141745880-141745902 CTGCTGAGGCAGAGAGGGCTTGG - Intergenic
999586230 5:153092688-153092710 CTGTGAGAGCAGAGGGAGCCAGG - Intergenic
1001318773 5:170663418-170663440 CTGCTGGGGGAGAGGCACCTGGG - Intronic
1001580406 5:172794300-172794322 CAGCTAGAGCAGAGGGGCCTTGG + Intergenic
1001591385 5:172867639-172867661 ATGCTAGGGCAGAGAGAGAAGGG - Intronic
1004403857 6:15313400-15313422 CTCCTAGGGCTTGGGGAGCTGGG - Intronic
1004884529 6:20038748-20038770 CTGATAGGGAAAAGGGAGCAAGG + Intergenic
1006038113 6:31229962-31229984 GTGCTGGGGCAGAGGCAGGTGGG - Intergenic
1006093070 6:31639572-31639594 CAGCTAAGGCAGCCGGAGCTCGG - Exonic
1006425048 6:33958547-33958569 CTGCTAGGGCCTTGGGAGCAGGG + Intergenic
1006603664 6:35242045-35242067 ATGTTAGGGCAGAGGGAGTGAGG - Intronic
1006642375 6:35496076-35496098 CTGCTAGGGGAGGGAGGGCTGGG - Intronic
1006743766 6:36326948-36326970 CTGCAAGGACAGGTGGAGCTTGG + Intronic
1006914689 6:37586569-37586591 CTGCTAAGAGGGAGGGAGCTTGG - Intergenic
1007351807 6:41279019-41279041 CTGCTGGGGCATGGGGAGATGGG - Intronic
1007944468 6:45813151-45813173 CTGCCTGGGTAAAGGGAGCTGGG + Intergenic
1009975661 6:70668128-70668150 CTGCGAGGCCAAAGGTAGCTTGG + Exonic
1010656586 6:78518534-78518556 CTGCTATGGCAGAGGGAGGTGGG - Intergenic
1011685394 6:89819674-89819696 CTGCTCGGGCACTGGGACCTCGG - Exonic
1012391528 6:98746593-98746615 ATCCAAAGGCAGAGGGAGCTGGG - Intergenic
1013529423 6:111005244-111005266 GTCCTAGGGCAGAGGGTGTTTGG + Intronic
1016825743 6:148386977-148386999 TTCCCAGGACAGAGGGAGCTGGG - Intronic
1017326364 6:153145668-153145690 CTGCTCTGGCAGAGGTAGCAGGG + Intergenic
1017631225 6:156397757-156397779 CTGCTAGCCCAGAGGGAGGAAGG + Intergenic
1018397853 6:163393971-163393993 CCAGCAGGGCAGAGGGAGCTGGG - Intergenic
1019292146 7:256063-256085 ACCCTACGGCAGAGGGAGCTGGG + Intronic
1019509572 7:1411057-1411079 CTCCTAGAGCAGATGGAGCTCGG + Intergenic
1019706450 7:2499327-2499349 CTGCTGGGGCAGAGGGTCCCAGG + Intergenic
1019729490 7:2622473-2622495 TTGCTGGGGCAGGAGGAGCTGGG - Intergenic
1019729503 7:2622518-2622540 CAGCTGGGGCAGGAGGAGCTGGG - Intergenic
1019755178 7:2763465-2763487 CTGCCGGGGTTGAGGGAGCTCGG - Intronic
1019971842 7:4547830-4547852 CTGCTAGGGGAGAGGGGACCAGG - Intergenic
1020560826 7:9727519-9727541 CTGCCAAGGGAGAGGTAGCTGGG - Intergenic
1021525190 7:21578632-21578654 CTGCTAGGGCAGTGTGGGGTTGG - Intronic
1022100110 7:27164475-27164497 CAGCCAGGGCAGCCGGAGCTGGG - Intronic
1022470869 7:30681365-30681387 CTGCTAAGCCAGAGGGTGCGGGG - Intronic
1022951930 7:35347400-35347422 CTCCTAGGGCTGAGAGAGTTGGG + Intergenic
1024985348 7:55189178-55189200 CTGCTAAGCCAGAGGCTGCTTGG - Intronic
1025321829 7:58102616-58102638 CTCTTAGGGCATAGGGAGTTTGG + Intergenic
1025474969 7:60907899-60907921 CTCTTAGGGCATAGGGAGATTGG + Intergenic
1025487930 7:61075092-61075114 CTCTTAGGGCATAGGGAGGTTGG - Intergenic
1025512033 7:61581975-61581997 CTCTTAGGGCATAGGGAGGTTGG - Intergenic
1025556583 7:62317006-62317028 CTCTTAGGGCATAGGGAGGTTGG - Intergenic
1025566057 7:62435379-62435401 CTGTTAGGGCATAGGGAGGTTGG + Intergenic
1027462929 7:78478070-78478092 CTGTTGGGGGATAGGGAGCTAGG - Intronic
1027468032 7:78539779-78539801 CTGCTCTGGCAGAGGTAGCAAGG + Intronic
1027948216 7:84778466-84778488 CTGCTGGGGGATGGGGAGCTAGG + Intergenic
1029109524 7:98205545-98205567 CTGCTCGGGCTGAGGGCGCAGGG - Exonic
1031117910 7:117688043-117688065 TTGCTGGGGCAGAGGGAGGGTGG + Intronic
1031135755 7:117882429-117882451 GTGCTGGGGCAGAGGGAAGTGGG + Intergenic
1032415495 7:131732537-131732559 TGGCTGGAGCAGAGGGAGCTGGG - Intergenic
1034331843 7:150289493-150289515 CTGCTAAGGGAGAGGGAGGTGGG - Exonic
1034666193 7:152820377-152820399 CTGCTAAGGGAGAGGGAGGTGGG + Exonic
1036784457 8:11676925-11676947 CTGGGAGCTCAGAGGGAGCTGGG + Intergenic
1037000132 8:13707450-13707472 CTGCTCAGGGAGAGGCAGCTGGG + Intergenic
1039174884 8:34792630-34792652 CTGCCAGGACAAAGGGGGCTAGG - Intergenic
1039969332 8:42308015-42308037 CTGCTGAGGCAGAGAGCGCTGGG - Intronic
1042205548 8:66326702-66326724 CTGATAGGGCAGAGGGATAAAGG - Intergenic
1042835948 8:73079303-73079325 CTCCTGGGGGAGAGGGAGATTGG - Intronic
1043385233 8:79741942-79741964 ATGCTTGGGCAGAGCCAGCTGGG + Intergenic
1044835595 8:96292539-96292561 CTGCCAGGGCTGAGCCAGCTGGG + Intronic
1044923422 8:97188869-97188891 ATCTGAGGGCAGAGGGAGCTGGG - Intergenic
1045559075 8:103243644-103243666 CTGCTTAGGCAGAAGGAGCAGGG + Intergenic
1047418760 8:124688030-124688052 GTGCTAGGGCCCAGGGACCTCGG - Intronic
1047433071 8:124809389-124809411 CTGCTAGGCCAGAGGGGACTGGG - Intergenic
1047940296 8:129822672-129822694 CTGGTCTGACAGAGGGAGCTGGG + Intergenic
1048028724 8:130611035-130611057 ACCCTAAGGCAGAGGGAGCTGGG + Intergenic
1048193346 8:132310328-132310350 CTGCAATGGAAAAGGGAGCTGGG - Intronic
1049558147 8:143293863-143293885 CTGCAAGGGCAGAGAGAGGTGGG + Intronic
1049578040 8:143398538-143398560 CTGCTTGGGCTGGGGGAGCCTGG + Intergenic
1049610405 8:143552579-143552601 CTCCTGGGGCAGAGGGCGATGGG - Intergenic
1049802057 8:144522459-144522481 CTGCTAGGGCCGCGGGCGCGCGG - Exonic
1050308171 9:4327245-4327267 CTGAGAGAGCAGAGGGAGGTGGG + Intronic
1050623377 9:7477918-7477940 CTGGTAGGGCTGAGGCAGCCAGG + Intergenic
1053019120 9:34682711-34682733 GTCCTAGTGCAGAGGGGGCTGGG - Intergenic
