ID: 917968910

View in Genome Browser
Species Human (GRCh38)
Location 1:180195020-180195042
Sequence CCATTCAGCTCCTTTAACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 136}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917968910_917968919 22 Left 917968910 1:180195020-180195042 CCGAGGTTAAAGGAGCTGAATGG 0: 1
1: 0
2: 1
3: 8
4: 136
Right 917968919 1:180195065-180195087 TGCACTTGGTCGTGGTCTCCTGG 0: 1
1: 0
2: 2
3: 7
4: 94
917968910_917968920 23 Left 917968910 1:180195020-180195042 CCGAGGTTAAAGGAGCTGAATGG 0: 1
1: 0
2: 1
3: 8
4: 136
Right 917968920 1:180195066-180195088 GCACTTGGTCGTGGTCTCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 103
917968910_917968921 24 Left 917968910 1:180195020-180195042 CCGAGGTTAAAGGAGCTGAATGG 0: 1
1: 0
2: 1
3: 8
4: 136
Right 917968921 1:180195067-180195089 CACTTGGTCGTGGTCTCCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 95
917968910_917968915 -5 Left 917968910 1:180195020-180195042 CCGAGGTTAAAGGAGCTGAATGG 0: 1
1: 0
2: 1
3: 8
4: 136
Right 917968915 1:180195038-180195060 AATGGAGCAGGTGGTGGTGCAGG 0: 1
1: 0
2: 3
3: 82
4: 785
917968910_917968916 8 Left 917968910 1:180195020-180195042 CCGAGGTTAAAGGAGCTGAATGG 0: 1
1: 0
2: 1
3: 8
4: 136
Right 917968916 1:180195051-180195073 GTGGTGCAGGCGCCTGCACTTGG 0: 1
1: 0
2: 0
3: 9
4: 121
917968910_917968917 14 Left 917968910 1:180195020-180195042 CCGAGGTTAAAGGAGCTGAATGG 0: 1
1: 0
2: 1
3: 8
4: 136
Right 917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG 0: 1
1: 0
2: 1
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917968910 Original CRISPR CCATTCAGCTCCTTTAACCT CGG (reversed) Intronic
900767804 1:4517059-4517081 CCAGTCAGCTGCTTTAAACAAGG + Intergenic
912373369 1:109190821-109190843 AAATTCTGCTCCTTTAACCCCGG + Intronic
917968910 1:180195020-180195042 CCATTCAGCTCCTTTAACCTCGG - Intronic
922291535 1:224212825-224212847 CCTTTCATCTTCTTCAACCTGGG + Intergenic
1063387226 10:5623541-5623563 CCATTAAGCTGCTTGAAGCTCGG - Intergenic
1064879573 10:20035589-20035611 CGATTCTCCTCCTTTAGCCTAGG - Intronic
1077663176 11:4086899-4086921 CCTTTCTGCTGCTTTTACCTTGG + Intronic
1078341781 11:10502388-10502410 ACCTTCAGCTCCTTTCTCCTAGG - Intronic
1079452529 11:20609688-20609710 CCATTCAGCCCCTCTCTCCTGGG - Intronic
1081801254 11:45860843-45860865 CCATTCAGCTCAATGATCCTGGG - Exonic
1086299410 11:85409536-85409558 CCATTGAACTCCTTAATCCTAGG - Intronic
1086911542 11:92478428-92478450 CCCTTCAGCTCATTTGGCCTTGG + Intronic
1087725150 11:101707911-101707933 CCATACATCTCCTGAAACCTAGG - Intronic
1089517843 11:119045026-119045048 CCATCCAGCTCCTTTCCCCCTGG - Exonic
1090106117 11:123854907-123854929 CCAGACTGCTTCTTTAACCTGGG + Intergenic
1091132855 11:133160976-133160998 CCATCCAGCTCCATGTACCTGGG - Intronic
1093256121 12:16870489-16870511 CCATCCAGCTAGTTTTACCTAGG - Intergenic
1095812074 12:46382634-46382656 CCATTCAGCGACATTAACCCGGG + Intergenic
1096537523 12:52284880-52284902 CCATTCAGCTCCTTCATGCATGG - Intronic
