ID: 917981420

View in Genome Browser
Species Human (GRCh38)
Location 1:180271955-180271977
Sequence GAGAGCTCTGCAGAGGACTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 428}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917981417_917981420 2 Left 917981417 1:180271930-180271952 CCGGGGCAGCAGCAAGCAGGAGA 0: 1
1: 0
2: 5
3: 63
4: 477
Right 917981420 1:180271955-180271977 GAGAGCTCTGCAGAGGACTGTGG 0: 1
1: 0
2: 5
3: 41
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917981420 Original CRISPR GAGAGCTCTGCAGAGGACTG TGG Exonic
901785221 1:11620116-11620138 GAGGGCTCTGCAGATGAGAGAGG + Intergenic
902206685 1:14873480-14873502 GTGAGCTATGCAGAGATCTGAGG + Intronic
902621780 1:17654989-17655011 GGGAGCTGTGCAGAGGACCTGGG + Intronic
902746754 1:18479774-18479796 GAGACCCCTGCACAGGACTTTGG + Intergenic
903262634 1:22139641-22139663 GAACGATCTGCTGAGGACTGTGG + Intronic
904417077 1:30369632-30369654 GAGAGCAGTGGAGAGGACTGTGG - Intergenic
904551055 1:31318467-31318489 GACAACTCTGCAGAAGACTGAGG + Intronic
905118973 1:35667117-35667139 GAGAGCTCTGGAGAGGGCAGAGG - Intergenic
905173581 1:36123271-36123293 GAGAGTTCTGGAGCGGGCTGGGG + Intronic
905374393 1:37509358-37509380 GAGTGCTCTTCTGAGGTCTGTGG - Intronic
906067434 1:42992127-42992149 GAGAGCTAATCACAGGACTGTGG - Intergenic
906239951 1:44236698-44236720 GAGAGGGCAGCAGAGGACAGAGG + Intronic
906243541 1:44257413-44257435 GAAAGCTCTGCCCATGACTGAGG - Intronic
906796356 1:48699161-48699183 GGGAGCTCTGCATAGGACCCAGG + Intronic
907469707 1:54665330-54665352 GAGAGCTGGGCAGAGGCATGGGG - Intronic
907490228 1:54804683-54804705 GAGACCTTTACAGAGGCCTGAGG - Intergenic
907988493 1:59556077-59556099 GAGAGATCTGCAGAGGCCTGAGG + Intronic
908246067 1:62228574-62228596 GAGAGGTCTGGAAAGGGCTGCGG - Intergenic
910833532 1:91484256-91484278 GGGAGCACTGCAGGAGACTGGGG + Intergenic
911079656 1:93916141-93916163 GACAGCTCTGAAGAGAACAGTGG - Intergenic
911596473 1:99803741-99803763 GAGAGCTGAGCAGAGGAATTGGG - Intergenic
914441505 1:147711572-147711594 GAGAGCTCTGAAGAGAGCAGTGG - Intergenic
915069555 1:153254924-153254946 GAGAGCTCTGCAGTGGTTCGTGG - Intergenic
915077302 1:153319821-153319843 GACAGCTCTGAAGAGAACAGTGG - Intergenic
915724423 1:158007564-158007586 GACACCTCAGGAGAGGACTGGGG + Intronic
916116552 1:161489740-161489762 GTGAGGTGTGCAGAGGACTTGGG + Intergenic
916379726 1:164196036-164196058 GACAGCTCTGAAGAGGACAGCGG + Intergenic
916793415 1:168144172-168144194 GGGCTCTCTGCAGAGTACTGAGG - Intergenic
916814905 1:168342491-168342513 GAGCTCTCTGCAGGGGAATGAGG + Intergenic
917222803 1:172749417-172749439 TAGAGTTCTGCAGAGGGCTCGGG - Intergenic
917286130 1:173423394-173423416 GAGAGCTTTGCAGAGGAAGTGGG - Intergenic
917579104 1:176356463-176356485 GACAGCTCTGAAGAGGGCAGTGG + Intergenic
917981420 1:180271955-180271977 GAGAGCTCTGCAGAGGACTGTGG + Exonic
918513655 1:185338912-185338934 GAGAAGTCTGCAGCGGCCTGTGG - Intergenic
920345146 1:205301558-205301580 GAATGCTCTGCAGGGGGCTGAGG + Intergenic
921070050 1:211651052-211651074 GGGTGCTCTGCTGAGGACAGGGG - Intergenic
921993806 1:221395912-221395934 GAGAGCTCTGAAGAGGCCCCGGG + Intergenic
923457316 1:234175761-234175783 CAGCTCTCTGCAGAGGACAGAGG + Intronic
1063136647 10:3222829-3222851 AAGAACTCTGCAGAGGAGGGCGG - Intergenic
1063437455 10:6046036-6046058 GAGAGCTCTGGAGAGGGTTCTGG - Intronic
1065997664 10:31074499-31074521 GAGAGCTCTGCAGAGGAGAGGGG + Intergenic
1067211489 10:44263236-44263258 GAGATCTCAGCTGAGGTCTGGGG - Intergenic
1067535579 10:47107461-47107483 AGCAGCTCTGCACAGGACTGGGG + Intergenic
1067665564 10:48274962-48274984 AAGAGCTCTGCAAGGAACTGGGG + Intergenic
1067681390 10:48443649-48443671 GAGGGCTCTGCAGGGGCCTGGGG + Intergenic
1069782573 10:70966026-70966048 TAGTGCTCTGCAGAGCCCTGGGG + Intergenic
1069885103 10:71618641-71618663 GAGGGCTCTCCCGAGGACGGTGG - Intronic
1070329859 10:75409225-75409247 GGGAGCGCTGCAGGGCACTGGGG - Intergenic
1070551978 10:77497041-77497063 CAGACCTCTGCAGAGGCCTTGGG - Intronic
1070818000 10:79337252-79337274 GAGAGCTCAGCACAGTACTTAGG + Intergenic
1070912930 10:80133619-80133641 GAGAGCTGTGCGGAGGAGAGAGG + Intronic
1072138310 10:92568047-92568069 GAGAGCTTTGCAGAGAACATAGG - Intronic
1072737613 10:97889519-97889541 GAGAGCTCTGCACAACACAGTGG + Intronic
