ID: 917968917

View in Genome Browser
Species Human (GRCh38)
Location 1:180195057-180195079
Sequence CAGGCGCCTGCACTTGGTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 76}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917968910_917968917 14 Left 917968910 1:180195020-180195042 CCGAGGTTAAAGGAGCTGAATGG 0: 1
1: 0
2: 1
3: 8
4: 136
Right 917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG 0: 1
1: 0
2: 1
3: 4
4: 76
917968908_917968917 25 Left 917968908 1:180195009-180195031 CCAGGGCGGAGCCGAGGTTAAAG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG 0: 1
1: 0
2: 1
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917968917 Original CRISPR CAGGCGCCTGCACTTGGTCG TGG Intronic
903822069 1:26111014-26111036 GAGGCGCCTGCACCTGGCTGCGG - Intergenic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
1067883595 10:50068119-50068141 CTGGCGCCAGCTCCTGGTCGGGG - Exonic
1069557220 10:69406369-69406391 GAGGGGCCTGCACTTGCTCTGGG - Intronic
1070688831 10:78509800-78509822 CAGGCCCCTGCACTTGCTCCTGG - Intergenic
1071941661 10:90597770-90597792 CAGGGGACTGCATTTAGTCGAGG - Intergenic
1073186425 10:101617989-101618011 CAGGCCCCTGCACAAGGTGGGGG + Intronic
1073301894 10:102475909-102475931 GAGACGCCTGCACATGGTCAAGG + Exonic
1073753428 10:106555752-106555774 CAGGCCCCTGCACTTCTTCCTGG - Intergenic
1080433253 11:32217517-32217539 CAGGCGCCTGCCACTGGTCCCGG - Intergenic
1082028800 11:47590498-47590520 CCAGCGCCTGCACCTCGTCGCGG + Exonic
1083893557 11:65608891-65608913 CAGGCCACTGCACCTGGCCGAGG + Intronic
1084760525 11:71267900-71267922 CAGGGGCCTGCCCTGGGTGGTGG - Intergenic
1104322844 12:127768209-127768231 CAAGTGTCTGCACTTGGTGGGGG - Intergenic
1104990445 12:132621343-132621365 CAGGTGCCTGCACCTGCTGGGGG + Exonic
1106421488 13:29589545-29589567 CAGGTGCCTGGACTTGGGAGGGG + Intronic
1113835916 13:113328359-113328381 CAGGCGTCTGCACATGGCTGTGG + Intronic
1121722305 14:96118062-96118084 CATGCGCCAGCACTTGGGAGGGG + Intergenic
1124101863 15:26703241-26703263 CAGGCACCGGCACCTGGTGGGGG + Intronic
1125722070 15:41849994-41850016 CTGGCGCCTGCAGATGGTCTGGG - Intronic
1125746050 15:41997923-41997945 CAGGAGCCTGGACTTGTTTGGGG - Intronic
1128055907 15:64700035-64700057 CAGGCTCCTCCACTTGGCCTGGG - Intronic
1128115534 15:65102537-65102559 CAGGCGCCAGCCCATGTTCGGGG + Exonic
1128358467 15:66944306-66944328 CAGGTGCCTCCACAGGGTCGCGG + Intergenic
1128654771 15:69452720-69452742 CAGGCGCCTTCAGTGGGTCCTGG + Intergenic
1130051236 15:80485704-80485726 CAGTGGCCTGCAATTGGTCTTGG - Intronic
1132956424 16:2596743-2596765 CAGGAGCCTGCGCTTGGAAGTGG - Intronic
1139632276 16:68237785-68237807 AGGGCGCCTGCGCTTGGTGGAGG + Intronic
1141920461 16:87132357-87132379 CAGGAGCCTGCACCTGTTCCTGG - Intronic
1142621607 17:1168967-1168989 CAGCCACCTTGACTTGGTCGAGG - Intronic
1143330538 17:6131767-6131789 CAGGAGCCTGCACCAGGTCCAGG - Intergenic
1145260005 17:21349029-21349051 CAGGCTTCTGCGCTTGGTGGTGG + Intergenic
1145316612 17:21738909-21738931 CAGGCTTCTGCGCTTGGTGGTGG - Intergenic
1147896587 17:43755474-43755496 GAGGCGCTTGCACTTGCACGAGG + Exonic
1148156907 17:45429875-45429897 CAGGCTGCTGCGCTGGGTCGCGG + Intronic
1149641327 17:58204804-58204826 CAGCAGCCTGCACTTGCTCCAGG - Exonic