1096652865 12:53070567-53070589 ACATTCACCTCCTTAAGCCTTGG + Intronic
1098199582 12:68040594-68040616 CCATTTAGATCCTTTATGCTTGG - Intergenic
1102425010 12:112837214-112837236 CCCTTCAACTCCTTGAGCCTTGG + Intronic
1104213136 12:126709906-126709928 TCATTCAGGTCCTTTAAAATTGG - Intergenic
1105406018 13:20133303-20133325 CCCCTCAGCTCCTTTCACGTTGG - Intergenic
1105499215 13:20956844-20956866 CCATTCTGATTCTTGAACCTGGG + Intergenic
1106083132 13:26517108-26517130 CCTTCCAGCTCCTTAATCCTTGG + Intergenic
1109515166 13:63434519-63434541 CAATTCTGCTCCTTTTCCCTAGG - Intergenic
1111679615 13:91427033-91427055 CCATACAGCTCCTGAAATCTAGG - Intronic
1111783841 13:92763350-92763372 CCATTCAGCTTCTTCAGCTTTGG + Intronic
1111802821 13:93000464-93000486 CCATTTAGCTGTTTTAACTTTGG - Intergenic
1111821617 13:93222990-93223012 CCCTTCTGCTCCTTTAATCAGGG + Intergenic
1116063345 14:39951646-39951668 CTATGCAGCTCCTTGAACATAGG + Intergenic
1118538601 14:66797168-66797190 CTATTCTGTTCCATTAACCTAGG + Intronic
1120321973 14:82975117-82975139 CCATTCAAATCCATTTACCTTGG - Intergenic
1120749846 14:88187184-88187206 CCATTCAGCAACTTTCTCCTGGG + Intronic
1123107086 14:105846674-105846696 CCATTTACATCCTTTATCCTGGG + Intergenic
1123693975 15:22863549-22863571 CCATTTGGCTCCTCTGACCTTGG + Intronic
1124239386 15:28017349-28017371 CCATACAGATCATTTAATCTGGG + Intronic
1124833445 15:33172601-33172623 TTTTTCAGCTCCTTTAACCCCGG + Intronic
1128878252 15:71220028-71220050 ATGTTCAGCTCCTTTAACCAGGG + Intronic
1138228030 16:55315664-55315686 CAATTCTGCTCCATGAACCTCGG - Intergenic
1139341641 16:66271408-66271430 CCATTCAGCTGCCCAAACCTTGG - Intergenic
1140948549 16:79794251-79794273 CCAATCAGCTCCCGTGACCTGGG + Intergenic
1143461947 17:7109429-7109451 CCATTGAGATCCTTAAATCTGGG + Intronic
1145827645 17:27889183-27889205 CCTGTCACCTCCTTTGACCTGGG + Intronic
1146280189 17:31539746-31539768 CCATTCATCTGCTTTGGCCTGGG - Intergenic
1146684420 17:34831456-34831478 CCATTCAGCTTCCTGATCCTTGG - Intergenic
1146853092 17:36240397-36240419 CAATGCAGCTCCTGTACCCTAGG - Intronic
1146869002 17:36364277-36364299 CAATGCAGCTCCTGTACCCTAGG - Intronic
1147071877 17:37964912-37964934 CAATGCAGCTCCTGTACCCTAGG - Intergenic
1150082360 17:62251706-62251728 CAATGCAGCTCCTGTACCCTAGG - Intergenic
1151139335 17:71976456-71976478 CCATTCAGCAGCGTTACCCTGGG - Intergenic
1151342405 17:73480436-73480458 CCATCCAGCTCCTTCTTCCTGGG - Intronic
1156582240 18:38391846-38391868 CTATTCTGCTCCTTTGATCTGGG - Intergenic
1156583778 18:38409616-38409638 CCATTCATCTTCTGAAACCTAGG - Intergenic
1157496243 18:48159437-48159459 CAATTCAGCTCCATTCATCTTGG - Intronic
1160046636 18:75392573-75392595 CCAGTCAGCTCCTCCAACCCAGG - Intergenic
1164272904 19:23688961-23688983 CACTTCAGGACCTTTAACCTTGG + Intergenic
1164531797 19:29054137-29054159 CCATTTAGCTCCAGAAACCTAGG - Intergenic
1166276267 19:41756395-41756417 TCCTTCAGCACCTTTGACCTTGG - Intronic
1167310769 19:48736624-48736646 TCATTCAGCTCATTTCCCCTTGG - Intronic