1073087365 10:100901637-100901659 GAGTGACCTGGAGAGGACTGGGG + Intergenic
1073944159 10:108730918-108730940 GTGAGATGTGCAGAGGACTTGGG + Intergenic
1074631425 10:115259137-115259159 GACAGCTCTGAAGAGGGCAGTGG - Intronic
1074777239 10:116775392-116775414 GAGAGCCCTGGGGAGGACGGGGG + Intergenic
1075086939 10:119419925-119419947 CTGAGCTCTGCAGAGTACCGGGG + Intronic
1076427858 10:130380275-130380297 TGCAGCTGTGCAGAGGACTGTGG + Intergenic
1076450717 10:130555283-130555305 GAGAGCTCAGCAGAAGACAGAGG + Intergenic
1076451033 10:130557117-130557139 GAGGACTCTGCAGAGTCCTGAGG - Intergenic
1076482435 10:130793295-130793317 GAGAACTCTGAATAGCACTGGGG - Intergenic
1077374151 11:2197722-2197744 GAGACCTCTGCACTCGACTGTGG - Intergenic
1077530002 11:3090590-3090612 GAGAGCTCTGGGCAGGACTCAGG + Exonic
1077907078 11:6542994-6543016 GGTAGCTGTGTAGAGGACTGTGG + Intronic
1078763479 11:14271484-14271506 GAGTGCTGTGCAGAGGATGGGGG - Intergenic
1078777947 11:14410928-14410950 CAGAGCTCTGCAAAGCACAGTGG - Intergenic
1079270659 11:18982830-18982852 GTGAGATGTGCAGAGGACTTGGG + Intergenic
1080346817 11:31334919-31334941 GACAGCTCTGAAGAGAACAGTGG - Intronic
1081143786 11:39536321-39536343 GACAGCTCTGAAGAGAACAGTGG - Intergenic
1081575753 11:44317721-44317743 GACAGCTCTGCCCAGGACAGTGG - Intergenic
1083003638 11:59321001-59321023 GACAGCTCTGAAGAGAACAGTGG - Intergenic
1083275239 11:61593369-61593391 GTGAGCTCACCAGAGGAATGAGG + Intergenic
1083325506 11:61871076-61871098 GGGAGCTCAGCTCAGGACTGAGG + Intergenic
1083872508 11:65497753-65497775 GAGACTTCTGTAAAGGACTGGGG + Intergenic
1084589751 11:70083896-70083918 GAGAGACCTGCAGAGGCCAGAGG + Intronic
1084643445 11:70439901-70439923 GTGGGTTCTGCAGGGGACTGGGG - Intergenic
1085338759 11:75717834-75717856 GTGAGCTCTGCTGTGGTCTGAGG - Exonic
1085428513 11:76426159-76426181 GAGACGTCTGCAGAAGGCTGTGG - Intergenic
1086732269 11:90265068-90265090 GAGACTTTTGCAGAAGACTGAGG - Intergenic
1087898311 11:103611938-103611960 GACAGCTCTGAAGAGAACAGTGG + Intergenic
1088923892 11:114281393-114281415 GAGAGATGTTCAGAGCACTGGGG + Intronic
1089496986 11:118912957-118912979 GAGAGAGCTTCTGAGGACTGAGG - Intronic
1089687477 11:120165187-120165209 AAGAGCACTTCAGAGGTCTGTGG - Intronic
1089752304 11:120660464-120660486 GAGAGTGCTGCACAGGACTTGGG + Intronic
1090606189 11:128425024-128425046 GAGAGCTCCACTGAGGCCTGTGG - Intergenic
1090972872 11:131657967-131657989 GTGAGCTCTGAAGAGACCTGAGG + Intronic
1091191632 11:133700317-133700339 GGGACCTCTGCAGAGTCCTGAGG - Intergenic
1092006777 12:5076795-5076817 AAGAGGGCTGCAGAGGGCTGAGG + Intergenic
1092534960 12:9378985-9379007 GAAGGCTCTTCAGGGGACTGTGG + Intergenic
1093271792 12:17071834-17071856 GTGAGCTTGGCAGAGGTCTGTGG + Intergenic
1094395633 12:30002527-30002549 GAAAGCTCTGTATAGGAGTGTGG + Intergenic
1094719724 12:33052185-33052207 GTGAGCGGTGCAGGGGACTGTGG - Intergenic
1096513155 12:52143034-52143056 GAGGGCTCTGCAGGGCACTGAGG + Intergenic
1097004028 12:55902093-55902115 GAGAGCCCTGTGGAGCACTGGGG + Exonic
1097749624 12:63337495-63337517 GACAGCTCTGAAGAGAGCTGTGG + Intergenic
1097980057 12:65729214-65729236 GGGAGCGGTGCAGAGGACCGGGG - Intergenic
1099086947 12:78257652-78257674 GAGAGCTCTGAAGAGAGCAGTGG - Intergenic
1099522568 12:83682141-83682163 GACAGCTCTGAAGAGAACAGTGG + Intergenic
1100830556 12:98513128-98513150 GAGTGCTCCTGAGAGGACTGAGG + Intergenic
1101874575 12:108589898-108589920 GAGAGCTGTGCAGAGGTTGGGGG + Exonic
1103216714 12:119207366-119207388 GAGAGCCCTGTACAGGCCTGGGG + Intronic
1104388818 12:128374456-128374478 GAGCACTCTGCAGAGGGGTGTGG + Intronic
1104901285 12:132190722-132190744 CAGAGCTGTGCTGAGGTCTGTGG - Intergenic
1104909048 12:132230859-132230881 GGGAGCCCTGCAGTGGCCTGCGG - Intronic
1106136317 13:26976223-26976245 GAGAGCACTGCCGAGGGCTGTGG - Intergenic
1106688129 13:32084119-32084141 GAGAATTCTGCAGAGGACACAGG - Intronic
1106919456 13:34548081-34548103 AATAACTCTGGAGAGGACTGGGG + Intergenic
1106976721 13:35226359-35226381 GAGAGTTCTGAGGAGAACTGTGG - Intronic
1107189273 13:37560079-37560101 GTGAGATGTGCAGAGGACTTGGG + Intergenic
1113170597 13:107498339-107498361 AAGAGCTTGGGAGAGGACTGTGG + Intronic
1113378369 13:109783832-109783854 GAGAGCTCCCCCGAGGACAGTGG - Exonic
