ID: 917981024

View in Genome Browser
Species Human (GRCh38)
Location 1:180269276-180269298
Sequence CAGGGTATCATGGGCTCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917981016_917981024 10 Left 917981016 1:180269243-180269265 CCTTGCAGAACGCTCTCTCCTAA 0: 1
1: 0
2: 1
3: 6
4: 94
Right 917981024 1:180269276-180269298 CAGGGTATCATGGGCTCCCTTGG 0: 1
1: 0
2: 1
3: 12
4: 158
917981019_917981024 -8 Left 917981019 1:180269261-180269283 CCTAAATTAACAGCCCAGGGTAT 0: 1
1: 0
2: 0
3: 11
4: 96
Right 917981024 1:180269276-180269298 CAGGGTATCATGGGCTCCCTTGG 0: 1
1: 0
2: 1
3: 12
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917981024 Original CRISPR CAGGGTATCATGGGCTCCCT TGG Intronic
903176785 1:21586285-21586307 CACAGAACCATGGGCTCCCTGGG + Intergenic
903384055 1:22915350-22915372 AAGGGTACCAAGGTCTCCCTTGG - Intergenic
904331572 1:29761337-29761359 CAGGGTTCCTTGGGCCCCCTGGG + Intergenic
904470046 1:30730453-30730475 CAGGCGATCGTGGGCTCGCTTGG + Intergenic
905622750 1:39462934-39462956 CAGGGAATCTTGGGCTCCTAGGG + Intronic
905733180 1:40310289-40310311 CAGGGCATCAGGGGCTACCCAGG - Exonic
905837676 1:41142165-41142187 GCATGTATCATGGGCTCCCTAGG - Intronic
905871491 1:41406942-41406964 CGGAGTATCTGGGGCTCCCTGGG + Intergenic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
906292218 1:44626612-44626634 CAAGGTCACATGGGCTCCATGGG + Intronic
907535483 1:55151722-55151744 CAGGGTACCCTCGGCTCCCTTGG - Intronic
911906866 1:103580624-103580646 CAGTGTATCATGGGATGCCTGGG - Intergenic
916019534 1:160779900-160779922 CAGGTTAACATGGGCTCGGTAGG + Intergenic
917308817 1:173656001-173656023 CAGTGTATCATGGCTTCCCTTGG + Intronic
917981024 1:180269276-180269298 CAGGGTATCATGGGCTCCCTTGG + Intronic
918066121 1:181103011-181103033 CAAGGACTCATGGCCTCCCTAGG - Intergenic
918148726 1:181780451-181780473 GAGGGAAGCATGGGCTCCCTGGG + Intronic
918542348 1:185645984-185646006 CAGGGTATAATGAGCTATCTTGG + Intergenic
919139382 1:193551343-193551365 CAGGATAGCTTAGGCTCCCTGGG + Intergenic
920655128 1:207868933-207868955 CGGGGTAGGGTGGGCTCCCTGGG - Intergenic
923067041 1:230527492-230527514 CAGGATCTCATGGCTTCCCTTGG + Intergenic
924929117 1:248711882-248711904 CAGGGTATAAGGGGCTGCATGGG - Intergenic
1062857882 10:788440-788462 CAGGGGATCCTAGGCTTCCTGGG + Intergenic
1063956065 10:11268440-11268462 CAGGGGAACATGGTCTCCCGTGG - Intronic
1065300299 10:24315055-24315077 CAGGGTATCAGTGGGTCCCATGG - Intronic
1067036911 10:42927628-42927650 CAGGGTTTCAGGTGTTCCCTGGG - Intergenic
1068392539 10:56416841-56416863 CAATGTACCATGAGCTCCCTTGG - Intergenic