1053608934 9:39690777-39690799 CTGGTAGGAAAGAGAGAGCTGGG - Intergenic
1053946562 9:43315018-43315040 CTCTTAGGGCATAGGGAGGTTGG + Intergenic
1054244588 9:62651621-62651643 CTGGTAGGAAAGAGAGAGCTGGG + Intergenic
1055574141 9:77646143-77646165 CCCCTAGGAGAGAGGGAGCTTGG - Intronic
1055925960 9:81509974-81509996 CTGCAATGGAAGCGGGAGCTGGG + Intergenic
1056798595 9:89675739-89675761 CTGCAAGGGCAGAGGGGACAGGG + Intergenic
1056854072 9:90109875-90109897 CACCTAGAGGAGAGGGAGCTGGG - Intergenic
1056947110 9:91007314-91007336 CAGCTGGGGCAGAAGCAGCTGGG - Intergenic
1057138682 9:92713726-92713748 TTGCTGGGGCAGGGGGATCTGGG + Exonic
1057179667 9:93022954-93022976 CTGCCAGGGGATAGGGAACTGGG + Intronic
1057455186 9:95202267-95202289 ATGCCAGGGCAGAGGGAACTGGG + Intronic
1057631276 9:96720746-96720768 CTGCCAGTGCAGGAGGAGCTAGG - Intergenic
1058935718 9:109767639-109767661 ATGTCAGGGCAGAGGGAGCGAGG - Intronic
1059563038 9:115353572-115353594 TTTCTAGAGGAGAGGGAGCTTGG + Intronic
1060794935 9:126507101-126507123 CTGCTGGGGGAGAGAGAGCTTGG - Intergenic
1061138484 9:128750492-128750514 CTGCTGTGGGAAAGGGAGCTGGG + Intronic
1062277703 9:135738574-135738596 CTGAGAGGGCTGAGGGAGCCGGG - Intronic
1062658765 9:137617756-137617778 CTGCGAGGGCTCAGGGTGCTCGG + Intronic
1203589692 Un_KI270747v1:43576-43598 CTCTTAGGGCATAGGGAGGTTGG + Intergenic
1187166198 X:16806352-16806374 CTCCCAGGGCAGAGCGAGCATGG + Intronic
1190290306 X:48988088-48988110 CTGCGTGGGCTCAGGGAGCTGGG - Intronic
1190321490 X:49182468-49182490 CTGCTGGCGCAGAGTGAGCAAGG - Intronic
1192146239 X:68684708-68684730 CTGATAGGCCAGAGGGTGCTGGG + Intronic
1192219665 X:69188873-69188895 CTGCTACTGCAGAGTGAGGTAGG - Intergenic
1192226673 X:69233292-69233314 TTTCTAGGGCAGTAGGAGCTGGG - Intergenic
1192873217 X:75204682-75204704 CTGATAGGGCAGAAGGATATAGG + Intergenic
1197560513 X:128014897-128014919 CTGCTAGGGCAGTGTGGGGTTGG - Intergenic
1198074668 X:133182913-133182935 CTGCTAGGCCAGAGGCAGCTAGG + Intergenic
1200292627 X:154886880-154886902 CAGCTGGGGCAGCTGGAGCTGGG - Exonic
1200339471 X:155382620-155382642 CAGCTGGGGCAGCTGGAGCTGGG - Exonic
1200346999 X:155458073-155458095 CAGCTGGGGCAGCTGGAGCTGGG + Exonic
1200487429 Y:3786277-3786299 CTGATAGGGCAGAAGGATGTAGG + Intergenic
1201185359 Y:11396444-11396466 CTGCTAAGGGAGAGGGAGGTAGG + Intergenic
1201378073 Y:13343328-13343350 CTGATGGGGCAGAGGGGGCATGG + Intronic
1201467392 Y:14298318-14298340 CTGTTTGGGCATGGGGAGCTAGG - Intergenic
1202368425 Y:24182206-24182228 CAGCTAGGACAGAAGCAGCTGGG - Intergenic
1202502360 Y:25487911-25487933 CAGCTAGGACAGAAGCAGCTGGG + Intergenic