1113587589 13:111475949-111475971 GTGAGCTCTGCAGAAGAGTGAGG + Intergenic
1113844745 13:113380442-113380464 GAAAGTTCTGGAGAGGACAGTGG - Intergenic
1115897892 14:38110556-38110578 GAGAGCTAGATAGAGGACTGTGG - Intergenic
1115961129 14:38837111-38837133 GATGGCTCTGCAGTGGCCTGAGG - Intergenic
1116502541 14:45637982-45638004 GAGACCTCAGTATAGGACTGGGG + Intergenic
1117257053 14:53988688-53988710 GAAATCTCTGCAGAGTCCTGAGG + Intergenic
1117619299 14:57568136-57568158 GAGCTCTCTGCAGTGCACTGGGG + Intronic
1118474481 14:66103888-66103910 GGGAGCTATGCAGAGAAGTGAGG - Intergenic
1118590121 14:67394926-67394948 GAGTTCTCTGCAGAGTCCTGAGG - Intronic
1118600367 14:67467778-67467800 GAGTGTTCTGCAGAGAAATGTGG + Intronic
1119207628 14:72806431-72806453 GAGAGATGAGCAGAGGACTAAGG - Intronic
1119485701 14:74985111-74985133 GACAGCTCTGCAGAGCCCAGTGG - Intergenic
1122299937 14:100725745-100725767 GGGAGCTCTGCAGAGGAAGAGGG + Intronic
1122315051 14:100821067-100821089 CAGAGAACTGCAGAGGCCTGGGG - Intergenic
1122444262 14:101757805-101757827 GAGAGGTTCCCAGAGGACTGAGG - Intergenic
1122612086 14:102992083-102992105 GAAAGTTCTGCATAGCACTGTGG + Intronic
1123205736 14:106711373-106711395 GAGAGCACTGCAGAGCCCCGTGG - Intergenic
1124197741 15:27647612-27647634 AAGAGTACTGCAGAGGACAGTGG + Intergenic
1124648487 15:31457451-31457473 GAGAGTGATGCAGAGAACTGGGG - Intergenic
1124715173 15:32053104-32053126 CAGAGCCCTGAAGAGGGCTGTGG + Intronic
1125972251 15:43921452-43921474 GAGAGCTCAAGAAAGGACTGAGG + Intronic
1127147789 15:56042796-56042818 GTGAGCTGTACAGAGGATTGAGG + Intergenic
1127454492 15:59144630-59144652 GAGAGCTCTCAACAGCACTGAGG + Intronic
1128075165 15:64821275-64821297 GACAGCTCTGGAGAGGAGCGTGG + Exonic
1128373990 15:67062819-67062841 GAAAGCTCTGAGGAGGGCTGAGG - Intergenic
1128488134 15:68117518-68117540 GAGAACTCTGGGGAGGACAGAGG - Intronic
1129093421 15:73176886-73176908 GAGAGCTGTGAAGACAACTGGGG - Intronic
1129392364 15:75226711-75226733 CAAAGTTCTGCAGAGGTCTGAGG + Intergenic
1129690255 15:77709308-77709330 GGGAGCTGTCCAGAGTACTGGGG - Intronic
1129702168 15:77774324-77774346 GAGAGGTGGGCAGAGGGCTGAGG - Intronic
1130094818 15:80848157-80848179 GAGACCCCTGCAGGAGACTGAGG + Intronic
1130351315 15:83094225-83094247 GACATCTCTGCAGAGAGCTGGGG + Intergenic
1131237606 15:90710573-90710595 GAGAGCCCTCCACAGGACTTTGG - Intergenic
1132009816 15:98266256-98266278 GAGGGCTCAGCAGAGACCTGCGG - Intergenic
1132252928 15:100348187-100348209 CAGAGCTCTATAGAGAACTGTGG - Intergenic
1132645603 16:997958-997980 GAGAGCTCGCCAGAGGACTGTGG + Intergenic
1132870863 16:2115224-2115246 GAGGGCACTGCAGAGGTCGGAGG + Intronic
1133258926 16:4536046-4536068 GAGAGCTCTGCAGAGGACCTTGG - Intronic
1133286144 16:4691818-4691840 GGGGGCTGTGCAGAGGCCTGGGG - Intergenic
1134787130 16:16954822-16954844 ATGAGCTCTGAGGAGGACTGTGG - Intergenic
1134800082 16:17076174-17076196 GGCAGCTCTGCAGAGGGGTGGGG + Intergenic
1135854088 16:25990980-25991002 CAGGGCTCTGTTGAGGACTGGGG - Intronic
1136114131 16:28083954-28083976 GTGAGCCCTGCAGGGGAATGAGG + Intergenic
1136727567 16:32373203-32373225 GACAGCTCTGAAGAGAACAGTGG - Intergenic
1137461477 16:48668155-48668177 GACAGCTCTGAAGAGAACAGTGG - Intergenic
1137614319 16:49837815-49837837 GAGGGAACTGCAGAGGACAGTGG - Intronic
1139917687 16:70438634-70438656 GAGAGCTCTTCCGAGGGCTGGGG + Intronic
1140398716 16:74651964-74651986 GACAGCTCTGCAGAGTATGGAGG - Exonic
1142009843 16:87708349-87708371 GAGAGCGGTGCGGAGGACTGAGG - Exonic
1202998866 16_KI270728v1_random:144547-144569 GACAGCTCTGAAGAGAACAGTGG + Intergenic
1203130464 16_KI270728v1_random:1680955-1680977 GACAGCTCTGAAGAGAACAGTGG + Intergenic
1142638190 17:1270612-1270634 GAGGACTCTGCGGAGGACTTGGG + Exonic
1142904071 17:3031260-3031282 GAGAGCTCAGGAAGGGACTGGGG - Intronic
1142904110 17:3031420-3031442 GAGAGCTCAGGAAGGGACTGGGG - Intronic
1142904200 17:3031818-3031840 GAGAGCTCAGGAAGGGACTGGGG - Intronic
1142904235 17:3031977-3031999 GAGAGCTCAGGAAGGGACTGGGG - Intronic
1143109654 17:4545926-4545948 CAGCTCTCTGCAGGGGACTGCGG + Exonic
1143812224 17:9481247-9481269 AAGAGCTATGCTGAGGACTTTGG - Intronic
1144656332 17:17039538-17039560 GAGAGAGCTGCAGAGGAGAGAGG - Intergenic
1144872256 17:18378469-18378491 GAGAGCTCTGGGGAGGGCTCTGG - Intronic
