ID: 917977591

View in Genome Browser
Species Human (GRCh38)
Location 1:180250434-180250456
Sequence GCTCACCCGACCCCAAGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917977591_917977596 29 Left 917977591 1:180250434-180250456 CCTAGCCTTGGGGTCGGGTGAGC 0: 1
1: 0
2: 1
3: 9
4: 143
Right 917977596 1:180250486-180250508 GATGTGTATGCCTGCACCTTTGG 0: 1
1: 0
2: 1
3: 12
4: 99
917977591_917977593 -2 Left 917977591 1:180250434-180250456 CCTAGCCTTGGGGTCGGGTGAGC 0: 1
1: 0
2: 1
3: 9
4: 143
Right 917977593 1:180250455-180250477 GCTGCCCTGCTTCTGTGATGAGG 0: 1
1: 0
2: 0
3: 29
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917977591 Original CRISPR GCTCACCCGACCCCAAGGCT AGG (reversed) Intronic
900460802 1:2801369-2801391 GCTCCCCCGACCCAAGGGCCTGG - Intronic
900663810 1:3800158-3800180 GGCCAGCTGACCCCAAGGCTAGG + Intergenic
900692227 1:3987736-3987758 GATCACCTGTCCCCAAGCCTGGG - Intergenic
901163701 1:7199462-7199484 GGGCACCCGACCCTAGGGCTGGG + Intronic
901597829 1:10399216-10399238 GCTCAGGCGACCCCCAGGGTGGG - Intronic
901749395 1:11396708-11396730 TCTCACCCCACCCCAACACTGGG + Intergenic
901924181 1:12555464-12555486 CCTCTCCAGGCCCCAAGGCTTGG - Intergenic
902411037 1:16211706-16211728 GCCCACCCAACCTCAATGCTGGG + Intronic
903228317 1:21906430-21906452 GCTCCCCCTGCCCCCAGGCTGGG + Intronic
904468865 1:30723628-30723650 GGCCACCTGACCCAAAGGCTGGG - Intergenic
905278225 1:36832902-36832924 GCCCCCCTGCCCCCAAGGCTAGG + Intronic
907474612 1:54697477-54697499 GGACTCCCGACCCCAAGGCCAGG - Intronic
908186676 1:61658991-61659013 GACCACAGGACCCCAAGGCTGGG + Intergenic
915350013 1:155218450-155218472 GCTTACCCTACCCGAAGGCTTGG + Intergenic
915353412 1:155240688-155240710 GCTTACCCTACTCAAAGGCTTGG + Exonic
915542004 1:156573297-156573319 GCTCACCAGACCCCATGCCAGGG - Intergenic
915556717 1:156664881-156664903 GCTCTCCCCACTCCAGGGCTGGG + Intergenic
917977591 1:180250434-180250456 GCTCACCCGACCCCAAGGCTAGG - Intronic
920251192 1:204623489-204623511 GCACCTCTGACCCCAAGGCTTGG + Intronic
920432277 1:205926691-205926713 GCATACCCGACCCCAAGGCCTGG + Intronic
921970836 1:221147338-221147360 CCGCACCCGGCCCCAAGTCTTGG + Intergenic
1062884115 10:1003906-1003928 GCACACAAGACCCTAAGGCTAGG - Intronic
1068670214 10:59714983-59715005 ACTTACCCTACCCCCAGGCTGGG + Intronic
1069828311 10:71267818-71267840 GCTCACCCAAACCCAGGGCCGGG + Intronic
1073268050 10:102240379-102240401 GCCCACCTCACCCCAAGGCCAGG + Intronic
1076345142 10:129774494-129774516 GCTCCCCCGCCCCCCAGGCCAGG + Intergenic
1076611482 10:131728766-131728788 GCTCATCAGACCCCACAGCTGGG + Intergenic
1078067379 11:8087317-8087339 GCTCAGCCAAGCCCAGGGCTGGG + Intronic
1078266121 11:9757473-9757495 CCCCACCCAACCCTAAGGCTGGG + Intergenic
1083996948 11:66277526-66277548 CATCCCCCCACCCCAAGGCTGGG - Intergenic
1084035154 11:66505108-66505130 CCTCACCTGACCCCCAGCCTGGG - Intronic
