ID: 917982373

View in Genome Browser
Species Human (GRCh38)
Location 1:180278446-180278468
Sequence CCTACCAAGCAGAGTGTGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917982373_917982377 15 Left 917982373 1:180278446-180278468 CCATCCACACTCTGCTTGGTAGG 0: 1
1: 0
2: 1
3: 31
4: 238
Right 917982377 1:180278484-180278506 CAGTTTCATGCTGCTAGCTCTGG 0: 1
1: 0
2: 0
3: 18
4: 242
917982373_917982378 20 Left 917982373 1:180278446-180278468 CCATCCACACTCTGCTTGGTAGG 0: 1
1: 0
2: 1
3: 31
4: 238
Right 917982378 1:180278489-180278511 TCATGCTGCTAGCTCTGGTAAGG 0: 1
1: 0
2: 8
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917982373 Original CRISPR CCTACCAAGCAGAGTGTGGA TGG (reversed) Exonic
902144368 1:14385464-14385486 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
906525551 1:46491202-46491224 CCTCCCAAACCGAGTGTGGCTGG - Intergenic
906962909 1:50430323-50430345 CCCACCCAGCTGAGTTTGGAAGG + Intergenic
909846178 1:80397499-80397521 CATACAAAGCAGTGTGTAGAGGG - Intergenic
910157128 1:84232072-84232094 CATTCAAAGCAGTGTGTGGAGGG - Intronic
910946014 1:92592410-92592432 CATTCCAAGCAGTGTGTAGAGGG + Intronic
911954776 1:104220216-104220238 CATTCAAAGCAGAGTGTAGACGG - Intergenic
912097734 1:106166136-106166158 CGTTCAAAGCAGTGTGTGGAGGG + Intergenic
914996828 1:152550944-152550966 CATTCAAAGCAGTGTGTGGAGGG - Intronic
915817596 1:158986126-158986148 CCTACCCAGCAAAGTCTAGATGG - Intergenic
917982373 1:180278446-180278468 CCTACCAAGCAGAGTGTGGATGG - Exonic
918583533 1:186160572-186160594 CATACAAAGCAGTGTGTAGAGGG - Intronic
919879216 1:201891251-201891273 TCTGCCAAGCAGGGTGTGGGAGG + Intronic
920965225 1:210695833-210695855 CCCAGCCAGCGGAGTGTGGAGGG - Intronic
921288207 1:213628734-213628756 CATTCAAAGCAGAGTGTAGAGGG - Intergenic
1064718818 10:18206750-18206772 CTTAGCAAGCAAAGTGGGGAGGG + Intronic
1066472959 10:35717006-35717028 ACTACCACACAGGGTGTGGAGGG + Intergenic
1067240305 10:44485968-44485990 CATACAAAGCAGTGTGTAGAGGG - Intergenic
1067301248 10:45012324-45012346 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1067551436 10:47239150-47239172 CTTGCCAGGTAGAGTGTGGAAGG - Intergenic
1068385422 10:56319903-56319925 CCCACCAATCAGAATGAGGATGG - Intergenic
1071720424 10:88138509-88138531 CTTAGCCAGCAGAGAGTGGAGGG - Intergenic
1072180755 10:92977245-92977267 CATTCCAAGCAGAGAGAGGATGG - Intronic
1074171601 10:110944895-110944917 ACTACCCAGCTGAGTGTTGAAGG - Intronic
1075076123 10:119351617-119351639 TTTATCAAGCAGAGTGAGGATGG + Intronic
1077692062 11:4352610-4352632 CATACAAAGCAGTGTGTAGAGGG - Intergenic
1078219212 11:9337342-9337364 CCTACCAAGAAGAGTTAAGAGGG - Intergenic
1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG + Intergenic
1081625376 11:44652193-44652215 CCAAACAGGCAGACTGTGGAAGG + Intergenic
1082638181 11:55622286-55622308 CCTTCAAAGCAGTGTGTAGAGGG - Intergenic
1085545451 11:77313578-77313600 TCTACAACGCAGAGCGTGGACGG - Intergenic
1086687258 11:89747041-89747063 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1090154510 11:124423644-124423666 CCTACCAAGAAAAGAATGGAAGG + Intergenic
1094838498 12:34333331-34333353 CCTCACATGCACAGTGTGGAGGG - Intergenic
1097748555 12:63327179-63327201 CCTATAAAACAGGGTGTGGAAGG + Intergenic
1100784439 12:98064241-98064263 CCTACCAAGTAGACTGTACAGGG + Intergenic
1101195786 12:102380737-102380759 CCTAGGAGGCAGAGTGTGCAGGG + Intergenic
1102542899 12:113635139-113635161 TCTTCCAAGCAGAGAGTGGGGGG - Intergenic