1146791472 17:35753052-35753074 GAAAGCTCTGGCAAGGACTGAGG - Intronic
1147058947 17:37858604-37858626 GGGAGCGCTGCGGAAGACTGGGG - Intergenic
1147545316 17:41396793-41396815 AAGGATTCTGCAGAGGACTGGGG - Intronic
1147728762 17:42583564-42583586 GAGAGCTCTGCGGCGTACTGTGG + Exonic
1148642760 17:49200725-49200747 GGGAGTTCTGCAGGAGACTGTGG + Intergenic
1148905566 17:50909779-50909801 GAGAGCTCTGAAGGGGTCGGGGG - Intergenic
1149255451 17:54821254-54821276 GACAGCTCTGAAGAGAACAGTGG + Intergenic
1151032695 17:70759456-70759478 GAGCTCTCTGCAGAGTCCTGAGG + Intergenic
1151749014 17:76026553-76026575 GAGAACTCTGGGGAGGGCTGTGG + Intronic
1151791971 17:76311948-76311970 GAGAGTTTTGCATAGCACTGGGG - Intronic
1152410812 17:80121937-80121959 CATCGCTCTGCAGAGGACTTCGG - Intergenic
1152639612 17:81444159-81444181 GTCAGCCCTGCAGAGCACTGAGG + Intronic
1152805920 17:82356331-82356353 CTGAGCCCTGCAGAGGAATGGGG - Intergenic
1152946849 17:83202664-83202686 GAGAACTCTGCAGAGGATGCTGG - Intergenic
1155562445 18:27093263-27093285 GACAGCTCTGAAGAGGGCAGTGG - Intronic
1156485344 18:37462140-37462162 GAGAGCTCAGCAGAGGTAGGAGG + Intronic
1156612553 18:38742308-38742330 GAGAACTCTGAAAAGGACAGAGG + Intergenic
1157124732 18:44945704-44945726 GATAGTTCTGCTGAGGGCTGAGG + Intronic
1157333684 18:46721634-46721656 GAGAGCACTGTAGAGGGCTGTGG - Intronic
1157555248 18:48609238-48609260 GTGAGATCTGCAGAGATCTGGGG + Intronic
1157682272 18:49616381-49616403 TAAAGCTCTTCAGAGGACTGCGG - Intergenic
1159267506 18:66101685-66101707 GAGACCTATTCAGATGACTGAGG + Intergenic
1160302828 18:77701446-77701468 GAGAGCTCTCCAGAGCACTCAGG - Intergenic
1161068477 19:2249380-2249402 GGGGGCTCTGCTGGGGACTGAGG + Exonic
1161479173 19:4502077-4502099 GAGAGCAGAGCAGAGAACTGTGG + Exonic
1162157897 19:8692170-8692192 GAGAGATCAGCAGAGGATTCAGG + Intergenic
1162567696 19:11453322-11453344 GAGATCTCTGCAGAGAACCTGGG + Exonic
1162967094 19:14161167-14161189 GAGAGCTCTGCTGGTCACTGGGG + Intronic
1165112311 19:33509565-33509587 GGGCTCTCTGCTGAGGACTGGGG - Intronic
1166047605 19:40238635-40238657 GAGAGGTGTGGAGAGGGCTGTGG - Intronic
1167260656 19:48455951-48455973 GAGTGCTCTTGAGAAGACTGTGG + Exonic
1167609914 19:50502040-50502062 GAGGGCTCTGCAGAGGCTGGCGG - Intergenic
1167765537 19:51479793-51479815 GAGAGCTATGTAGAGGCCTGGGG + Intronic
1168650114 19:58087225-58087247 CAGTGCTCAGCAGAGGGCTGTGG - Intronic
925189505 2:1871436-1871458 CAGCTCTCTGCAGAGGACTGCGG - Intronic
925651042 2:6089532-6089554 GAAAGCTCTGTGGAGGACTAAGG + Intergenic
925823763 2:7825945-7825967 GCGTGCTCTGCAGATGACTTGGG - Intergenic
926178509 2:10618392-10618414 CAGTGATCAGCAGAGGACTGTGG - Intronic
926892770 2:17652199-17652221 AAGAGGTTTCCAGAGGACTGAGG + Intronic
926989262 2:18659930-18659952 GAGAGCTGTTTAAAGGACTGAGG + Intergenic
927475395 2:23410645-23410667 AAGAGGTCTGAAGAGGACTGCGG - Intronic
927491911 2:23526433-23526455 GAGGGCTCTGCAGGGGCCGGGGG + Intronic
927794011 2:26033245-26033267 GAGCGCTCTGCAGAGGAGGTGGG - Intergenic
928101250 2:28438710-28438732 GATAGCTTTGCAGATCACTGTGG + Intergenic
928372591 2:30751803-30751825 GGGAGCTCTGCAAGGGAGTGGGG + Intronic
929079583 2:38109248-38109270 GAGAGCTCAGCAGAGGAAAAGGG - Intronic
929455565 2:42062374-42062396 GGGAGCTCAGCAGGAGACTGGGG - Intergenic
931188077 2:59972914-59972936 GAGAGCTCTCATGAGGAATGAGG + Intergenic
931463216 2:62466078-62466100 GGGAGCTCTGCAGGGTAGTGGGG - Intergenic
931594547 2:63927133-63927155 GAGAGCTCTGAAGAGAGCTGTGG + Intronic
931710903 2:64988850-64988872 GCGAGCTCTGGAGAGGAGCGCGG + Intronic
931753905 2:65354982-65355004 GAAAGCCCAGCAGAGGGCTGAGG + Intronic
932104574 2:68931099-68931121 GACAGCTCAGCTGAGGACTCTGG - Intergenic
932309468 2:70728190-70728212 GAGAGCACTGCAGTGGCCTCAGG - Intronic
933459955 2:82569991-82570013 GGGAGCTCTGCAGGAGACTGGGG - Intergenic
933817224 2:86077745-86077767 GAGAATGCCGCAGAGGACTGGGG - Intronic
933984787 2:87581514-87581536 CAGAGGTCTGCAGGGGGCTGGGG - Intergenic
935009324 2:99117240-99117262 GATATCTCTGCAGAGGAGAGAGG + Intronic
935103668 2:100020054-100020076 GACAGCTTTGCAGAAAACTGTGG - Intronic
935595511 2:104874259-104874281 GAGACCTCTGGAGAGGACAAAGG + Intergenic
936046742 2:109194413-109194435 GAGAGCGCAGCTGAAGACTGTGG - Intronic