926771337 2:16378725-16378747 CCATTCTGCTTCTCTGACCTTGG + Intergenic
926835309 2:17012652-17012674 CAAATCAGCTCCTTGAAACTTGG - Intergenic
927380734 2:22476645-22476667 CCATTCATCTTCTGTAATCTAGG - Intergenic
928429232 2:31204344-31204366 ACATTCAGCTCCTAAAACCTTGG + Intronic
928933536 2:36649949-36649971 CCATTCACCTACTTGTACCTGGG + Intergenic
929586022 2:43114980-43115002 CCATTGAGCTGGCTTAACCTGGG - Intergenic
930514128 2:52384002-52384024 GTTTTCTGCTCCTTTAACCTGGG + Intergenic
930764904 2:55075373-55075395 CCTTTCACCTCCTTTCACTTAGG - Intronic
930780913 2:55224262-55224284 CCATCCAGCTCCTTTGACTGTGG - Intronic
931821866 2:65960102-65960124 TCATTCAGATCCTTTGACCAAGG + Intergenic
934580967 2:95437648-95437670 TCAGTCAGCTCCATTAGCCTAGG + Intergenic
934598483 2:95639066-95639088 TCAGTCAGCTCCATTAGCCTAGG - Intergenic
936647424 2:114388223-114388245 CCATTGAAATCCTTAAACCTTGG + Intergenic
939113651 2:138036504-138036526 CCATTCAGCTTCTTCCACCTGGG + Intergenic
943144554 2:184025498-184025520 CAATTCCTCTCCTTCAACCTGGG + Intergenic
944763884 2:202844712-202844734 TAATTGAGCTCCTTTAACATAGG + Intronic
1169981517 20:11390166-11390188 CAATTCAGCTGCTTTAACAAAGG + Intergenic
1170287712 20:14729492-14729514 ACATTGATCTCCTTTGACCTGGG + Intronic
1171197237 20:23209293-23209315 CCCTTCACTTCCTTAAACCTTGG - Intergenic
1172341923 20:34164823-34164845 CCAACCAGCTCCTGTGACCTAGG - Intergenic
1174476499 20:50799654-50799676 TCATTCAGCACCTTCAGCCTCGG + Intronic
1174704569 20:52642388-52642410 CCATTGATTTCCTTTAACTTTGG - Intergenic
1175687168 20:61039991-61040013 CCATTCACCTCCTATGTCCTAGG + Intergenic
1175795220 20:61766653-61766675 CCACGCAGCTCTGTTAACCTCGG + Intronic
1175970480 20:62684390-62684412 CCAATCAGCTCCTTGTGCCTCGG - Intronic
1178190946 21:30280149-30280171 CACTTCAATTCCTTTAACCTAGG - Intergenic
1179316416 21:40247905-40247927 CCATACATCTCCTGAAACCTAGG + Intronic
1184190380 22:42890753-42890775 GCATTCAGCATCTTCAACCTGGG + Intronic
950698872 3:14726301-14726323 CCAGTCAGCTTCTGTAACCTTGG + Intronic
950702109 3:14757789-14757811 TCCTTCAGCTCCTTTCTCCTTGG + Intronic
952952390 3:38535508-38535530 TCTTTCACCTCCTTTAATCTGGG + Intronic
954745599 3:52785909-52785931 CCATCCAGCTACATTAACCGGGG - Intronic
956273040 3:67468398-67468420 CCATCCAGCTCCTTGAACCTGGG + Intronic
957525741 3:81376546-81376568 CCATTTAGCTTTTTAAACCTTGG + Intergenic
959006609 3:101026984-101027006 CCATTCAGCTCCCATAAACTTGG + Intergenic
960151061 3:114249321-114249343 TCATTGAGCTCCTTTCATCTGGG + Intergenic
965746877 3:171935418-171935440 CCATTCTGATCCCATAACCTTGG - Intronic
967558518 3:190889800-190889822 CCCTTCAGCCCCTTTATGCTGGG + Intronic
973357782 4:49142991-49143013 CCATTCCGTTCCTTTTATCTTGG + Intergenic
975983275 4:80182931-80182953 CCAATCAGCTCCCTTTACATTGG + Intergenic
976889870 4:90033299-90033321 ACATCCAGCTCCTAAAACCTTGG - Intergenic
980824418 4:138056803-138056825 CCCTTCTGCTCCTCTAGCCTAGG - Intergenic
986106290 5:4662494-4662516 CAATTTAGTTCCTTTAAACTAGG - Intergenic