1068717661 10:60206056-60206078 CAGGGTACCTTGGGTTCCCAGGG - Intronic
1068958434 10:62843052-62843074 ATGGCTATCATGGGCTGCCTAGG - Intronic
1069212656 10:65780380-65780402 CAGGCTGTCATGGGATTCCTAGG - Intergenic
1069718143 10:70533874-70533896 CAGGGTTTCCTGGTCTCACTGGG + Intronic
1069878812 10:71579236-71579258 AGGGGTGTCATGGGCTCCCTGGG + Intronic
1076538596 10:131199039-131199061 CAAGATCTCATGGGCACCCTGGG + Intronic
1077134513 11:991787-991809 CAGGGTATTAGGGGTGCCCTCGG + Intronic
1078482606 11:11691764-11691786 CAGTCTATCATGGCATCCCTTGG - Intergenic
1078781251 11:14441342-14441364 CAGGGTGGCATGGCCTCGCTTGG - Intergenic
1081527120 11:43934838-43934860 CAGGTTACCATAGGCTGCCTTGG + Intronic
1081680925 11:45001891-45001913 CAGGGTATCTATGGCTGCCTGGG + Intergenic
1083397219 11:62400171-62400193 CAGGATATGAGGGGCTCCCCAGG + Intergenic
1084478342 11:69401438-69401460 CAGGGTAACATGAACTTCCTAGG + Intergenic
1085607535 11:77915549-77915571 GAGGGTGTCCTGGGCTCCCCTGG - Intronic
1086680265 11:89662644-89662666 CAGGCTATCAGGGAGTCCCTGGG - Intergenic
1087239053 11:95755043-95755065 CAGGGTATCATAGGGTCCCAAGG + Intergenic
1090663877 11:128902119-128902141 CTGGCTGTCATGGGCTCCCAGGG - Exonic
1091114097 11:132997568-132997590 CTGGGGCTCATGTGCTCCCTAGG + Intronic
1091398186 12:167033-167055 CAGGGTAAAATGGGATCCATCGG + Intronic
1094870609 12:34597338-34597360 CAGGGGATCCTGGGCTTCCCTGG + Intergenic
1094870919 12:34598850-34598872 CAGAGTATCCTGGGCTTCCCTGG + Intergenic
1094870992 12:34599223-34599245 CAGGGGATCCTGGGCTTCCCTGG + Intergenic
1094871756 12:34602770-34602792 CAGGGTATCCTGGGAGCCCCTGG + Intergenic
1099428908 12:82557262-82557284 CAGAGTTTCAGGGGTTCCCTCGG + Intergenic
1102259424 12:111435299-111435321 GAGGGTATCATGGGGCCCCAGGG - Intronic
1103447534 12:121004012-121004034 CAGGGTCTCATGGGCAGTCTGGG + Exonic
1109760377 13:66819818-66819840 CACTGTAGCATGGGCTTCCTGGG - Intronic
1117457365 14:55911921-55911943 CTTGGTATAATGTGCTCCCTAGG + Intergenic
1118056381 14:62083521-62083543 CAGGTTCTCCTGGGCTCACTTGG + Intronic
1120852864 14:89186873-89186895 CATGGTGTGCTGGGCTCCCTTGG + Intronic
1121567657 14:94922879-94922901 CAGTGTATTATCTGCTCCCTAGG + Intergenic
1122825454 14:104368415-104368437 CAGGGTCTCCTGGGCTCTCCAGG + Intergenic
1123774246 15:23562447-23562469 CAGGGTAGCATGGGATCCCCTGG - Intergenic
1124887031 15:33696744-33696766 GATGTTTTCATGGGCTCCCTGGG - Intronic
1126783855 15:52160893-52160915 AAGGGTATCATGGTAGCCCTGGG - Intronic
1133106581 16:3514289-3514311 CAGGGTCTCATGGTTTCCTTGGG - Intronic
