ID: 917981466

View in Genome Browser
Species Human (GRCh38)
Location 1:180272166-180272188
Sequence GTGGCCCTTTACCATGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917981454_917981466 30 Left 917981454 1:180272113-180272135 CCTGAACACAGGCTTTTCCTTAA 0: 1
1: 0
2: 1
3: 14
4: 223
Right 917981466 1:180272166-180272188 GTGGCCCTTTACCATGGGACAGG 0: 1
1: 0
2: 0
3: 7
4: 92
917981457_917981466 13 Left 917981457 1:180272130-180272152 CCTTAAGACTTGCAGTGAAGGGT 0: 1
1: 0
2: 0
3: 12
4: 96
Right 917981466 1:180272166-180272188 GTGGCCCTTTACCATGGGACAGG 0: 1
1: 0
2: 0
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917981466 Original CRISPR GTGGCCCTTTACCATGGGAC AGG Intronic
907387164 1:54133520-54133542 GGGGCCATTTACCATGGTCCAGG + Intronic
913595880 1:120376142-120376164 GTGGCCCTCCACCATGTGAATGG - Intergenic
915046679 1:153023300-153023322 GTGGCCTTGCACCTTGGGACTGG + Intergenic
917981466 1:180272166-180272188 GTGGCCCTTTACCATGGGACAGG + Intronic
918125411 1:181579467-181579489 ATGGCCCTTGACCATGGGATAGG - Intronic
923043434 1:230336710-230336732 GTGGCCCCTTCCCAGGAGACAGG - Intronic
1063865386 10:10359330-10359352 GTTGCCCTTAACAATGGGATGGG - Intergenic
1064777501 10:18795499-18795521 GGGGCTCTTTCCCATGGGACTGG + Intergenic
1067720877 10:48726957-48726979 GTGGCCCATTCCTAGGGGACAGG - Intronic
1068095856 10:52490095-52490117 CTGGCTATTTACCATGGGATAGG - Intergenic
1069511426 10:69045527-69045549 GTGGGCCTCTACCAAGGGCCAGG - Intergenic
1076039578 10:127232981-127233003 TTGGCTCTTCACCATGTGACTGG + Intronic
1076732918 10:132447206-132447228 GTGCCCCTCTACCAGGGGCCGGG - Intronic
1078717532 11:13854264-13854286 GTGGCCAAGTACCATGGGAATGG - Intergenic
1081692240 11:45086426-45086448 GTGGCTCTGGATCATGGGACAGG + Intergenic
1081890923 11:46542053-46542075 GTGGCCTTTAACCAGGAGACAGG - Exonic
1084512287 11:69613751-69613773 GTGGCCCATTAACTTGGGGCAGG - Intergenic
1084881979 11:72177939-72177961 GGGGCCCCGTCCCATGGGACTGG + Intergenic
1086347097 11:85908171-85908193 TTGAGCCTTTTCCATGGGACTGG + Intronic
1092555830 12:9560658-9560680 GTGGCCCTTTCCTTTGGGTCAGG - Intergenic
1094516270 12:31130013-31130035 GTGGCCCTTTCCTTTGGGTCAGG + Intergenic
1098979182 12:76936630-76936652 GTGGTCTTTTGCCTTGGGACTGG - Intergenic
1099861119 12:88227352-88227374 GTGGCCTTGCACCTTGGGACTGG - Intergenic
1101080068 12:101172918-101172940 GTGCCCCTGTCCCATGGGAGTGG + Intronic
1104505724 12:129330441-129330463 GTGGCCCTTTAAGAGGTGACTGG + Intronic
1113565612 13:111317934-111317956 GTGGCCCTGTCCAATAGGACCGG - Intronic
1113804910 13:113106972-113106994 CTGGCTCTTTGCCATGGGAGGGG - Intronic
1114773745 14:25457991-25458013 GTGGCCTTGTGCCTTGGGACTGG - Intergenic
1120642936 14:87037509-87037531 GTGTCCCTTTACCATAGTAAGGG - Intergenic
1121897320 14:97660455-97660477 CTAGCCATTTACCTTGGGACAGG + Intergenic
1122920365 14:104877468-104877490 GTGGCCCTTGGCCAAGGGTCAGG - Intronic
1123158694 14:106256297-106256319 TAAGCCCTTTTCCATGGGACAGG - Intergenic
1137071944 16:35911265-35911287 GTGGCCTTGCACCTTGGGACTGG + Intergenic
1139311907 16:66034583-66034605 GGGGCCCTATCCCATAGGACTGG + Intergenic
1140264528 16:73408818-73408840 GTGGTCCTCTCCCATGGGAGAGG - Intergenic
1142625036 17:1186564-1186586 GTGGCCCCTGGCCATGGGAACGG - Intronic
1143529999 17:7497185-7497207 GTGGCCTTTAACCATGTGAAAGG - Intronic
1150661297 17:67082028-67082050 GTGGCTATTTACCATGGGCCAGG + Intronic
1154359225 18:13645255-13645277 GTGGCTCTTCACCGTCGGACAGG - Exonic
1155804180 18:30145227-30145249 GTGGCCTTGTGCCTTGGGACTGG - Intergenic
1157920648 18:51709858-51709880 GTGGCCTTGCACCCTGGGACTGG - Intergenic
1159004737 18:63002118-63002140 GTGGACATTCACCATGGGAGGGG + Intergenic
1163250529 19:16124092-16124114 GGGGCCCTTTATCCGGGGACTGG - Intronic
1163939741 19:20480638-20480660 GTAGCCTTGTACCTTGGGACTGG + Intergenic
927376407 2:22420031-22420053 GTGGCCTTGTGCCTTGGGACTGG + Intergenic