936309065 2:111369297-111369319 CAGAGGTCTGCAGGGGGCTGGGG + Intergenic
937981244 2:127617136-127617158 GTGAGATGTGCAGAGGACTTGGG - Intronic
937983790 2:127629596-127629618 GAGGGCTCTGCAGGGGCCAGAGG - Intronic
938169772 2:129064719-129064741 GAAGGATCTGCAGAGCACTGGGG + Intergenic
942475110 2:176311420-176311442 GACAGCTCTGAAGAGAACAGTGG - Intronic
942720527 2:178947567-178947589 TAGAACTCAGCAGAGGAGTGAGG + Intronic
943446067 2:187989455-187989477 GATAGCTGTGCAGAGGGCTTGGG - Intergenic
946193690 2:218021164-218021186 GAGAGCTCTGCACAGCCCTTGGG + Intergenic
946300451 2:218820824-218820846 GAGAGGCCCGCAGAGGTCTGAGG + Intergenic
948292296 2:236834811-236834833 GAGAGATTTGGAGAGGTCTGTGG - Intergenic
948500428 2:238389090-238389112 TAGAGCTCTGCTCAGGAGTGTGG + Intronic
1169227502 20:3865647-3865669 GAGAGCACTGGAAGGGACTGGGG - Intronic
1169530477 20:6480110-6480132 GAGAGTTCTCCACAGAACTGAGG + Intergenic
1169619780 20:7492358-7492380 GAGAACTCTGCAGAGGCCCAAGG + Intergenic
1170312377 20:15007038-15007060 GAGACCCCTGTAGAGGACTGGGG + Intronic
1170336625 20:15277268-15277290 GAGAGGTCTGCTGAGGACCTTGG - Intronic
1172134978 20:32680820-32680842 GAGAGCTCTGCAAAGGCCCCAGG + Intergenic
1172449946 20:35014918-35014940 GAGAGCTCTGAACAGGACATTGG - Intronic
1173311263 20:41898021-41898043 GCTAGCTCTGCAGAGGACAGTGG - Intergenic
1173670594 20:44796132-44796154 GACAGCTCAGCAGAGACCTGAGG - Intronic
1175326159 20:58129854-58129876 GAGAGCGCTGGAGACGGCTGCGG - Intergenic
1175790218 20:61736076-61736098 CAGAGATCTGCACAGGAGTGGGG - Intronic
1176299138 21:5090383-5090405 GAGAGCAAAGCAGAGGCCTGAGG - Intergenic
1176374291 21:6079562-6079584 GAGTGCCATGCAGAGGACGGGGG - Intergenic
1177054232 21:16280138-16280160 GAGAGTTGTGGAGAGGAATGGGG + Intergenic
1178230133 21:30773450-30773472 GAGAGGTGTGCCAAGGACTGAGG + Intergenic
1179097655 21:38329867-38329889 GAGAGCAAAGCACAGGACTGGGG - Intergenic
1179540779 21:42082257-42082279 GAGTGCTCTGCAGAGAACTTGGG + Intronic
1179749185 21:43458683-43458705 GAGTGCCATGCAGAGGACGGGGG + Intergenic
1179857888 21:44171565-44171587 GAGAGCAAAGCAGAGGCCTGAGG + Intergenic
1180325218 22:11367370-11367392 GAGAGCTCTGAAGCGTATTGTGG + Intergenic
1180436590 22:15310716-15310738 GAGAGTTCTACAGGAGACTGGGG + Intergenic
1180605834 22:17058112-17058134 GAAGGCTCTTCAGGGGACTGTGG - Intergenic
1180975430 22:19845401-19845423 CTGAGCACTGCAGGGGACTGGGG - Intronic
1181024129 22:20117863-20117885 GCAGGCTCTGCAGAGGCCTGGGG + Intronic
1181103049 22:20554380-20554402 GAGGGCTCCACAGAGCACTGAGG - Intronic
1181167963 22:20993379-20993401 CAGAGCTCTGCTGAGGCCTGGGG + Intronic
1181812091 22:25409542-25409564 GAGAGGTCTGCAGGGGCCTGAGG - Intergenic
1182417488 22:30230701-30230723 GAGAGGTGTGCAGAGGAAGGTGG - Intergenic
1183041701 22:35184823-35184845 GATAGCTCTGCGGGGGGCTGGGG - Intergenic
1184099976 22:42336850-42336872 GAGACCTCTCCAGAGGACCCTGG + Intronic
1184128155 22:42501831-42501853 GGGAGGTCTGCAGGGGAATGAGG + Intergenic
1184136945 22:42555144-42555166 GGGAGGTCTGCAGGGGAATGAGG + Intronic
1184385258 22:44170594-44170616 CCCAGCTCTGCAGAGAACTGGGG + Intronic
1184962770 22:47943661-47943683 GGCAGCCTTGCAGAGGACTGAGG - Intergenic
1185053456 22:48565689-48565711 GAGAGCTGAGCACAGGGCTGCGG - Intronic
1185281054 22:49970076-49970098 GGCAGCTCTGCAGAGATCTGGGG + Intergenic
949408287 3:3737332-3737354 CAGAGCTCTGCAGAATACTGAGG - Intronic
950310148 3:11950050-11950072 GAGGGCTCTACAGAGAACTCTGG + Intergenic
950454877 3:13086704-13086726 GAGAGCTGTGCAGAGAGCTGAGG - Intergenic
950649355 3:14397610-14397632 GACAGCTCTGCAGGGGACCGGGG - Intergenic
951078944 3:18428200-18428222 GAGTTCTCTGCAGAGTCCTGTGG + Intronic
952533394 3:34285525-34285547 GAGAACTCTGCAGGGTTCTGAGG + Intergenic
953028027 3:39156051-39156073 GAGAGCACAGCTGAGGTCTGAGG - Intergenic
953093145 3:39749544-39749566 GAGACATCAGCTGAGGACTGGGG - Intergenic
953653079 3:44823529-44823551 GATAGCTCTGAAGAGTACAGTGG - Intronic
954460171 3:50621985-50622007 GAGACCTCTGCAGAGTCCTCTGG + Intronic
954982400 3:54758370-54758392 GAGAGCTCTGCTCAGGAGTGCGG + Intronic
955468024 3:59256404-59256426 GAGAGGTCTCCAGAGGAATGTGG - Intergenic
958586097 3:96090086-96090108 CAGAGGTCAGCAGAAGACTGGGG + Intergenic