1084453655 11:69254783-69254805 GCTCACCCAATCTCAAGGCATGG - Intergenic
1084668041 11:70587116-70587138 GCTCTCCCGACCACAACACTAGG + Intronic
1085451550 11:76637125-76637147 GCCCACTAGGCCCCAAGGCTGGG + Intergenic
1085469878 11:76750901-76750923 GCACACCCTATCCCCAGGCTGGG - Intergenic
1088833819 11:113560481-113560503 GAGCAGCCCACCCCAAGGCTAGG - Intergenic
1088889244 11:114031900-114031922 GCCCACACCACCCCAAGGCCTGG + Intergenic
1089351022 11:117821767-117821789 TGCCACCCCACCCCAAGGCTCGG - Intronic
1089701453 11:120246614-120246636 GCCAACCAGACCCCAAAGCTAGG + Intronic
1090358790 11:126158506-126158528 GCACACCCGACCACCAGGCAGGG + Intergenic
1090580010 11:128149092-128149114 GCTCAAGTGACCCCTAGGCTGGG + Intergenic
1090733652 11:129592694-129592716 GCTCACCAAACCCCAAAGCTTGG + Intergenic
1090805453 11:130199395-130199417 GCTCACCCAAGCCCAAGGCAGGG + Intronic
1091235095 11:134016453-134016475 GCTCACCCCACTCCACTGCTGGG - Intergenic
1097178957 12:57160016-57160038 GCTCCTCCCACCCCAAGGCCTGG - Intronic
1099621426 12:85006490-85006512 ACTCACACGTCCCCATGGCTAGG - Intergenic
1104973612 12:132542347-132542369 TCTCACCCGACACTCAGGCTGGG + Intronic
1113880253 13:113621349-113621371 CCACACCCCACCCCACGGCTGGG - Intronic
1114566887 14:23639537-23639559 CCTCACCCCACCCCCAGGCCCGG + Intronic
1121743394 14:96269326-96269348 GCTCAGCCGGAGCCAAGGCTTGG - Intergenic
1121976013 14:98404750-98404772 GCTGACCTGACTCCCAGGCTTGG - Intergenic
1122255032 14:100470309-100470331 GCTCACCTGACCCACAGGCTGGG - Intronic
1122637293 14:103136103-103136125 GCTCCCCCTTCCCCAAGGCAGGG + Exonic
1126328169 15:47504418-47504440 GCTCATCCAACCCCATGGCGAGG + Intronic
1126695784 15:51324085-51324107 GCTCCCCCTACCCAAAGACTGGG + Intronic
1128543924 15:68555002-68555024 GCCCACCCTACCACATGGCTGGG + Intergenic
1129602555 15:77008800-77008822 GCTCCCCCTACCCCAGGCCTGGG - Intronic
1132585108 16:702756-702778 GCTCCCAAGACCCCAGGGCTGGG + Intronic
1132978289 16:2721224-2721246 GCGCCCCCGACCCCACGGCCCGG - Intergenic
1133303703 16:4797622-4797644 GTACACCAGACCCCAAGGTTGGG + Intronic
1133856035 16:9550135-9550157 GGTCACCTGACCCCAAAGCCTGG + Intergenic
1133996450 16:10752179-10752201 GCTCACCCCTCACCAAGCCTTGG - Intronic
1134504164 16:14791771-14791793 GCTCACCCTACCCCAGGCTTAGG + Intronic
1134576409 16:15337137-15337159 GCTCACCCTACCCCAGGCTTAGG - Intergenic
1134726036 16:16419364-16419386 GCTCACCCTACCCCAGGCTTAGG + Intergenic
1134941399 16:18292496-18292518 GCTCACCCTACCCCAGGCTTAGG - Intergenic
1137586430 16:49666709-49666731 GCTCACCAGACCCCCAGGGAGGG + Intronic
1138458122 16:57132890-57132912 GCCCCCCTGACCGCAAGGCTGGG + Intronic
1145056654 17:19707671-19707693 GACCACCCTGCCCCAAGGCTAGG + Intronic
1145867718 17:28251394-28251416 GGTCACGTGACCCCACGGCTGGG + Intergenic
1145888191 17:28397038-28397060 GCCCACCCTACCCCATGCCTTGG + Exonic
1152633984 17:81423034-81423056 GCTTCCCGGACCACAAGGCTGGG - Intronic