1133512484 16:6473097-6473119 CAGGGCATCCTGGGGTCCCCGGG - Intronic
1133767656 16:8849065-8849087 CAGGGCAGCCTGGGCTCCCCTGG - Exonic
1137594388 16:49714161-49714183 CAGGAGATCATGGGCTCCGAAGG + Intronic
1138458436 16:57134201-57134223 GGGGCTATCATAGGCTCCCTAGG - Intronic
1141785446 16:86197138-86197160 CAAGCGATCATCGGCTCCCTGGG - Intergenic
1144051606 17:11501787-11501809 CAGGGTACCACTGGCACCCTGGG - Intronic
1145759792 17:27419659-27419681 CAAAGGATCCTGGGCTCCCTAGG + Intergenic
1145861399 17:28213359-28213381 CAGGCTATCAGGGGATCTCTTGG + Intergenic
1146685936 17:34841711-34841733 CAGGATATCAGAGCCTCCCTGGG + Intergenic
1148442697 17:47720001-47720023 CTGGGTATCATGGGTCCCCTTGG + Intergenic
1148656698 17:49289544-49289566 CCGGGCAGCATGGGCTCCTTTGG + Intronic
1154172742 18:12063081-12063103 CTGGGGATCAGGGTCTCCCTGGG + Intergenic
1158574981 18:58629163-58629185 CTGGGTTTCATCAGCTCCCTGGG - Intergenic
1159250504 18:65869620-65869642 CAAGGTATTATGGGGTCCTTAGG - Intronic
1161113302 19:2481785-2481807 CAGGCCATCGTGGGCACCCTGGG - Intergenic
1161663541 19:5561367-5561389 CAGGGTTTCATGGTCCACCTGGG + Intergenic
1161766288 19:6210814-6210836 CTGGGCAGCATGGGCTCCCAAGG - Intergenic
1163736487 19:18984447-18984469 CAGGGTATCAGGGCTACCCTGGG - Intergenic
1163821575 19:19499289-19499311 CTGGGGAGCAGGGGCTCCCTGGG - Intronic
926648548 2:15316468-15316490 CAGTGTGTCATGGCTTCCCTTGG - Intronic
930439204 2:51385465-51385487 CAGGGCATCATGGGCACATTGGG + Intergenic
932800120 2:74734200-74734222 CAGGGCCTCTTGTGCTCCCTGGG - Intergenic
937288119 2:120765714-120765736 CAGGGTGGGATGGGCCCCCTTGG + Intronic
937522941 2:122734009-122734031 AAGGGTATCCTGACCTCCCTTGG - Intergenic
938310687 2:130286574-130286596 TTGGGAATCAGGGGCTCCCTGGG - Intergenic
939182048 2:138815002-138815024 CAGGGCTTCCAGGGCTCCCTGGG + Intergenic
939906002 2:147915978-147916000 AAGGGTATCATGAGCTGCCAGGG - Intronic
940178313 2:150904005-150904027 AAGGGTTTCAAGAGCTCCCTGGG - Intergenic
940638167 2:156322230-156322252 CAGGGCGCCATCGGCTCCCTGGG + Intergenic
942423878 2:175838585-175838607 CTGGGTATCATGGGGACCATAGG - Intergenic
948491013 2:238313538-238313560 AAGGGTGTCTTGGGCTGCCTGGG + Intergenic
948721542 2:239904022-239904044 CAGGACAGCCTGGGCTCCCTGGG - Intronic
1169279358 20:4253988-4254010 CAGGGTCTCCAGGGCTCACTGGG - Intergenic
1172906919 20:38377285-38377307 CGGGAGATCATTGGCTCCCTTGG - Intergenic
1178943803 21:36929386-36929408 CTGGGTGTGATGGGCTCACTTGG - Intronic
1178944960 21:36939425-36939447 GAAGGTCTCATGTGCTCCCTGGG - Intronic