959895444 3:111600349-111600371 GAGAGCTCTGCTGTGGAATCTGG - Intronic
960505576 3:118489287-118489309 GAGAGCTCTGGAAAGGCCTTGGG + Intergenic
960930751 3:122846887-122846909 GAGGGCTCCCCAGAGGACTTTGG + Intronic
960941971 3:122940810-122940832 GAGAGCTCTGCTAAGGACTTGGG - Intronic
961325807 3:126108609-126108631 GAGAGCTCTGTTGAGGTGTGCGG + Intronic
961956640 3:130810937-130810959 GAGAGCTCTCAAGAGGTCTCAGG + Intergenic
962311742 3:134331680-134331702 GAGAGGGCTGCTGAGGAATGAGG - Intergenic
962420593 3:135225634-135225656 GAAAGCTCTGCCAAGAACTGTGG - Intronic
962850872 3:139307393-139307415 GAAGGCTCTGCAGAGGGCAGTGG - Intronic
963344284 3:144075290-144075312 GAGGACTCTGCAGAGTCCTGAGG - Intergenic
964459521 3:156908581-156908603 AAGAGCTCAACAGAGGACAGAGG - Intronic
966214660 3:177490153-177490175 GACAGCAGAGCAGAGGACTGAGG - Intergenic
966611180 3:181869360-181869382 GAGGGCTCTGCTGAGTACAGTGG + Intergenic
966932364 3:184684178-184684200 GACAGCTCTGAAAAGGACAGTGG + Intronic
967814518 3:193787737-193787759 GAGTCCCCTGCAGAGGACTACGG - Intergenic
967889001 3:194351658-194351680 GAGAGCCCAGCAGGGGCCTGAGG - Intergenic
968627914 4:1636374-1636396 GAGACCTCTGCCTAGGACGGGGG + Intronic
968893100 4:3382628-3382650 GAGAGAGCAGCAGAGAACTGAGG - Intronic
969622486 4:8285690-8285712 GAGAGCTCTGGTGAGAACTGGGG + Intronic
969652716 4:8477480-8477502 GGGAGCTCTGCTGAGGCCTCTGG + Intronic
970182864 4:13417367-13417389 GACAGCTCTGAAGAGGGCAGTGG + Intronic
970219637 4:13797460-13797482 GTGAGCTCTGGACAGGAATGAGG + Intergenic
971467118 4:26975768-26975790 GACAGCTCTGCAGAGAGCAGTGG - Intronic
974199437 4:58620171-58620193 GGGAGCGCTGCAGGAGACTGGGG - Intergenic
974307323 4:60157891-60157913 GACAGCTCTGAAGAGGGCAGTGG + Intergenic
975657925 4:76660126-76660148 AAGAGCTCTGGAGGGGGCTGGGG - Intronic
975744602 4:77464116-77464138 GACAGCTCTGAAGAGAACAGTGG - Intergenic
976091232 4:81460293-81460315 GGGTGCTCTGCAGAGGCCAGAGG + Intronic
976730403 4:88255477-88255499 GAGCTCCCTGCAGAGGACAGTGG + Intergenic
976748873 4:88433608-88433630 GAGAACTCTGCAGAGTCCTGAGG - Intronic
977009112 4:91613252-91613274 GAGTGCTCTGCAGAGGATACTGG + Intergenic
978928976 4:114287635-114287657 GACAGCTCTGAAGAGAACAGTGG + Intergenic
979809863 4:125023118-125023140 GAGAGTTGTGCAGTGGACTTTGG + Intergenic
981585693 4:146299917-146299939 GAGAGCTCTGCCAGGGAGTGAGG + Intronic
982085045 4:151826180-151826202 AAGAGCTCAGCAGAGGTCTAAGG - Intergenic
982313447 4:154008769-154008791 TAGGGCTCTGCAGAAGACTTGGG - Intergenic
983461289 4:168028224-168028246 GAGTTCTCAGCAGAGGACTTGGG - Intergenic
985720497 5:1486241-1486263 TAGAGCTCAGCAGAGCCCTGTGG - Intronic
985724258 5:1507470-1507492 GAGAGCTTTGGTGCGGACTGCGG + Intronic
985813714 5:2111035-2111057 GAGAGGTGGGCAGAGGCCTGCGG + Intergenic
985895786 5:2749381-2749403 GAGACCTCGGCAGAGGACGAAGG - Exonic
985960535 5:3299684-3299706 GAGACCTCTCCAGACGGCTGTGG + Intergenic
986312432 5:6562542-6562564 GGGGGCTCTGCAGAGTCCTGAGG - Intergenic
986964255 5:13251638-13251660 GAGAGCATTGGAGAGCACTGGGG + Intergenic
987239548 5:15981066-15981088 GAGAGCTCTGCACAAAGCTGGGG - Intergenic
987304774 5:16627119-16627141 GAGTTCTCTGCAGAGAGCTGTGG - Intergenic
987692426 5:21283868-21283890 GTGAGATGTGCAGAGGACTTGGG - Intergenic
988418279 5:30974129-30974151 GAGAGATCTAGAGAGGATTGAGG - Intergenic
988671784 5:33389283-33389305 GACAGCTCTGAAGAGAACAGTGG + Intergenic
988933422 5:36059569-36059591 GTGAGATGTGCAGAGGACTTGGG + Intronic
989087307 5:37689312-37689334 GAGAGCTCTGAAGAGAGCAGTGG + Intronic
990141266 5:52706946-52706968 GAGAGCCATGCAGGGGATTGAGG - Intergenic
990234359 5:53751099-53751121 GAGAGCTCTGAAGAGAGCAGTGG + Intergenic
991258952 5:64646181-64646203 GTGAAATCTGCAGAGGAATGAGG + Intergenic
991578346 5:68128026-68128048 GAGGGCTGTTCTGAGGACTGGGG - Intergenic
991747932 5:69766182-69766204 GTGAGATGTGCAGAGGACTTGGG + Intergenic
991799508 5:70346030-70346052 GTGAGATGTGCAGAGGACTTGGG + Intergenic
991829089 5:70664008-70664030 GTGAGATGTGCAGAGGACTTGGG - Intergenic
991891867 5:71345459-71345481 GTGAGATGTGCAGAGGACTTGGG + Intergenic
993044061 5:82847564-82847586 GACAGCTCTGAAGAGAACAGTGG - Intergenic
993984695 5:94583652-94583674 GACAGCTCTGAAGAGAACAGTGG + Intronic