1153851877 18:9102647-9102669 GCGCTCCCGACCCCAGGCCTAGG - Exonic
1159777999 18:72626026-72626048 TCTCACTGGACCACAAGGCTGGG - Intronic
1160018782 18:75164626-75164648 GCTCACCTGTCCCCATGCCTTGG - Intergenic
1160518035 18:79489150-79489172 GCCCACCAGGCCCCAAGGCAAGG - Intronic
1162477853 19:10911734-10911756 GCCCAGCCGGCCCCAGGGCTTGG + Intronic
1163177603 19:15575511-15575533 GGTCACCCGAACCCCAGCCTTGG + Intergenic
1163334544 19:16661945-16661967 GCAGAACCGGCCCCAAGGCTGGG + Intronic
1163427807 19:17248587-17248609 GAGCACCTGCCCCCAAGGCTGGG + Intronic
1164790107 19:30970200-30970222 CCTCGCCCAACACCAAGGCTTGG - Intergenic
1165108409 19:33487621-33487643 GCTCACCCGGCCCCTCAGCTGGG - Intronic
1166108124 19:40607513-40607535 GCTCACCTGAGCCGAAGGGTGGG - Exonic
1166994665 19:46714421-46714443 GCTCGCCCCACCCCAGTGCTGGG - Intronic
1167016125 19:46842272-46842294 GCCCTCCAGACCCCCAGGCTGGG + Intronic
1167340622 19:48913715-48913737 CCTCTCCCGACTACAAGGCTAGG + Intronic
1167430341 19:49450673-49450695 GCTCACCCCACCCCCACCCTAGG + Intronic
927467724 2:23349783-23349805 GCTGTCCAGACCCCAATGCTGGG - Intergenic
927860907 2:26559345-26559367 CCTAGCCCCACCCCAAGGCTGGG + Intergenic
936047060 2:109196312-109196334 GCTCCCCTGGCCCCAAGGCCTGG + Intronic
936092424 2:109510117-109510139 GCACACCCCAACCCGAGGCTGGG + Intergenic
936386079 2:112030577-112030599 GCTCAGCTGCCCCGAAGGCTGGG - Intergenic
937638441 2:124184302-124184324 GCTCCGCCCACCCCAAAGCTGGG - Intronic
938109386 2:128553776-128553798 GCTGACTGCACCCCAAGGCTGGG + Intergenic
938465039 2:131519783-131519805 TCTGACCCGACCCCATGGCCTGG + Intergenic
942045550 2:172097318-172097340 GCCCTCCCGACTCCCAGGCTTGG + Intergenic
943727347 2:191266003-191266025 ACACACCCCACTCCAAGGCTGGG - Intronic
946023308 2:216656637-216656659 GCTCACCCGAACTCAATGCCTGG - Intronic
1174458925 20:50669252-50669274 CCTCTCCTGACCCCTAGGCTAGG + Intronic
1176309069 21:5140246-5140268 CCTCACCCCACCCCCAGGCCTGG - Intronic
1178478946 21:32962461-32962483 GCACACCAGAGCCAAAGGCTGGG - Intergenic
1179381731 21:40905581-40905603 GCTCACATGGCCCCAAGGCTTGG + Intergenic
1179847992 21:44121787-44121809 CCTCACCCCACCCCCAGGCCTGG + Intronic
1181306577 22:21920546-21920568 GCTCCCTCGGCCCCAAGGCAAGG + Exonic
1181515000 22:23405233-23405255 GCTCAGCCGAGCCCCAGGTTGGG - Intergenic
1182061930 22:27404635-27404657 GCTCACGTGACCCCCAGGGTAGG + Intergenic
1184557143 22:45239758-45239780 CCCCACCCCACCCCCAGGCTAGG - Intronic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
960283835 3:115805170-115805192 TCTCACCCGACCCCAAAGCAAGG - Exonic
962677993 3:137770434-137770456 GCTCACCCGACCCCAGAGGCTGG - Intergenic
962894021 3:139697961-139697983 TCACACCCCACCCCAAGGCTTGG - Intergenic
963063190 3:141241489-141241511 CCTTCCCTGACCCCAAGGCTGGG - Intronic
964480965 3:157138052-157138074 CCACACCCGGCCCCAAAGCTAGG + Intergenic
