ID: 917968908

View in Genome Browser
Species Human (GRCh38)
Location 1:180195009-180195031
Sequence CTTTAACCTCGGCTCCGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917968908_917968917 25 Left 917968908 1:180195009-180195031 CCAGGGCGGAGCCGAGGTTAAAG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG 0: 1
1: 0
2: 1
3: 4
4: 76
917968908_917968912 -6 Left 917968908 1:180195009-180195031 CCAGGGCGGAGCCGAGGTTAAAG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 917968912 1:180195026-180195048 TTAAAGGAGCTGAATGGAGCAGG 0: 1
1: 0
2: 1
3: 28
4: 267
917968908_917968916 19 Left 917968908 1:180195009-180195031 CCAGGGCGGAGCCGAGGTTAAAG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 917968916 1:180195051-180195073 GTGGTGCAGGCGCCTGCACTTGG 0: 1
1: 0
2: 0
3: 9
4: 121
917968908_917968913 -3 Left 917968908 1:180195009-180195031 CCAGGGCGGAGCCGAGGTTAAAG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 917968913 1:180195029-180195051 AAGGAGCTGAATGGAGCAGGTGG 0: 1
1: 0
2: 3
3: 48
4: 656
917968908_917968915 6 Left 917968908 1:180195009-180195031 CCAGGGCGGAGCCGAGGTTAAAG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 917968915 1:180195038-180195060 AATGGAGCAGGTGGTGGTGCAGG 0: 1
1: 0
2: 3
3: 82
4: 785
917968908_917968914 0 Left 917968908 1:180195009-180195031 CCAGGGCGGAGCCGAGGTTAAAG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 917968914 1:180195032-180195054 GAGCTGAATGGAGCAGGTGGTGG 0: 1
1: 1
2: 2
3: 42
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917968908 Original CRISPR CTTTAACCTCGGCTCCGCCC TGG (reversed) Intronic
902472179 1:16656795-16656817 CTTTAACCTCTGTGCCACCCAGG - Intergenic
904916461 1:33973827-33973849 CTTTTACCTGAGCTCTGCCCTGG - Intronic
917968908 1:180195009-180195031 CTTTAACCTCGGCTCCGCCCTGG - Intronic
919751307 1:201039887-201039909 CCTGAACCTCGGGTCCTCCCTGG - Exonic
1067025356 10:42839035-42839057 GTTCAACCTTGGCTCCTCCCTGG - Intergenic
1067197249 10:44132697-44132719 CTTTATCCTGGGCTCCATCCAGG - Intergenic
1077034941 11:490012-490034 CTGGACCCTCGGCTCCGTCCTGG + Exonic
1103986114 12:124768630-124768652 CTTCATCCACTGCTCCGCCCTGG + Intergenic
1109486383 13:63027239-63027261 CTGCAACCTCTGCTCCCCCCCGG + Intergenic
1115211838 14:30974726-30974748 CTTTAGCCTCTACTCCCCCCAGG - Intronic
1122393004 14:101403286-101403308 CTGTGCCCTCGGCTCCGGCCAGG - Intergenic
1125526844 15:40381987-40382009 CTGCAACCTCTGCCCCGCCCAGG + Intergenic
1128645608 15:69376717-69376739 TTTTAATCTGGGCTCAGCCCTGG + Intronic
1132990946 16:2793371-2793393 CTGCAACCTCCGCCCCGCCCCGG + Intergenic
1137877085 16:52007051-52007073 CTTTAGCCTCTGCACAGCCCAGG + Intronic
1142213684 16:88820807-88820829 CTTTAACCTCGGGTGGTCCCTGG + Intronic
1143307554 17:5959463-5959485 CTTTAAACTTGGCTCTGCTCGGG - Intronic
1154265902 18:12878592-12878614 CTGCAACCTCTGCTCCCCCCAGG - Intronic
1163586540 19:18167427-18167449 CCTTAAACTCGGTTCCTCCCGGG + Intronic
1165964088 19:39559870-39559892 CTGTAGCCTCCGCTCCTCCCAGG - Intergenic
927156809 2:20225338-20225360 CTTTCAGCTCGGCTGCTCCCTGG + Exonic
927588731 2:24334416-24334438 CTTTAACCTTGGCTGGGCCAAGG - Intronic
936599095 2:113877971-113877993 CTTTAACCTCCTTTCCACCCTGG + Intergenic
943669098 2:190641645-190641667 CTTTAACCTACTCTCCACCCTGG + Intergenic
948249322 2:236513036-236513058 CTTTAACCCCGGTTCAGGCCTGG - Intergenic
1170096964 20:12656641-12656663 CTTTCACCTGGGCTCCTTCCCGG + Intergenic
1181618224 22:24069896-24069918 CTCTAACCTCGCCACAGCCCAGG - Intronic
954668922 3:52277739-52277761 CTGTGACCTCGATTCCGCCCTGG - Intronic
955015789 3:55067368-55067390 TTTGAACCTCTGCTCTGCCCCGG + Intronic
968049746 3:195646391-195646413 CTTTAACATCAGCTCCTCTCCGG - Intergenic
968097551 3:195942197-195942219 CTTTAACATCAGCTCCTCTCCGG + Intergenic
968304387 3:197639591-197639613 CTTTAACATCAGCTCCTCTCCGG + Intergenic
968506849 4:974674-974696 CTTTACCCTGGGGTCCACCCAGG - Intronic
970332562 4:15002033-15002055 CTGTCACCTCGGTTCCGCCCTGG - Intergenic
970610568 4:17721587-17721609 CCTTCACCTCGGCTCTGCCCCGG - Intronic
973800557 4:54473375-54473397 ATTAAACCTTGGCTCCACCCTGG - Intergenic
978777484 4:112517382-112517404 CTGTGACCTCTGCTCCGCGCTGG + Intergenic
982278346 4:153659380-153659402 CCTTAACCGCTGCTCCGCGCTGG + Intergenic
985741815 5:1622004-1622026 CTAGAACCTCAGCTCCTCCCCGG + Intergenic
985741830 5:1622098-1622120 CTAGAACCTCAGCTCCTCCCTGG + Intergenic
985741838 5:1622145-1622167 CTAGAACCTCAGCTCCTCCCTGG + Intergenic
985741894 5:1622615-1622637 CTAGAACCTCAGCTCCTCCCCGG + Intergenic
985741976 5:1623273-1623295 CTAGAACCTCAGCTCCTCCCCGG + Intergenic
985742011 5:1623556-1623578 CTAGAACCTCAGCTCCTCCCTGG + Intergenic
985742047 5:1623838-1623860 CTAGAACCTCAGCTCCTCCCCGG + Intergenic
988781040 5:34522003-34522025 CTCTAACCTCCTCTCTGCCCTGG - Intergenic
991674749 5:69079782-69079804 CTGTAACCTCTGCTCCTGCCAGG - Intergenic
998202438 5:140135717-140135739 TTTTAAACTCAGCTCAGCCCAGG - Intergenic
999123748 5:149230685-149230707 CTTTAACTTCTTCTCTGCCCGGG - Exonic
1001457153 5:171872630-171872652 TTTTAACCTCAGCTCCACCTGGG - Intronic
1008553966 6:52657099-52657121 CTGTAACCTCTGCCCCACCCCGG + Intergenic
1023357397 7:39381137-39381159 CTACAACCTCTGCCCCGCCCCGG + Intronic
1031954060 7:127924084-127924106 CTTTACCCTCAGGTCAGCCCTGG + Intronic
1036089731 8:5652643-5652665 CTTTAACCTTCCCTCCACCCTGG - Intergenic
1038911734 8:31972358-31972380 CCTTGACCTCGGCTCTTCCCAGG + Intronic
1044477631 8:92646767-92646789 ATTTAACCTTGGCTAGGCCCAGG - Intergenic
1061693689 9:132355236-132355258 CCTTGACCTCGGCCCCGCCCGGG + Intergenic
1197849599 X:130843603-130843625 CTTTAACCTCACCCCCACCCTGG + Intronic
1199696137 X:150343811-150343833 CTTTAACCTGGCCTCACCCCAGG + Intergenic