995315474 5:110766878-110766900 GAAAGGAATGCAGAGGACTGTGG - Intergenic
995945616 5:117641789-117641811 AACAGCTCTGCAGAGCATTGTGG + Intergenic
996117348 5:119633277-119633299 CAGAGCTCTGCAGAGGTGTCTGG + Intronic
997243728 5:132328352-132328374 CAGAACTCTGTAGAGGACGGTGG + Intronic
997657148 5:135563931-135563953 GACAGCTCTGCAGACAGCTGGGG + Intergenic
997995720 5:138584432-138584454 GAGAGCTCTGCAGAGGAGGGAGG + Intergenic
998526822 5:142850107-142850129 CAGAGCTCTGAAGAGGCCTAGGG - Intronic
999255373 5:150206964-150206986 GAGAGCTGTGGTGAGCACTGCGG + Intronic
1000227971 5:159287287-159287309 GAGAGCTCTGTTGAGTACTTGGG - Intergenic
1002636262 5:180610245-180610267 CAGAGCTCAGCAGTGGACTCGGG - Intronic
1003062944 6:2876488-2876510 GAGAGTTCTGGCGAGGGCTGCGG - Intergenic
1003851281 6:10225386-10225408 ATGAGCTCTGCAGAGATCTGGGG + Intergenic
1003863545 6:10343492-10343514 GAGGACTCTGCAGAGTCCTGAGG + Intergenic
1003987588 6:11452408-11452430 GACAGCTCTGAAGAGAACAGTGG + Intergenic
1005692872 6:28323956-28323978 GAGAGCCCAAGAGAGGACTGGGG + Intergenic
1006043867 6:31277098-31277120 GAGAAGTCTGTAGAGGACAGGGG + Intronic
1006913293 6:37578257-37578279 GTCAGCTCTGCAGACGCCTGGGG + Intergenic
1007270103 6:40629808-40629830 GAGAGCACGGCAAGGGACTGGGG - Intergenic
1007904714 6:45448105-45448127 GAGAACTCTGGAGAGGTCTAGGG + Intronic
1008436821 6:51485909-51485931 GAGAGCTCTGAAGAGAGCAGTGG - Intergenic
1009290154 6:61870492-61870514 GACAGCTCTGAAGAGGGCAGTGG + Intronic
1010333019 6:74646591-74646613 GAAAGCTGTTCAGGGGACTGCGG + Intergenic
1010765234 6:79771189-79771211 GAGAGGTCTCTGGAGGACTGGGG + Intergenic
1010837932 6:80612728-80612750 GACAGCTCTGAAGAGAGCTGTGG + Intergenic
1011137355 6:84115114-84115136 GACAGCTCTGAAGAGAGCTGTGG - Intergenic
1011516946 6:88165905-88165927 GAGAGCTCTGCAGGGAGCCGAGG + Exonic
1011598888 6:89041788-89041810 GTGAGCCCTGCCGAGGTCTGGGG + Intergenic
1012725825 6:102808958-102808980 GACAGCTCTGAAGAGGGCAGTGG - Intergenic
1013864258 6:114675647-114675669 GGGAGCTCTATAGAGGAATGGGG + Intergenic
1014019188 6:116568026-116568048 GGGGACTCTGCAGAGTACTGAGG - Intergenic
1014317608 6:119886877-119886899 GTGAAATCTGGAGAGGACTGAGG + Intergenic
1014907148 6:127043849-127043871 GAGAGCTCTGAAGAGAGCAGTGG + Intergenic
1015046247 6:128779761-128779783 GACAGCTCTGAAGAGAACAGTGG - Intergenic
1015046947 6:128787653-128787675 GACAGCTCTGAAGAGGGCAGTGG + Intergenic
1015421854 6:133020133-133020155 GAAAGCTCTACAGAGCAGTGGGG - Intergenic
1017423614 6:154297926-154297948 GAATGCTCTTCAGAGCACTGCGG - Intronic
1017707918 6:157140846-157140868 GAGGACTCTGCAGAGTGCTGAGG - Intronic
1018490121 6:164283878-164283900 GTGAGCTGTGCAGATAACTGGGG - Intergenic
1018610386 6:165642499-165642521 TAGTGCTCTGCAAAGCACTGAGG + Intronic
1018682925 6:166279923-166279945 GAGAGCTATGTTGAGGACTGGGG - Intergenic
1019472881 7:1230442-1230464 GAGAGCTCTTCAGAGGCCCTCGG - Intergenic
1019748831 7:2716256-2716278 GAGATTTCGGAAGAGGACTGCGG - Exonic
1019947108 7:4338503-4338525 GAGGGCTCTGCATGGCACTGGGG + Intergenic
1022901455 7:34814519-34814541 GACAGCTCTGAAGAGCACAGTGG + Intronic
1023186600 7:37539371-37539393 GAGAGGTCAGGAGAGGAGTGGGG + Intergenic
1023729418 7:43176519-43176541 GGGGACTCTGCAGAGGCCTGAGG + Intronic
1024569134 7:50709728-50709750 GTGAGCTGTGCTGTGGACTGTGG + Intronic
1024587654 7:50855517-50855539 GAGAGCTCTGCTGCAGAGTGAGG - Intergenic
1024934379 7:54698104-54698126 GAGTGTTCTGCAGAGGCTTGGGG + Intergenic
1025998386 7:66542897-66542919 CAGAGCTCTGCAGCAGCCTGTGG - Intergenic
1026007422 7:66611064-66611086 GAGGTCTCTGTAGAAGACTGTGG - Intergenic
1026594456 7:71722746-71722768 GAGATTTCTACAGAGGCCTGCGG + Intergenic
1026991347 7:74587698-74587720 CAGAGCTCTGCAGCAGCCTGTGG - Intronic
1028114524 7:86982287-86982309 GACAGCTCTGAAGAGAACAGTGG + Intronic
1028340977 7:89719324-89719346 GACAGCTCTGAAGAGAACAGTGG + Intergenic
1028997378 7:97116434-97116456 GAGAGCTCTACCCAGCACTGTGG + Intergenic
1030082029 7:105786406-105786428 AAGAACTCTGCAGGGGACAGCGG + Intronic
1030125438 7:106148704-106148726 GGGAGCACTGCAGAGGGCTAGGG - Intergenic
1030228070 7:107174604-107174626 AAGAGCTCTGCAGAGGGAGGGGG + Intronic
1030646854 7:112071193-112071215 GAGAGCTCTGTTGTGGGCTGTGG - Intronic