966856021 3:184194188-184194210 GCTCAGCCCACCCCAAGGTCAGG - Intronic
968441156 4:625195-625217 GCACACCCGAGCCCAGGTCTGGG + Intergenic
968689301 4:1982503-1982525 GCTCAGCCGACTGCAGGGCTGGG - Intergenic
969310225 4:6348621-6348643 GCTCTCCAGACCCCAGGACTTGG + Intronic
971056955 4:22923963-22923985 GCTCACTACACCCCTAGGCTAGG + Intergenic
973802918 4:54496538-54496560 GTCCATCAGACCCCAAGGCTGGG - Intergenic
985813012 5:2103956-2103978 GCTCACCTGACTCCAAAGCCAGG + Intergenic
985986691 5:3522092-3522114 TCTCACCCCAGCCCAGGGCTGGG + Intergenic
986421980 5:7594360-7594382 GCTCATAGGACCCCAAGGTTTGG + Intronic
999285428 5:150391641-150391663 GCTCACCCCACTTGAAGGCTGGG - Exonic
1001800997 5:174543961-174543983 GCTCACCTGACTCCAAGCCCAGG + Intergenic
1006042216 6:31266086-31266108 GGACACTGGACCCCAAGGCTAGG - Intergenic
1007367777 6:41406909-41406931 CCTCGCCCGCCCCCAAGCCTAGG - Intergenic
1016893771 6:149032707-149032729 GCTCTCCCGAGGCCAAGGTTGGG - Intronic
1020111910 7:5452221-5452243 GCACACTTGACCCCATGGCTTGG + Intronic
1020278889 7:6640089-6640111 GCTCACCCAAGTCAAAGGCTGGG - Intronic
1026830440 7:73607130-73607152 GCTCACCCGACCCCTAGGTAAGG + Intronic
1030348952 7:108461936-108461958 GCTCAACCCACCCCCATGCTTGG + Intergenic
1032711503 7:134464028-134464050 ACACACCTGACCCCCAGGCTTGG + Intergenic
1039442410 8:37604419-37604441 ACAGACCCGACACCAAGGCTAGG + Intergenic
1040680258 8:49800771-49800793 GAACACCCTACCCCAAGGCGTGG + Intergenic
1044931995 8:97260040-97260062 GCTCAGCTGGCCCCATGGCTAGG - Intergenic
1045945324 8:107788914-107788936 GCTTACCCTACCCGAAGCCTTGG - Intergenic
1047499340 8:125430014-125430036 GCGCACACGCCCCCAGGGCTGGG - Intergenic
1048165759 8:132059868-132059890 CCTCACCCTACCCCACAGCTTGG - Intronic
1048976730 8:139677354-139677376 GCTCATCCAACCCCAGGGCCTGG + Intronic
1053422774 9:37990363-37990385 GCTCACCCCACCCCACCTCTGGG + Intronic
1056555423 9:87683855-87683877 CCTCCCCAGACCCCACGGCTGGG - Intronic
1059336581 9:113572813-113572835 GCTCAGCCTGCCCCTAGGCTGGG - Intronic
1061282075 9:129603104-129603126 GCTCACCAGACCCCAAGCCTGGG + Intergenic
1061921951 9:133787382-133787404 GATCACCCCACCCCCAGCCTGGG - Intronic
1062176239 9:135164578-135164600 GCTGACCCCACCCCAAGCCGAGG + Intergenic
1062635141 9:137486703-137486725 GCTGAAGCCACCCCAAGGCTGGG - Intronic
1186891791 X:13966261-13966283 GCTCACCCCTGCCCAAGGCACGG + Intergenic
1192366403 X:70477434-70477456 GCTGGCCCCACCCCAGGGCTTGG - Intronic
1196866880 X:120078431-120078453 GCTCTCCCGTGCCCAAGGCAAGG - Intergenic
1196876219 X:120157851-120157873 GCTCTCCCGTGCCCAAGGCAAGG + Intergenic
1197219162 X:123895140-123895162 GCCCACCCTACCCCTAGGCCAGG + Intronic
1198052318 X:132960968-132960990 GTTCTCCCGAGGCCAAGGCTGGG + Intronic
1200002131 X:153067513-153067535 GCCCCCCCGACCCCGGGGCTGGG - Intergenic
1200005602 X:153082512-153082534 GCCCCCCCGACCCCGGGGCTGGG + Intergenic