ID: 917972147

View in Genome Browser
Species Human (GRCh38)
Location 1:180215458-180215480
Sequence GTGAGCCATGATTATACTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917972139_917972147 23 Left 917972139 1:180215412-180215434 CCAGCTACTCAGGGGGCTGAGGG 0: 22
1: 2497
2: 105429
3: 211882
4: 243844
Right 917972147 1:180215458-180215480 GTGAGCCATGATTATACTACTGG No data
917972137_917972147 24 Left 917972137 1:180215411-180215433 CCCAGCTACTCAGGGGGCTGAGG 0: 1388
1: 100786
2: 206642
3: 240744
4: 152662
Right 917972147 1:180215458-180215480 GTGAGCCATGATTATACTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917972147 Original CRISPR GTGAGCCATGATTATACTAC TGG Intergenic
No off target data available for this crispr