1030682242 7:112446248-112446270 GAGTGCTCTTCAGATGAATGTGG - Intronic
1032450432 7:132025814-132025836 GAGTGCTCAGAAGAGGACTGAGG + Intergenic
1033013733 7:137650450-137650472 AAGACCTCTGCAAAGGACTGGGG + Intronic
1034966022 7:155391532-155391554 CAGAGCTCTGCACAGGGGTGGGG + Intronic
1035444876 7:158933461-158933483 GAGACCCCTGCACAGGACTCTGG + Intronic
1035670338 8:1412177-1412199 GGGGGCTCTGCAGAGGGCAGTGG - Intergenic
1035726391 8:1826967-1826989 GGGAGCTCTGCAGTGGAAAGGGG + Intronic
1035745519 8:1959896-1959918 CAGGGCTCTGCAGAGGAGAGGGG - Intergenic
1035870496 8:3132165-3132187 GAGATATCTGCTGAGGTCTGAGG - Intronic
1037078765 8:14756519-14756541 GAGTCATCTGCAGAGTACTGTGG - Intronic
1037653913 8:20866718-20866740 GACAGCCCTGGAGAGGACAGGGG - Intergenic
1037800728 8:22033875-22033897 GAAAGCCCTGCAGAGGGCTGGGG - Intronic
1038192378 8:25335036-25335058 GAGTGCTCTGGGGAGGAATGCGG - Intronic
1038461674 8:27722553-27722575 CAGAGCACAGCAGAGAACTGTGG - Intergenic
1039406622 8:37318591-37318613 GATGGCTCTGCAAAGGAGTGGGG - Intergenic
1039641174 8:39225000-39225022 GTGGCCTCTGCAGAGGACAGAGG + Intronic
1039791945 8:40883188-40883210 GACTGCTCTGCCCAGGACTGAGG - Intronic
1042486088 8:69347154-69347176 GAGGGCTCTTCATGGGACTGAGG - Intergenic
1043314875 8:78908087-78908109 GTGAGCAATGCAAAGGACTGGGG + Intergenic
1043938832 8:86173901-86173923 GACAGCTCTGAAGAGAACAGTGG - Intergenic
1045294559 8:100862026-100862048 GAGAGATCTGCAGAGCTCTGAGG + Intergenic
1048303577 8:133268122-133268144 GGCAGCTATGCAGAGGCCTGTGG - Intronic
1048318139 8:133377070-133377092 GAGGGCTCTGCTGAGGTCTGGGG + Intergenic
1049279825 8:141738547-141738569 GGGAGCTCTGCTGTGGGCTGGGG - Intergenic
1049345413 8:142136073-142136095 GTGAGCCGTGCAGAGGTCTGGGG - Intergenic
1049435161 8:142583167-142583189 CAGGGCTCTGAAGAGAACTGGGG + Intergenic
1049551098 8:143260335-143260357 GATGGCTCTGCAGTGGCCTGAGG - Intronic
1050597345 9:7216881-7216903 GACAGCTCTGAAGAGAACAGCGG + Intergenic
1052118890 9:24684080-24684102 GATAGTTCTGCAGAGTACTTAGG + Intergenic
1053819518 9:41952503-41952525 GTGAGTCCTGCAGGGGACTGTGG + Intronic
1054109786 9:61096156-61096178 GTGAGTCCTGCAGGGGACTGTGG + Intergenic
1054611071 9:67234969-67234991 GTGAGTCCTGCAGGGGACTGTGG - Intergenic
1054890030 9:70240905-70240927 GACAGCTCTGAAGAGAACAGTGG + Intergenic
1055328382 9:75156093-75156115 GAACTCTCTGCAGAGAACTGAGG - Intergenic
1056835914 9:89954986-89955008 GAGAGCTCTACTGGGGAGTGCGG + Intergenic
1057068697 9:92077441-92077463 GAGGATTCTGCAGACGACTGTGG - Intronic
1057169035 9:92949827-92949849 GAGAGCTCCTCAGAGGGTTGTGG - Intronic
1059524567 9:114978656-114978678 GAGAGCTCTGCAGAGCCCCAAGG - Intergenic
1060373588 9:123098387-123098409 AAGAGCTCATAAGAGGACTGCGG - Intronic
1060375728 9:123114165-123114187 TACAGCTCTGCTGGGGACTGTGG - Intronic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1061108316 9:128549607-128549629 GAGAGTTCTGGAGAGGATGGTGG - Intergenic
1061296082 9:129677519-129677541 GAGAGCTCTGCAGTGTCCTGAGG + Intronic
1186076367 X:5883759-5883781 CAAAGCTCTGCAGAGGACAGAGG + Intronic
1187473449 X:19589304-19589326 CAGGGCTCAGCAGAGGGCTGAGG + Intronic
1189208723 X:39264721-39264743 GAGAGCTCCCCAGAGAGCTGTGG + Intergenic
1191003765 X:55688645-55688667 GAGAGCTCTGAAGAGAGCAGTGG - Intergenic
1192020624 X:67386874-67386896 GACAGCTCTGAAGAGAACAGTGG + Intergenic
1192936364 X:75862757-75862779 GACAGCTCTGAAGAGAACAGTGG - Intergenic
1192973745 X:76261062-76261084 GACAGCTCTGAAGAAGACAGTGG - Intergenic
1193003598 X:76590967-76590989 GACAGCTCTGAAGAGAACAGCGG - Intergenic
1194291995 X:92085063-92085085 GAGAACTCTGCATAGTAGTGTGG + Intronic
1198851412 X:140968600-140968622 GAACGCTTTGCAGAGAACTGAGG - Intergenic
1199967025 X:152829093-152829115 TGGACCTCTGCAGATGACTGGGG + Intronic
1200083342 X:153590470-153590492 GTGAACTCTGTAGAGGACAGTGG + Intronic
1200135769 X:153873889-153873911 CAGTGCTCTGCAGAGTCCTGGGG - Intronic
1200609503 Y:5309605-5309627 GAGAACTCTGCATAGTAGTGTGG + Intronic
1201129850 Y:10944372-10944394 GAGAGGACTGCAGTGGAGTGGGG - Intergenic
1201333451 Y:12853053-12853075 GACAGCTCTGAAGAGAGCTGTGG - Intronic
1202343157 Y:23890077-23890099 GACAGCTCTGAAGAGGGCAGTGG + Intergenic
1202527611 Y:25780008-25780030 GACAGCTCTGAAGAGGGCAGTGG - Intergenic