987737280 5:21862939-21862961 CCCTTCAGTTCCTTTAACATAGG + Intronic
988277535 5:29100961-29100983 CCATTTACATCCTTTATCCTAGG - Intergenic
991965060 5:72082436-72082458 CAAGTCAGCTCCTTAACCCTTGG - Intergenic
995861940 5:116650369-116650391 CCATTTAGCACCTATAAACTTGG + Intergenic
1000102763 5:158032562-158032584 CCATTCAGCTGCTTGTAACTGGG + Intergenic
1001274160 5:170338332-170338354 CCTTACTGCTTCTTTAACCTTGG - Intergenic
1001289390 5:170445810-170445832 CCTTTCACCTTCTTTAACCTCGG - Intronic
1001467038 5:171976701-171976723 AGATTCAGGTCCCTTAACCTTGG + Intronic
1005509570 6:26500428-26500450 CCCTCCAGCTCCTTTCTCCTTGG + Intergenic
1007271651 6:40641907-40641929 CCAGGCAGCTCCCTTAACTTCGG + Intergenic
1008486650 6:52043247-52043269 GCATTCAGCTCCTTGAATTTTGG - Intronic
1010524731 6:76886879-76886901 CCATTCTTCTCCTTTCACCATGG + Intergenic
1012459218 6:99442344-99442366 CCATTGAGCTTCTACAACCTTGG + Intronic
1013042202 6:106446831-106446853 CCATGCGGCTCTTTTAACTTGGG + Intergenic
1016324688 6:142887007-142887029 CCATTTAGGTTCTTTAAACTAGG - Intronic
1016469259 6:144358021-144358043 GGATTCAGCTACTTTTACCTGGG + Intronic
1018117795 6:160604832-160604854 CCTTTCTGCTCCATTAAACTAGG + Intronic
1022961205 7:35428709-35428731 CCTCTCAGCACCTTCAACCTTGG + Intergenic
1027965545 7:85001212-85001234 CCATTCAGCCTCATTAACCAGGG - Intronic
1028337477 7:89675036-89675058 CCATTCTGTTCCTTTTACTTGGG - Intergenic
1029237225 7:99131171-99131193 CTATTGAGCTAATTTAACCTAGG + Intronic
1030434074 7:109492892-109492914 CCATGCTGCTTCTTTTACCTAGG - Intergenic
1034454313 7:151157875-151157897 CCACTCAGGTCCTATAACCTGGG + Intronic
1034489614 7:151386325-151386347 CCAGTTAACTCCTTTGACCTGGG - Intronic
1035824074 8:2626091-2626113 CTATTCAGTTACTTCAACCTTGG - Intergenic
1036383770 8:8260047-8260069 TCCTTCAGCTCCCTTAGCCTTGG + Intergenic
1037319052 8:17627005-17627027 CCATTCCCCTCCGCTAACCTTGG + Intronic
1040081117 8:43287071-43287093 CCATTAAGCTCCTGTATGCTCGG - Intergenic
1046496261 8:115018498-115018520 TCATTCAGCTTCTTTAAAATAGG + Intergenic
1047912674 8:129547481-129547503 CCATTCAGCTCCACTAAACTGGG - Intergenic
1052505499 9:29348798-29348820 ACATCCAGATCCTTTAAACTGGG + Intergenic
1055349596 9:75372685-75372707 CCTTCCAGCTCTTTTAACATGGG + Intergenic
1055667054 9:78563394-78563416 CCATCCAGCTCCTTCCACATCGG - Intergenic
1056095864 9:83252550-83252572 CCATTCAGTTTCTTTTACTTGGG - Intronic
1057690796 9:97282813-97282835 CTATTCAGGTCCTTTGCCCTAGG + Intergenic
1058288190 9:103206041-103206063 CCTTTCAGCTCGCTTCACCTTGG - Intergenic
1060149493 9:121279229-121279251 CCCTTCAACTCCTTGAGCCTTGG - Intronic
1060860330 9:126948726-126948748 CAATTCAGCTCCGTAAACATAGG + Intronic
1194214786 X:91116612-91116634 CCATTCAGTTCCTAGAAACTTGG + Intergenic
1195862505 X:109396764-109396786 ACATTCTGTTCCTTTAACCCAGG + Intronic
1196089272 X:111722382-111722404 ACATTCAACTCCTTGAACCCTGG + Intronic
1198412666 X:136387462-136387484 CCTTTGATCTCCTTTCACCTGGG - Intronic