1150790854 17:68199341-68199363 CAGGCTGCTGCGCTGGGTCGCGG - Intergenic
1151662519 17:75526157-75526179 CTGGCGCCTGCACGTGGGCCCGG - Intronic
1151843193 17:76632295-76632317 CAGGCACCTTAACTTGGCCGTGG + Intronic
1152106290 17:78331066-78331088 CAGGAGCCGGCACGTGGTAGTGG - Intergenic
1152541944 17:80981198-80981220 CAGGAGCCTGCACAGGGTAGGGG + Intergenic
1152790056 17:82273850-82273872 CAGGAGCCTGCACGTGGAAGGGG - Intergenic
1155537661 18:26833560-26833582 CAGAGGCCTGCACTTGGGCGCGG + Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1157901979 18:51526716-51526738 CAGGGGCCTGCAGGTGGTCCTGG - Intergenic
1160575694 18:79852656-79852678 CCAGCGCCTGCACCTGGGCGTGG + Intergenic
1165850805 19:38849506-38849528 CAGGCGCCTGCGCGTGCGCGGGG - Intronic
1167862589 19:52297334-52297356 GAGACGCCTGAATTTGGTCGGGG - Intronic
1167982161 19:53284291-53284313 CAGGCGCTTGCCCTGGGTCCTGG + Intergenic
1167983983 19:53299682-53299704 CAGGCGCTTGCCCTGGGTCCTGG - Intergenic
926353841 2:12021935-12021957 GAGGAGCCTGCACTAAGTCGAGG + Intergenic
932414269 2:71564393-71564415 CAGGCCCCTGCACCTAGTCTAGG + Intronic
948185689 2:236019623-236019645 CAGCAGCCTGCACCTGGACGGGG + Intronic
1171196775 20:23206053-23206075 CAGGCTCCTGCACCTGGTCAGGG - Intergenic
1173643374 20:44618630-44618652 CTGGCGCCGGGACTTGGGCGGGG + Exonic
1177009735 21:15717338-15717360 AAGGTGCCTGCACTTTGTAGAGG - Intergenic
1180964047 22:19776461-19776483 CAGGGGCCTGCACGGGGTGGAGG + Intronic
1183078889 22:35443759-35443781 CAGGTGCTTGCACTTGTTTGTGG + Intergenic
963746946 3:149134138-149134160 CAGGGGCCTGCACTGGGCCACGG + Intronic
968279695 3:197466972-197466994 CAGGCCCCCGCACTTGCTGGTGG + Intergenic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
971758283 4:30730854-30730876 CTGGAGCCTGCCCTTGGCCGTGG + Exonic
973004264 4:44989516-44989538 CAGCCGCCTGCAATTGGTTCAGG + Intergenic
978385647 4:108173151-108173173 CAGGCGCCTGAACTTGGCATGGG + Intergenic
985749692 5:1667238-1667260 CAGGAGTCCGCACTTAGTCGGGG - Intergenic
986478299 5:8158503-8158525 CAGGAACCTGCACTTGGGAGGGG - Intergenic
1002644559 5:180646762-180646784 CAGGCTCCTTCCCTGGGTCGGGG + Intronic
1018227641 6:161644569-161644591 CAGGCGCCCACACTTGGACCTGG - Intronic
1019524414 7:1474341-1474363 CAGGCACCTGCCCATGATCGCGG - Exonic
1026688297 7:72531490-72531512 CAGGCGCCTGGGCCTGGTTGAGG - Intergenic
1026723532 7:72853374-72853396 CAGGCGCCTGGGCCTGGTTGAGG - Intergenic
1034969844 7:155412133-155412155 CAGGCCCCAGCACTTGTTGGTGG - Intergenic
1035166078 7:156990679-156990701 CAGGCGCTGTGACTTGGTCGCGG - Intergenic
1040596838 8:48846818-48846840 CAGCTGCCTGCACTTGGTCGGGG + Intergenic
1048548240 8:135406700-135406722 CAGGAGGCTGCACTAGGTCAAGG + Intergenic
1049771956 8:144387007-144387029 TAGGCCCCTGCACTTGGCCCAGG - Intronic
1049847347 8:144809428-144809450 CAGGCACATCCACTTGGTTGGGG + Intronic
1056020982 9:82438086-82438108 CAGGCTGCTGCACTTGCTGGAGG - Intergenic
1057070914 9:92099246-92099268 CAGGCTGCTGCACTTGCTGGAGG + Intronic
1059373022 9:113858613-113858635 CAGGCACCTGCACTTGGTAATGG - Intergenic
1059426874 9:114226830-114226852 CAGGCACCTGCCTTTGGTCTGGG + Intronic
1193865475 X:86725787-86725809 CTGGTGCCTGCAATTGGTTGTGG + Intronic