1179727322 21:43347718-43347740 CCGGGTGTCCTGGGGTCCCTGGG - Intergenic
1181169444 22:21000057-21000079 AAGGGCATCAAGGGCTGCCTCGG + Exonic
1181372897 22:22432072-22432094 CAGGGTCGCATGGGCTTCCCAGG - Intergenic
1182057742 22:27373271-27373293 CAGTCTGTCATGGGTTCCCTTGG - Intergenic
1182357487 22:29728877-29728899 CAGAGGGCCATGGGCTCCCTGGG + Intronic
1183179473 22:36249680-36249702 CAAGGTAACTTGGGCTTCCTGGG - Intergenic
1183427305 22:37746636-37746658 CAGGGTCGCCTGGGCTCCCGGGG - Intronic
1183691030 22:39388582-39388604 CAGGGTAGCTCGGGCTCCTTGGG - Intergenic
950577970 3:13844448-13844470 CAGGGTCTCAGGGCCTCCCCAGG - Intronic
954214070 3:49114744-49114766 CAAGGTGTGATGGGCTCCCCTGG - Exonic
960565789 3:119130303-119130325 CAGTCTATCATGGATTCCCTTGG - Intronic
961338428 3:126200086-126200108 TAGGGAATCATGGGTTCACTGGG - Intergenic
961408321 3:126699157-126699179 CAGAGTCTCATGGTCACCCTTGG + Intergenic
962987039 3:140545393-140545415 CAGGTTCTCCTGGGCTCTCTTGG - Intronic
963667793 3:148211771-148211793 CAGGGAATCATGGGTTCACCTGG + Intergenic
964270000 3:154945380-154945402 CAGTCTATCATGGCTTCCCTTGG - Intergenic
966392156 3:179464248-179464270 CAGGGAATCAAGAGCTGCCTAGG + Intergenic
969376955 4:6769253-6769275 CAGGGTATCGGGGGCCCTCTCGG + Intergenic
975291170 4:72679556-72679578 CAGTCTATCATGGCTTCCCTTGG - Intergenic
978327835 4:107579310-107579332 CCGGGTAGCATGGGCTCACGAGG - Intergenic
981824339 4:148922835-148922857 CAGGCAATCATGGGTTTCCTTGG + Intergenic
982693399 4:158572715-158572737 CAGGATGTCAAGTGCTCCCTTGG + Exonic
986284695 5:6350732-6350754 AAGGGTATCATGGAGTCTCTGGG + Intergenic
987291568 5:16513197-16513219 CAGGGAATCATGGGCTCATCTGG + Intronic
988772865 5:34449654-34449676 TAGGTTATCATGGGTTCCCCAGG + Intergenic
988912066 5:35853225-35853247 CAGTGTATCATGAGAACCCTGGG - Intronic
998546082 5:143029053-143029075 CAGGGTTGCCAGGGCTCCCTGGG - Intronic
1000214270 5:159139767-159139789 CAGTGTGTCATGGCTTCCCTTGG - Intergenic
1001632450 5:173185897-173185919 AAGGGTCTCAGGGACTCCCTAGG + Intergenic
1002463393 5:179388265-179388287 CAGGATTTCATGTGCTCCCAAGG + Intergenic
1002647742 5:180669349-180669371 CAGGATAGCACGGGCTCCCTTGG - Intergenic
1015305072 6:131697910-131697932 CATGGCTTCATGGGCTCCCTTGG - Intronic
1018398056 6:163395959-163395981 CAGGGTCTGATGGGCTGCTTGGG + Intergenic
1022843957 7:34191510-34191532 GAGGGACTCATTGGCTCCCTTGG + Intergenic
1023771081 7:43557218-43557240 CAGGGTGGCATGGGCTTCCCAGG + Intronic
1023843612 7:44109483-44109505 GAGGCTATCCTGGGCTCCCGGGG - Intronic
1023916837 7:44596343-44596365 CAGTGTTTCATGTGGTCCCTGGG - Intergenic
