ID: 917972651

View in Genome Browser
Species Human (GRCh38)
Location 1:180218889-180218911
Sequence CATCTCCTCACTTGTATTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917972649_917972651 5 Left 917972649 1:180218861-180218883 CCTGCTGACTTAGACTCTCTCTC No data
Right 917972651 1:180218889-180218911 CATCTCCTCACTTGTATTCCTGG No data
917972648_917972651 6 Left 917972648 1:180218860-180218882 CCCTGCTGACTTAGACTCTCTCT No data
Right 917972651 1:180218889-180218911 CATCTCCTCACTTGTATTCCTGG No data
917972643_917972651 30 Left 917972643 1:180218836-180218858 CCGTTCCTACTCCCTGGGTCCGA No data
Right 917972651 1:180218889-180218911 CATCTCCTCACTTGTATTCCTGG No data
917972646_917972651 18 Left 917972646 1:180218848-180218870 CCTGGGTCCGAACCCTGCTGACT No data
Right 917972651 1:180218889-180218911 CATCTCCTCACTTGTATTCCTGG No data
917972644_917972651 25 Left 917972644 1:180218841-180218863 CCTACTCCCTGGGTCCGAACCCT No data
Right 917972651 1:180218889-180218911 CATCTCCTCACTTGTATTCCTGG No data
917972647_917972651 11 Left 917972647 1:180218855-180218877 CCGAACCCTGCTGACTTAGACTC No data
Right 917972651 1:180218889-180218911 CATCTCCTCACTTGTATTCCTGG No data
917972645_917972651 19 Left 917972645 1:180218847-180218869 CCCTGGGTCCGAACCCTGCTGAC No data
Right 917972651 1:180218889-180218911 CATCTCCTCACTTGTATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917972651 Original CRISPR CATCTCCTCACTTGTATTCC TGG Intergenic
No off target data available for this crispr