1102642312 12:114377980-114378002 CCACCCAACCAGAGAGTGGATGG - Intronic
1103783597 12:123415753-123415775 CCTTCAAAGCAGACTGAGGAGGG - Exonic
1104166882 12:126240158-126240180 TCTGCCAACCAGAGTGTGGCAGG + Intergenic
1104634664 12:130430216-130430238 CCCACCAAGTAGAGTGTCTAAGG - Intronic
1105867627 13:24474678-24474700 CCTAGAAAGCAGACTCTGGATGG - Intronic
1106357426 13:28997046-28997068 CATTCAAAGCAGTGTGTGGAGGG - Intronic
1107733991 13:43376898-43376920 CCAGCCAAGCAAGGTGTGGAGGG - Intronic
1112033400 13:95476633-95476655 CCTCCCAGGCAGTGTGTGAAGGG + Intronic
1112922296 13:104628811-104628833 CCTACAAAGCAGAGGGGGGGGGG - Intergenic
1114265233 14:21069754-21069776 CCTGCCTAGCAGAGAGCGGAGGG - Intronic
1117465677 14:55991338-55991360 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1117468342 14:56017166-56017188 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1118425042 14:65651140-65651162 CCTCCCAACTAGAGTGTGGAGGG + Intronic
1120928913 14:89827520-89827542 CCCACCATGCAGAGTATAGAAGG + Intronic
1120979789 14:90279725-90279747 CCTTCCCAGCCCAGTGTGGAAGG + Intronic
1121597219 14:95173536-95173558 GCAACAAAGGAGAGTGTGGATGG - Intergenic
1122580310 14:102767692-102767714 CCTACCATGGAGAGTGAGCATGG + Intergenic
1122951389 14:105047080-105047102 CATGCCAGGCAGAGTGGGGATGG + Intergenic
1123127528 14:105959272-105959294 CATTCAAAGCAGAGTGTAGAGGG - Intergenic
1202846374 14_GL000009v2_random:180985-181007 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1202915838 14_GL000194v1_random:171587-171609 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1128381349 15:67115379-67115401 CCATCAAAGCAGACTGTGGAGGG - Intronic
1129732836 15:77941726-77941748 ACTGCCAAGCACAGTGTCGATGG - Intergenic
1130159445 15:81384123-81384145 CCTCACAAGCAGAGAGAGGAAGG - Intergenic
1131946408 15:97627035-97627057 CCCACCAAGCCAAGAGTGGAGGG + Intergenic
1132935479 16:2478408-2478430 CACCCCATGCAGAGTGTGGAGGG + Intronic
1133060572 16:3171861-3171883 CCTACCAAGCCCAGTGTGGATGG + Intergenic
1134827180 16:17294197-17294219 CTGACAAAGCAGAGTGGGGAAGG + Intronic
1137224778 16:46492830-46492852 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1139691050 16:68642397-68642419 CTTGCCATCCAGAGTGTGGAGGG - Intronic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1142562132 17:816476-816498 CGGACCAAGCAGATGGTGGAGGG - Intronic
1143714490 17:8757257-8757279 CCTACCAAGGAGCCTGTTGAAGG + Exonic
1154517469 18:15188483-15188505 CATACAAAGCAGTGTGTAGAGGG + Intergenic
1155675031 18:28419693-28419715 CATTCAAAGCAGAGTGTAGAGGG - Intergenic
1155721410 18:29017299-29017321 CATACTAAGCAGAGAGTTGATGG + Intergenic
1155734359 18:29202379-29202401 CCTGCTAAGCTGAGTTTGGAAGG - Intergenic
1156471513 18:37379957-37379979 CCTTCCACTCAGAGGGTGGATGG + Intronic
1159349517 18:67253619-67253641 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1162923877 19:13919853-13919875 CCCACCCAGCAGAGTCTGGTGGG + Exonic
1163668339 19:18613369-18613391 CTTACCCAGCAGAGTGCGGAAGG - Intronic
1164307391 19:24016524-24016546 CCTTCAAAGCAGTGTGTAGAGGG - Intergenic
1165600476 19:37051871-37051893 CATTCAAAGCAGTGTGTGGAGGG - Intronic
1165677139 19:37736252-37736274 ACTCCCAAGCAGAATGTTGAAGG + Intronic
1165873808 19:38991634-38991656 CCAACCAAGCAGAATGGGGTGGG - Intronic
1166172238 19:41037068-41037090 CCTACACAGCAGTGTGTAGAGGG + Intergenic