1025845417 7:65192380-65192402 GAGGGTGTCCTGGGCTCCCCTGG + Intergenic
1025895693 7:65698412-65698434 GAGGGTGTCCTGGGCTCCCCTGG + Intergenic
1029600399 7:101559855-101559877 CAGGGTATATGGGTCTCCCTGGG - Intergenic
1030341518 7:108385990-108386012 CAGGGTGTGATGGGGCCCCTAGG + Intronic
1030511524 7:110488571-110488593 GAGGGTATCATGGGCACTTTGGG + Intergenic
1032285266 7:130534808-130534830 CAGGGGTGCATGGGCTCACTGGG + Intronic
1032286052 7:130539212-130539234 CAGGGGTGCATGGGCTCACTGGG + Intronic
1033409723 7:141106254-141106276 CTGGGCATCATGCACTCCCTAGG - Intronic
1033937136 7:146600198-146600220 CCAGGTATCATGGGTGCCCTAGG - Intronic
1035675162 8:1451015-1451037 CAGGGCATCACTGGCTCACTTGG + Intergenic
1036707926 8:11059165-11059187 CAGGGTTTCGAGGGCTCCCGCGG + Intronic
1037258351 8:16980035-16980057 CAGAGTCTCATGGCTTCCCTTGG + Intergenic
1037615162 8:20512536-20512558 CAAGGGCTCCTGGGCTCCCTTGG + Intergenic
1037758765 8:21728189-21728211 CAGTGTGTCCTGGGCTCCCTGGG - Intronic
1040410861 8:47152990-47153012 CAGTCTATCATGGCTTCCCTTGG - Intergenic
1044956635 8:97488047-97488069 CAGTCTATCATGGCTTCCCTTGG + Intergenic
1045756659 8:105551559-105551581 CAGTGTAGTATGAGCTCCCTGGG + Intronic
1045877468 8:106999243-106999265 CAGGGAATCATGGGATCATTTGG + Intergenic
1049843901 8:144790599-144790621 CAGGGTGCAAGGGGCTCCCTAGG - Intronic
1050326167 9:4500088-4500110 CAGTGTGTCACGGACTCCCTAGG - Intronic
1051726212 9:20089849-20089871 CAGGGGGTCAAGGGCTCACTAGG - Intergenic
1051929009 9:22363529-22363551 CAGGGAGTCTTGGGCTGCCTGGG + Intergenic
1056718296 9:89052106-89052128 CAGGATGTCATCGGCTCCATCGG - Exonic
1058127351 9:101210344-101210366 CAGGGGCTCAGGGGTTCCCTGGG + Intronic
1059644968 9:116256098-116256120 GTGGGAATCATGTGCTCCCTGGG - Intronic
1061840080 9:133353627-133353649 CTGGGTATCTTGGGTTCCCCAGG + Intronic
1062535741 9:137020448-137020470 CGGGGCAACATGAGCTCCCTGGG - Exonic
1185637312 X:1562211-1562233 CAGCCTCTCATGGGCTCCCCCGG - Intergenic
1193811358 X:86055145-86055167 GGAGGAATCATGGGCTCCCTTGG + Intergenic
1194274738 X:91865581-91865603 CAGGGTAACAAGGTCTCTCTGGG + Intronic
1195208157 X:102624895-102624917 CAGGGTATCATGGGCTCACAGGG + Intergenic
1199205693 X:145146211-145146233 CAGTGTAGCATGGGCTCCTCTGG - Intergenic
1199796188 X:151200046-151200068 CAGGCTATCATGGCTTCCCTTGG - Intergenic
1200141479 X:153904892-153904914 CCGGGACTCATGGGCTGCCTGGG + Intronic
1200591980 Y:5086982-5087004 CAGGGTAACAAGGTCTCTCTGGG + Intronic
1202054690 Y:20817751-20817773 CAGGCTGTCATGGCTTCCCTTGG - Intergenic