ID: 917975833

View in Genome Browser
Species Human (GRCh38)
Location 1:180237089-180237111
Sequence CAGGGGAAGGAGAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3703
Summary {0: 1, 1: 3, 2: 25, 3: 418, 4: 3256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917975833_917975848 30 Left 917975833 1:180237089-180237111 CCTCCCTCCTTCTCCTTCCCCTG 0: 1
1: 3
2: 25
3: 418
4: 3256
Right 917975848 1:180237142-180237164 TTCCTTTGCAAAATCTTTGCAGG 0: 1
1: 0
2: 3
3: 34
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917975833 Original CRISPR CAGGGGAAGGAGAAGGAGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr