ID: 917981274

View in Genome Browser
Species Human (GRCh38)
Location 1:180271270-180271292
Sequence TGCCTACAGCAGGCAGGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 223}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917981264_917981274 30 Left 917981264 1:180271217-180271239 CCATGAGAGTGGGGACCTCTCCA 0: 1
1: 1
2: 0
3: 16
4: 177
Right 917981274 1:180271270-180271292 TGCCTACAGCAGGCAGGCTTAGG 0: 1
1: 0
2: 2
3: 26
4: 223
917981267_917981274 -2 Left 917981267 1:180271249-180271271 CCCCTGTGCCTCGCGCTGTCCTG 0: 1
1: 0
2: 4
3: 29
4: 408
Right 917981274 1:180271270-180271292 TGCCTACAGCAGGCAGGCTTAGG 0: 1
1: 0
2: 2
3: 26
4: 223
917981265_917981274 15 Left 917981265 1:180271232-180271254 CCTCTCCACTCTGATGTCCCCTG 0: 1
1: 0
2: 4
3: 27
4: 313
Right 917981274 1:180271270-180271292 TGCCTACAGCAGGCAGGCTTAGG 0: 1
1: 0
2: 2
3: 26
4: 223
917981270_917981274 -10 Left 917981270 1:180271257-180271279 CCTCGCGCTGTCCTGCCTACAGC 0: 1
1: 0
2: 1
3: 9
4: 107
Right 917981274 1:180271270-180271292 TGCCTACAGCAGGCAGGCTTAGG 0: 1
1: 0
2: 2
3: 26
4: 223
917981268_917981274 -3 Left 917981268 1:180271250-180271272 CCCTGTGCCTCGCGCTGTCCTGC 0: 1
1: 0
2: 1
3: 11
4: 216
Right 917981274 1:180271270-180271292 TGCCTACAGCAGGCAGGCTTAGG 0: 1
1: 0
2: 2
3: 26
4: 223
917981269_917981274 -4 Left 917981269 1:180271251-180271273 CCTGTGCCTCGCGCTGTCCTGCC 0: 1
1: 0
2: 1
3: 25
4: 296
Right 917981274 1:180271270-180271292 TGCCTACAGCAGGCAGGCTTAGG 0: 1
1: 0
2: 2
3: 26
4: 223
917981266_917981274 10 Left 917981266 1:180271237-180271259 CCACTCTGATGTCCCCTGTGCCT 0: 1
1: 0
2: 2
3: 29
4: 395
Right 917981274 1:180271270-180271292 TGCCTACAGCAGGCAGGCTTAGG 0: 1
1: 0
2: 2
3: 26
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917981274 Original CRISPR TGCCTACAGCAGGCAGGCTT AGG Intronic
900410484 1:2510411-2510433 TGCTCACAGCAAGGAGGCTTTGG - Intronic
900677697 1:3899286-3899308 TGCCTACAGGAGACAAGTTTTGG + Intronic
901629926 1:10643048-10643070 TGCCCACAGAGGGCAGGCTGAGG + Intronic
904011106 1:27391214-27391236 AGCCTCCACCAGGCAGGTTTTGG - Intergenic
904818250 1:33221303-33221325 GGCCCCCATCAGGCAGGCTTGGG + Intergenic
905003227 1:34689759-34689781 TACAGAGAGCAGGCAGGCTTGGG - Intergenic
905970122 1:42135424-42135446 TGCCATCAGTGGGCAGGCTTGGG - Intergenic
908348619 1:63261941-63261963 TGACTACAACACCCAGGCTTAGG - Intergenic
908525118 1:64980484-64980506 TGCATACTGCAGGGAGGTTTTGG - Intergenic
909919077 1:81357694-81357716 TGGCTGGGGCAGGCAGGCTTGGG + Intronic
912009924 1:104947200-104947222 TGCATAAAGCAAGGAGGCTTTGG - Intergenic
912429531 1:109621647-109621669 TGCCTTTACCAGGCAGGCTTAGG + Intronic
912658058 1:111505295-111505317 TGCCTACAGCATGCTGTGTTTGG - Intronic
914449770 1:147780724-147780746 TGTCTAAAGCTGGCGGGCTTTGG - Intergenic
914847102 1:151289340-151289362 TGCAGACATCAGGCAGGGTTGGG - Intronic
915603964 1:156939381-156939403 CGCCGATATCAGGCAGGCTTTGG - Intronic
916028230 1:160853982-160854004 TGCATACACCAGGCAGGCCTTGG - Intronic
917981274 1:180271270-180271292 TGCCTACAGCAGGCAGGCTTAGG + Intronic
919534620 1:198772075-198772097 TGACGACAGCAGGCAGTCCTGGG + Intergenic
921763349 1:218941833-218941855 TGCCTACAGAAGGCAGTTTGGGG + Intergenic
924008311 1:239636832-239636854 TACCCAAAGCAGGCAGGGTTGGG - Intronic
1063547922 10:7000256-7000278 TGCTTACAGGAGGCAAGCCTAGG + Intergenic
1065949384 10:30638109-30638131 TGCCTACAGCAGGCAGCTCCAGG + Intergenic
1067059297 10:43069749-43069771 TTCCTACAGCAGGCATGGCTAGG - Intergenic
1067180324 10:43980565-43980587 TGGCTACAGCAGGCAGGAACTGG - Intergenic
1068084160 10:52353884-52353906 TGCTGACAGTTGGCAGGCTTTGG - Intergenic
1069777371 10:70934863-70934885 TTCCTCCAGCAGGCAGGCTGGGG + Intergenic
1069783173 10:70969516-70969538 GGCTGACAGCAGGCAGGCTGGGG + Intergenic
1074254130 10:111783399-111783421 TCCCTCCAGCAGGCTGGCTCAGG - Intergenic
1075981681 10:126745807-126745829 TGCCTATGGAGGGCAGGCTTGGG - Intergenic
1076766368 10:132636528-132636550 GGCGTGCAGCAGGCTGGCTTGGG - Intronic
1077046702 11:549882-549904 TCCCTGCAGAAGGCAGGGTTTGG - Exonic
1082050464 11:47766943-47766965 GGCCCGCAGCAGGCAGGCCTCGG + Intronic
1082255250 11:50027092-50027114 TGCACACAGCAGGAAGGCTTTGG - Intergenic
1083897343 11:65626615-65626637 TACGTACAGCAGGCTGGCTAGGG - Intronic
1084297929 11:68225273-68225295 TGCTTACAGCTGGAAGGGTTGGG + Intergenic
1085835777 11:79955115-79955137 TGTCTCCAGCAGGCAGGTTCTGG + Intergenic
1086193057 11:84103325-84103347 TCCCTGCAGCTGGCAGGCTCTGG - Intronic
1086542729 11:87932080-87932102 TGGCTATAGCTGGTAGGCTTGGG - Intergenic
1088914013 11:114213132-114213154 TCCCTACAGCAGCCAGGCCATGG - Intronic
1089007032 11:115100815-115100837 TGCTAACAGCTGGCAGGCTGCGG - Intergenic
1090071463 11:123548000-123548022 TGCCTACCTCAGGCAGGCTCCGG + Intronic
1095138317 12:38633814-38633836 CACCTAAAGCAGGGAGGCTTTGG + Intergenic
1096295886 12:50383678-50383700 TGGCTGCAGCAGGCTGGCTGTGG + Intronic
1096871078 12:54592526-54592548 TCCCTGCAGCTGGCAGTCTTGGG + Intergenic
1100747520 12:97661931-97661953 TGCACACAGCAGGGAGGCCTTGG + Intergenic
1101777338 12:107806509-107806531 GGCCTCCAGCAGCCAGGCCTTGG - Intergenic
1102188810 12:110970380-110970402 AGCCTTCACCAGGCTGGCTTGGG - Intergenic
1102587786 12:113935189-113935211 TGGCAACAGGAGGCAGGCTGGGG - Intronic
1103219591 12:119232508-119232530 TGCAGACAGCAGGCAGGGCTGGG + Intergenic
1103658065 12:122490302-122490324 TGGCTAAACCAGTCAGGCTTCGG + Intronic
1107432455 13:40352202-40352224 TGCCCGCGGCAGGCAGGCTGGGG - Intergenic
1107435928 13:40380852-40380874 TGCCTGCAGCAGTCAGGGCTGGG - Intergenic
1109711345 13:66164880-66164902 GGCATACAGCCGGCAGGCTGTGG + Intergenic
1110013633 13:70371120-70371142 TCCCTGCAGCAATCAGGCTTAGG - Intergenic
1112227135 13:97550948-97550970 TGCCCCCAGCAGATAGGCTTGGG - Intergenic
1113771407 13:112911484-112911506 AGCCTGCAGCAGGCAGGATCCGG - Intronic
1116542213 14:46112649-46112671 TGCATACAGCAGGGAGGCCCTGG - Intergenic
1118458464 14:65966392-65966414 TGCCTGCAGGAGGCAGGCCAAGG - Intronic
1118617843 14:67587150-67587172 TTCCCACAGCTGGCAGGCTCCGG - Exonic
1118974820 14:70667558-70667580 AGCCTGGAGCAGGCAGGCTATGG - Exonic
1120630242 14:86881651-86881673 AGCCTAGAGCAGGCAGGGATGGG + Intergenic
1120876211 14:89378450-89378472 CACTTACAGCAGGCAGACTTGGG - Intronic
1121643487 14:95501860-95501882 GGCCTAGAGCAGGCAGGGGTTGG + Intergenic
1121826732 14:97016355-97016377 TGCCTGAAGCTGGCAGGCGTTGG + Intergenic
1122053106 14:99073612-99073634 TTCCCACAGCAGGGAGGCTGGGG + Intergenic
1122114776 14:99522227-99522249 CCCCTGCAGCAGGCAGGCTCCGG - Exonic
1122159425 14:99772560-99772582 TGACAAAAGCAGGCAGGTTTTGG - Intronic
1122192539 14:100057564-100057586 TTCACAGAGCAGGCAGGCTTAGG + Intronic
1122696570 14:103556132-103556154 AGCCCACAGCAGGCAGGCCTGGG - Intergenic
1125841064 15:42801582-42801604 TGCCAACCGCAGCCAGGCTGAGG - Intronic
1127979338 15:64023220-64023242 TGACTACTGCAGGCAGGGTTGGG - Intronic
1128494045 15:68181254-68181276 TGTCTACAGCAGGAAGGCTTGGG - Exonic
1128509591 15:68305174-68305196 TGCCTACAGCAGGCACGCCATGG - Intronic
1129966615 15:79741937-79741959 TGGCTTAAGCAGGCAGGATTGGG + Intergenic
1130986799 15:88849620-88849642 TCCCCACCGCAGGCAGGCCTTGG - Exonic
1131388280 15:92026051-92026073 TGTGTGCAGCAGGGAGGCTTTGG + Intronic
1131464850 15:92646677-92646699 AGCCTCCAGGTGGCAGGCTTTGG - Intronic
1131514468 15:93067883-93067905 TTGCAACAGCAGACAGGCTTAGG - Intronic
1132414903 15:101612953-101612975 TGCCACCAGCAGCCAGGCTTGGG - Intergenic
1132882704 16:2169554-2169576 GGCTGACAGCAGGCAGGCCTGGG - Intronic
1133830155 16:9315549-9315571 AGCCTGCAGTAAGCAGGCTTTGG - Intergenic
1137332588 16:47514025-47514047 TGCCTAGAGCTGGGGGGCTTTGG - Intronic
1137886200 16:52106476-52106498 TCCCTAAAGCAGGCAACCTTGGG - Intergenic
1140146932 16:72320146-72320168 TGCACAGAGCAGGCAGGCTGTGG + Intergenic
1141423543 16:83931807-83931829 TGCCTATCTCAGCCAGGCTTGGG + Intronic
1142186952 16:88699169-88699191 AGCCTACAGAGGGCAGGCCTGGG - Intronic
1143104405 17:4521441-4521463 TGCCCAGAGCAGGCCGGCCTTGG - Intronic
1143695365 17:8611283-8611305 TGCTTTGGGCAGGCAGGCTTAGG - Intronic
1143763311 17:9120594-9120616 TGCCTACATCTGGCTGCCTTTGG + Intronic
1145202268 17:20956974-20956996 TGCCTACAGGAGCCTGGCTGAGG + Intergenic
1145238927 17:21228263-21228285 TGTCTACAGCAGCCTGGGTTGGG + Intergenic
1145249121 17:21287891-21287913 TGGCCACAGCAGGCAGGGCTAGG - Intronic
1147419640 17:40316087-40316109 TGCCTTCTGCAGTCAAGCTTGGG + Intronic
1148103035 17:45104313-45104335 TGCCTACAGCAGGCTGGGCTGGG - Intronic
1150995280 17:70310104-70310126 AGCCTACAGCAAGCAAGCTCGGG - Intergenic
1151342268 17:73479393-73479415 TTCCTGCAGCAGGAAGACTTAGG + Intronic
1151355029 17:73553259-73553281 TCCCTACTGGAGGCAGCCTTGGG - Intronic
1151776371 17:76205927-76205949 TGCCTACAAAAGGCAGGCAGAGG + Intronic
1152888471 17:82866482-82866504 TGCCGTCAGCAGCCAGGCCTTGG + Intronic
1157063592 18:44321405-44321427 TGCCAACCGCAGCCAGGCTGAGG - Intergenic
1159971945 18:74666109-74666131 TGCACACAGCAGTCAGGCTGAGG - Intronic
1160414244 18:78696956-78696978 AACCTGCAGAAGGCAGGCTTTGG - Intergenic
1160560130 18:79750955-79750977 TGGGTACAGAGGGCAGGCTTGGG + Intronic
1160560201 18:79751160-79751182 TGGGTACAGAGGGCAGGCTTGGG + Intronic
1161879981 19:6942418-6942440 TCCCTCCAGCAGGCGGGCTTGGG - Intergenic
1162084614 19:8240985-8241007 TTCAAACAGCAGCCAGGCTTGGG + Intronic
1164375176 19:27677869-27677891 TGCCTACTGCAGGCACTCTCAGG - Intergenic
1164817104 19:31212844-31212866 TGCCTACTGAAGGCAGTCTTGGG - Intergenic
1166247183 19:41537604-41537626 TGCCTGCTGCAGGCATGCCTAGG - Intergenic
1168087252 19:54057226-54057248 TACGTGCATCAGGCAGGCTTTGG + Intronic
925133910 2:1513208-1513230 TTCCTCATGCAGGCAGGCTTGGG - Intronic
925476195 2:4218526-4218548 TGCCTAAAGCATACAGCCTTAGG + Intergenic
926742791 2:16126170-16126192 TGCCCCCAGCACACAGGCTTGGG + Intergenic
930714902 2:54584186-54584208 AACCTACAGCATACAGGCTTCGG - Intronic
931894491 2:66713934-66713956 TGAGTTTAGCAGGCAGGCTTAGG - Intergenic
932308515 2:70720901-70720923 TGCCTCCAGCAGGGAGGCAAGGG - Intronic
932377868 2:71254175-71254197 TGCTTACTGAAGGCAGACTTAGG - Intergenic
933390673 2:81662861-81662883 TGGCTAGAGCAGCAAGGCTTTGG + Intergenic
933527593 2:83463047-83463069 TGACCAGAGCAGTCAGGCTTTGG + Intergenic
934605325 2:95690786-95690808 TGCCTCCTGCAGGCAGGCTGTGG + Intergenic
935328173 2:101956673-101956695 AGCCTGCAGCAGGCCAGCTTGGG + Intergenic
936258704 2:110938357-110938379 TGCCTACAGCAGGCACTCTGTGG + Intronic
936538782 2:113333339-113333361 TGCCTCCTGCAGGCAGGCTGTGG + Intergenic
937917231 2:127105322-127105344 TGCCTGGAGCAGGCAGCCCTGGG - Intronic
943620258 2:190140645-190140667 TGCATACAGCAGGGAGGCCCTGG + Intronic
947582595 2:231330789-231330811 TGGCTAAAGGAAGCAGGCTTTGG + Intronic
947582602 2:231330829-231330851 TGGCTAAAGGAAGCAGGCTTTGG + Intronic
947838312 2:233190606-233190628 TGCCCAGACCAGGCAGGCTGTGG + Intronic
948240536 2:236429525-236429547 TGGCTACAGGAGTCAGCCTTGGG + Intronic
948401198 2:237686834-237686856 TGCAGACAGCAGGCAGGGTCTGG + Intronic
948558392 2:238834068-238834090 AGCCTGGAGCAGGCAGGCTTCGG + Intergenic
1168997661 20:2145092-2145114 TGGCTGCAGCAGACAGGCATGGG - Exonic
1170798954 20:19574610-19574632 TTCCTCCAGCAGGCTAGCTTGGG + Intronic
1170804469 20:19617622-19617644 TGCCTGCAGGAGGGCGGCTTGGG + Intronic
1172522320 20:35576089-35576111 AACCTACAGAAGGAAGGCTTTGG - Intergenic
1173457491 20:43215311-43215333 TGCCCCCAGAAGGCTGGCTTTGG + Intergenic
1175870551 20:62207608-62207630 TTCGAACAGCAGGCAGGGTTGGG - Intergenic
1175997950 20:62819758-62819780 TGGCTACAGCAGGCAGACAGTGG + Intronic
1178746732 21:35258835-35258857 TGCCTTTAGCAGGCTGCCTTGGG + Intronic
1181335456 22:22125035-22125057 TGCCCACAGCTGGCGGGGTTTGG + Intergenic
1181998073 22:26898612-26898634 TGCCTAAATCTTGCAGGCTTCGG - Intergenic
1182710583 22:32320514-32320536 TGCAGAGACCAGGCAGGCTTGGG + Intergenic
1183905103 22:41034596-41034618 TGCATGCAGCAGGAAGCCTTGGG + Intergenic
1184426292 22:44411007-44411029 TGCCCACAGCAGGAGGGCCTGGG - Intergenic
1185167574 22:49271136-49271158 AGCCAACAGCAGGCAAGATTTGG + Intergenic
1185273450 22:49939055-49939077 TGCCAGGAGCAGGCAGGCCTGGG + Intergenic
949243386 3:1896462-1896484 TGACAAAAGCAGGCAGGCTTCGG + Intergenic
949510865 3:4765561-4765583 TCCCTACAGAAGGCAGTCCTAGG - Intronic
950098485 3:10343661-10343683 TGTCCACAGCAGCCAGACTTTGG + Intronic
950456035 3:13093315-13093337 TCCCTGCAGCAGGCAGGGCTGGG - Intergenic
952828866 3:37546495-37546517 AGCCTTCAGCAGGCAGGATGGGG - Intronic
953358758 3:42276826-42276848 TTACTCCAGCAGGCAGGGTTGGG + Intergenic
953485670 3:43292643-43292665 TGCCTACAGCTGGCTGGCTTAGG - Intronic
953848090 3:46444738-46444760 GGCCCACAGCAGGCAGGGTGTGG + Intronic
954757023 3:52846087-52846109 TGTGTACAGCTGACAGGCTTGGG - Intronic
955330796 3:58045375-58045397 TGCCTACAGCCTGCAGTCTGTGG - Intronic
955878423 3:63518607-63518629 TGCCCACAGCTGGCAGGTATAGG - Intronic
957566343 3:81888957-81888979 TGCCTGCAGCAGTCAGCCTGCGG - Intergenic
958944526 3:100348797-100348819 TACCAACAGCTGGCAGCCTTGGG - Exonic
958990257 3:100835091-100835113 TCCCAAAAGCAGGCAGGCCTGGG - Intronic
959113827 3:102152367-102152389 TGAATACAGCAGAGAGGCTTGGG + Intronic
960182226 3:114594130-114594152 TGCCTAAAGTAGGCAAGATTTGG - Intronic
960909120 3:122631071-122631093 TGAATACAGCAGGCAAGCCTGGG - Intronic
961338325 3:126199242-126199264 TGGTTACAGCAGGCAGGCCTAGG + Intergenic
961497493 3:127304989-127305011 TCCCTTTGGCAGGCAGGCTTTGG + Intergenic
961505298 3:127367043-127367065 TGCCTACAGGGGGAAGGTTTGGG + Intergenic
962847044 3:139282030-139282052 TGCCTATAGCAGGCAGGTCTGGG + Intronic
968892897 4:3380755-3380777 TGCATAGAGCAGGGAGGCCTTGG + Intronic
969621247 4:8280025-8280047 TGCCTGGAGGAGGCAGGATTAGG + Intronic
970198899 4:13581737-13581759 GGCTTACAGCAGGCAGGGCTGGG + Intronic
971912361 4:32810480-32810502 TGCACACAGCAGGCAGCCCTTGG + Intergenic
978372792 4:108046017-108046039 TGCCTACAGAAAGCAGGATTTGG + Intergenic
979764432 4:124446970-124446992 TGCATACAGCAGGGGGGCTCTGG + Intergenic
979974648 4:127182011-127182033 TGCCTAAAACTGGCAGCCTTTGG - Intergenic
981635855 4:146878157-146878179 TGACTACAGAAGGCAACCTTGGG + Intronic
981915136 4:150024945-150024967 TTCCTGCAGCAGGCAGGCCAGGG + Intergenic
983762673 4:171431806-171431828 TGGCTACAGAAAGCAGGCTTAGG - Intergenic
984454252 4:179945074-179945096 TACATACAGCAGGGAGGCTTTGG - Intergenic
985005673 4:185532985-185533007 GGCCTTCAGAATGCAGGCTTTGG + Intronic
986253612 5:6083360-6083382 TGCCCAGAGCAGGCAGGAGTTGG - Intergenic
986877890 5:12132795-12132817 TGGCTACAGGAGGCAGGAATGGG - Intergenic
986900170 5:12421614-12421636 TGCATACAGCAGGGAGGCCCTGG - Intergenic
987264286 5:16235909-16235931 CCCCCTCAGCAGGCAGGCTTTGG + Intergenic
989787107 5:45345226-45345248 TGCACACAGCAGGCAGCCTGTGG + Intronic
990945572 5:61245665-61245687 TGCCTTCAGAATGCAGGCCTAGG - Intergenic
992158085 5:73974229-73974251 AGCCAAAGGCAGGCAGGCTTAGG + Intergenic
992701336 5:79344426-79344448 TGCCGACGGCAGGCAGCCTCTGG - Intergenic
995427825 5:112044429-112044451 TGCCTTCAGCTGGCAGGGTGAGG - Intergenic
995621657 5:114032264-114032286 TCCCTACAGGAGGCAGCCTCTGG + Intergenic
995755851 5:115503174-115503196 TGCCTGCAGAAGGTAGGTTTGGG + Intergenic
997036868 5:130203023-130203045 TGCACACAGCAGGCAGGCCCTGG + Intergenic
997585491 5:135040703-135040725 TCCCAACAGCAAGCAGGCTCAGG - Intronic
997721073 5:136078882-136078904 TACCCACAGCAGGAAGGATTTGG + Intergenic
998599065 5:143566322-143566344 TGCCTCCAGCGGGCCTGCTTGGG + Intergenic
1000125184 5:158237031-158237053 TGGCTGCAGCAGGCAGTCTAAGG - Intergenic
1007545550 6:42690952-42690974 TGCCTAAATCAGGAAGGGTTGGG + Intronic
1007616156 6:43180763-43180785 TTCCTACTGAAGGCAGTCTTAGG - Exonic
1009911584 6:69936785-69936807 TGCCCAGAGCAGGATGGCTTTGG + Exonic
1013347677 6:109277840-109277862 TGCATGCAGCACACAGGCTTGGG + Intergenic
1016359191 6:143249901-143249923 TGCCTGCAGAAGGCTGTCTTTGG + Intronic
1018610734 6:165645324-165645346 TGACTGCAGCAGGCAGGAGTAGG - Intronic
1019342143 7:513338-513360 CGGCTACAGCAGACAGGCTGGGG + Intronic
1019841013 7:3444190-3444212 GGCCAACAGCTGGCAGACTTGGG - Intronic
1020276554 7:6628179-6628201 TGCCAACAGGAGGCAGCCTAGGG + Intergenic
1021383406 7:19997041-19997063 TGCCTATAGCTAGGAGGCTTGGG - Intergenic
1023845875 7:44120003-44120025 AGCCTACAGCAGGAAGGTCTGGG + Intronic
1024283638 7:47738949-47738971 TGCCTCCAGCAGCCTGGCCTTGG + Intronic
1024388556 7:48781245-48781267 TGGCTACTGCAGGCAGGACTTGG + Intergenic
1024617999 7:51132196-51132218 TGCCTAAAGCAGGGAGGGCTGGG - Intronic
1027150725 7:75731717-75731739 TACCTGCAGGAAGCAGGCTTAGG + Intronic
1028957749 7:96713017-96713039 TGCATACAGCAGGGGGGCTCTGG - Intergenic
1029176698 7:98669792-98669814 TGCCTTCGGCTGGCAGGCCTGGG + Intergenic
1029244836 7:99191521-99191543 TGCTAGCAGCAGGGAGGCTTTGG - Intronic
1029847292 7:103425375-103425397 AGCCTCCAGGAGGCAGGCTTGGG + Intronic
1031403365 7:121353007-121353029 TGCCTCCTGCAGAGAGGCTTTGG + Intronic
1035786616 8:2266231-2266253 CGGCTGGAGCAGGCAGGCTTGGG + Intergenic
1035806191 8:2455485-2455507 CGGCTGGAGCAGGCAGGCTTGGG - Intergenic
1036621346 8:10426050-10426072 TGCCCACTGAAGGAAGGCTTTGG - Intronic
1038731487 8:30132059-30132081 TGCCTACATCATGCTGGCTGTGG - Exonic
1039490186 8:37941751-37941773 TGCCTAAATCAGGCAGTCATTGG - Intergenic
1040600348 8:48878023-48878045 TGCCTCCTGCAGGCTGGCTCTGG - Intergenic
1040952133 8:52947971-52947993 TGGCTACAGCGGCCAGGCTGGGG + Intergenic
1042649495 8:71024009-71024031 TGTCTCCAGCTGGCATGCTTGGG + Intergenic
1044974827 8:97654052-97654074 TGACTACAGCAGGGATGCTCAGG - Intronic
1045267291 8:100630547-100630569 TGCCTATAGGAGGCAAGCTTTGG - Intronic
1045490126 8:102661824-102661846 TGCCAAGAGCAAGCAGGATTCGG + Intergenic
1047241821 8:123097288-123097310 TGCCTCCAGCAGCCAGGATTCGG - Exonic
1048265618 8:132983100-132983122 TGCCTACTGCAGAGAGGCTGGGG - Intronic
1049784362 8:144443578-144443600 TGCCTCCAGCAGCCAGGGTCAGG + Intronic
1052397838 9:27962497-27962519 TGCCTACAGCAGGCTTGCCGGGG - Intronic
1056890663 9:90488828-90488850 TGCCTCCAGCTCGCTGGCTTTGG - Intergenic
1057064053 9:92032462-92032484 TGCCTAGAGCAGGACGGCCTGGG + Exonic
1057087320 9:92223314-92223336 TCCCCACAGCAGGCAGACTGTGG - Intronic
1057565232 9:96160934-96160956 AGCCTGGAGCAGGCAGTCTTTGG + Intergenic
1057855343 9:98596909-98596931 TGCCTAAGGCTTGCAGGCTTTGG - Intronic
1058210492 9:102161705-102161727 TGCAAACAGCAGGTAGGCCTAGG + Intergenic
1058847760 9:108978887-108978909 TGGCTCCAGCAGTCAGGCTCAGG + Intronic
1059444209 9:114328130-114328152 TGCCCACAGCACGGAGGCTGGGG + Intergenic
1059445418 9:114334909-114334931 TGCCCACAGCACGGAGGCTGGGG + Exonic
1060194029 9:121611391-121611413 TGAGTACAGCAGACAGGCTAAGG + Intronic
1060778549 9:126394638-126394660 GGCCTCCAGCTGCCAGGCTTTGG - Intronic
1061924878 9:133801086-133801108 TGCCTGGTGCAGGCAGGCTCCGG - Intronic
1062116785 9:134813885-134813907 GGCAGACAGCAGGCAGGATTTGG + Intronic
1062400862 9:136372078-136372100 TGGCCTCAGCAGGCAGGCTGGGG + Exonic
1186784752 X:12946993-12947015 TGCCTACAGCCTTTAGGCTTTGG + Intergenic
1192143670 X:68665983-68666005 TTCCAACAGGAGGTAGGCTTTGG + Intronic
1195482235 X:105359016-105359038 TTCCTTCATCAGGCAGTCTTTGG + Intronic
1197887739 X:131235922-131235944 CTCCTCCAGCAGGCAGTCTTAGG + Intergenic
1197894151 X:131292941-131292963 TGCCTAGAGCAGGCAGGCACAGG + Intronic
1200710571 Y:6481316-6481338 TGCCTGCAGCAGGAGGCCTTGGG + Intergenic
1200884953 Y:8258515-8258537 TGCCTGCAGCAGGAGGGCATGGG + Intergenic