930533017 2:52613958-52613980 GTGGCCTTGCACCTTGGGACTGG - Intergenic
932628745 2:73320410-73320432 GTGGCCATTTAGCATGGCACAGG - Intergenic
942087315 2:172455464-172455486 CTGGCCCTTCTCCATGGGGCAGG - Intronic
1169324096 20:4661270-4661292 GTGGCCTTGCACCTTGGGACTGG - Intergenic
1173809226 20:45946212-45946234 GTGGGCCTCTACGAGGGGACTGG + Exonic
1182154044 22:28052291-28052313 GTGACCCTTTATCATGTGCCAGG + Intronic
1182278374 22:29204608-29204630 GTTGCCCTGTCCCAAGGGACAGG - Intergenic
1184331508 22:43830737-43830759 GTGGCCCTTTCCCACGAGCCGGG - Intronic
1185166950 22:49267156-49267178 GGGACGCTTCACCATGGGACAGG + Intergenic
949766992 3:7537550-7537572 GTGGACCTTTACATTGAGACTGG - Intronic
950452239 3:13071996-13072018 GAGGCCCCTTACCATGGCAGGGG - Intronic
951323136 3:21271607-21271629 GTGGACATTTGGCATGGGACTGG - Intergenic
953083652 3:39645574-39645596 GTGATCCTTTACCATGTGGCAGG + Intergenic
953881411 3:46693277-46693299 GTGGCCTTTTCGCATGGGAGCGG - Intronic
954558094 3:51534025-51534047 GTGGCCTTTTGCCTTGGGACTGG + Intergenic
956285280 3:67602209-67602231 TTGGGCCTTTACCATGTGCCTGG - Intronic
960264224 3:115602215-115602237 GTGACCAGTTACCATGAGACAGG + Intergenic
961017611 3:123479771-123479793 GGGTCCCTTTCCCTTGGGACTGG - Intergenic
961501855 3:127341982-127342004 GTGTCCCTGCACCATGGGAAGGG + Intergenic
969556797 4:7917169-7917191 GTGGGCATTTACCATGTGACAGG - Intronic
969617957 4:8264820-8264842 GTGGCCAGGTAGCATGGGACGGG + Intergenic
972649996 4:41007492-41007514 ATGGCCCTTTTCCTTGGCACTGG + Intronic
973051691 4:45606998-45607020 GTGGCCTTGTGCCTTGGGACTGG - Intergenic
973616661 4:52685641-52685663 CTCACCCTTTACCATGGGAATGG + Intergenic
976741230 4:88359613-88359635 GTGGCCTTGCACCTTGGGACTGG - Intergenic
979338654 4:119493316-119493338 GTGTCCCTTTTCCATAGGAAGGG + Intergenic
986608845 5:9547130-9547152 GTGGCCCTTTCCCACTGGATGGG + Intergenic
989813936 5:45712454-45712476 GTGGTTCTTCACCATGGCACTGG + Intergenic
996336838 5:122393297-122393319 TTGAACATTTACCATGGGACAGG + Intronic
1003589358 6:7424268-7424290 GTGCCCCAGTCCCATGGGACTGG + Intergenic
1005392682 6:25349659-25349681 GCGGCCCTTCACCATGGGCAAGG + Intronic
1006909567 6:37555251-37555273 GTGGCCCTTTATCATCTGCCGGG + Intergenic
1009950922 6:70394687-70394709 GTGGCCTTGCACCTTGGGACTGG - Intergenic
1015240923 6:131022328-131022350 GTGTCACGTTACCATGTGACAGG - Intronic
1019963191 7:4478441-4478463 GTGGCCCTTTCCCACTGGACTGG - Intergenic
1028473138 7:91225839-91225861 CTGGCCCTTGACCCTGAGACTGG - Intergenic
1029803320 7:102973271-102973293 GTGGCCTTGTGCCTTGGGACTGG - Intronic
1035220747 7:157405261-157405283 GGGGCTCTTTGCCATGGGAGAGG + Intronic
1036145051 8:6247210-6247232 GTGACCCTTTACCAAGGAAATGG - Intergenic
1037716904 8:21408488-21408510 GTGGCCCCTTTCCCTGAGACAGG - Intergenic
1041369827 8:57147529-57147551 CTGGCCCTTTTTCATGGCACAGG - Intergenic
1042157655 8:65863296-65863318 GTGGCCTTGTGCCTTGGGACTGG - Intergenic
1042415140 8:68509980-68510002 GTGGCCTTTATCCATGGAACAGG + Intronic
1043768737 8:84169859-84169881 GTGGCCTTGCACCTTGGGACTGG + Intergenic
1043857417 8:85277922-85277944 GTGGCCTTGCACCTTGGGACTGG + Intronic
1045014452 8:97987719-97987741 CTGAGCATTTACCATGGGACAGG - Intronic
1050703357 9:8366216-8366238 GTGGCTGTTTACCATTGGAATGG + Intronic
1055433317 9:76267138-76267160 GTGGCCCTTTAGCCTTGCACTGG - Intronic
1056726372 9:89122669-89122691 GTGGCCCTTTCCCATGAATCTGG - Intronic
1060426704 9:123512351-123512373 GTGGCCCCTGGCCATGGGAGTGG + Intronic
1192946575 X:75969765-75969787 GTGGCCTTGTGCCTTGGGACTGG + Intergenic
1196026058 X:111042494-111042516 GGGGCCCTGTACCACGGCACAGG + Intronic
1197947079 X:131851205-131851227 GTGGCCTTGTGCCTTGGGACTGG + Intergenic
1199673263 X:150164042-150164064 GTGGGCCTCTACCAGGGCACAGG - Intergenic
1200125594 X:153812738-153812760 GTGGCTCCTTACCATGTGCCTGG - Intronic