1166440328 19:42808604-42808626 CATTCAAAGCAGTGTGTGGAGGG - Intronic
1168260246 19:55189482-55189504 CCGACTGAGCAGAGTGAGGAAGG - Intronic
925045580 2:770980-771002 CCAAGGGAGCAGAGTGTGGAGGG - Intergenic
925869897 2:8261041-8261063 CCTTCCATGCAGAGAGTGGTAGG - Intergenic
928765299 2:34638298-34638320 CATACAAAGCAGTGTGTAGAGGG + Intergenic
929528217 2:42726191-42726213 CATACCAAACAGAGTGTTGATGG + Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932070658 2:68616804-68616826 CATACAAAGCAGTGTGTAGAGGG - Intronic
932332153 2:70903905-70903927 CCCACCAAGGAGATTGGGGAGGG - Intronic
932428923 2:71661878-71661900 CCCACCAAGCAGGGATTGGAGGG + Intronic
932881152 2:75503342-75503364 CCCAGGAAGCAGAGTGGGGAGGG + Intronic
933159401 2:79007507-79007529 CGCACCATGCAGAGTGTGGCAGG + Intergenic
936084264 2:109455865-109455887 CCCACCAACCAGGGTGGGGAGGG + Intronic
937254556 2:120546085-120546107 CCTACCAAGCCGAAGGTGCAAGG - Intergenic
937349073 2:121148647-121148669 CCTACCCAGCAGATTAAGGAAGG - Intergenic
940401626 2:153254620-153254642 CATCCAAAGCAGTGTGTGGAGGG - Intergenic
941263695 2:163331900-163331922 CCTAAGGAGGAGAGTGTGGACGG + Intergenic
942218628 2:173747261-173747283 CCAACCAGGCAGATGGTGGATGG - Intergenic
947328444 2:229002903-229002925 ATTTCCAAGCAGAGTGTTGAAGG - Intronic
948059572 2:235033020-235033042 CCTACCCAGCAGTGTAAGGAGGG - Intronic
1170364244 20:15582273-15582295 CCCACAAAGCAGAGTGCAGAAGG + Intronic
1172046485 20:32084236-32084258 CCAAGCAAGCAGAGTGTGACGGG - Intronic
1172579382 20:36034849-36034871 CATACCAAGCACTGTGTGGGGGG + Intergenic
1172718838 20:36983933-36983955 TCTAACAAGCAGAGCCTGGAGGG - Intergenic
1173477189 20:43368566-43368588 CATTCAAAGCAGAGTGTAGAGGG + Intergenic
1174039646 20:47689872-47689894 CCCACCAAGAGGTGTGTGGATGG - Intronic
1174419652 20:50391252-50391274 CCTACCAGGGAGAGAGGGGAAGG - Intergenic
1176114684 20:63426609-63426631 ATTTCCAAGCAAAGTGTGGAAGG - Intronic
1176635191 21:9186234-9186256 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1177181699 21:17751229-17751251 CATTCAAAGCAGAGTGTAGAGGG - Intergenic
1178301183 21:31454540-31454562 CCAACCCAGCAGGGTGAGGAAGG + Intronic
1178664302 21:34533320-34533342 CCTAACAGGCAGAGTGAGAATGG - Intronic
1179050886 21:37887843-37887865 CCTATCCTGCAGAATGTGGAAGG + Intronic
1179831702 21:44001061-44001083 CCTTCGAGGCAGAGTGTGCATGG + Intergenic
1180414957 22:12700562-12700584 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1180602028 22:17027116-17027138 CCTATAAAGCAGTGTGTAGAGGG + Intergenic
1182861941 22:33567940-33567962 CCTATCAGGCAGTGTGTGGGTGG + Intronic
1183513650 22:38250676-38250698 CCTTCCAAGCAAGGTGTGGGGGG + Intronic
1184021944 22:41826808-41826830 CCTCCCAAGCAGAGGAGGGAAGG + Intergenic
1184609288 22:45592272-45592294 GCCACCAACTAGAGTGTGGATGG - Intronic
951650813 3:24949397-24949419 CCTACTAAGAAGAGGGTGCACGG + Intergenic
952455556 3:33468369-33468391 CCTACCAAGGAGAATGGGGCAGG - Intergenic
953629144 3:44597547-44597569 CATTCCAAGCAGGGTTTGGAAGG + Exonic
954058381 3:48047500-48047522 AATACCAAGCAAAGTGGGGAGGG + Intronic
954117970 3:48477783-48477805 CCCACAAGGCAGGGTGTGGAGGG - Intronic
957240914 3:77660277-77660299 ATTTCCAAGCAGAGTGTTGAAGG - Intergenic
957465088 3:80579509-80579531 CCTACCAAGGAGAGAGCTGAAGG - Intergenic
957753489 3:84455812-84455834 ACTACCAAGCAGAGGGTATATGG - Intergenic
958554802 3:95660459-95660481 CCTTCAAAGCAGTGTGTAGAGGG - Intergenic
960052906 3:113254645-113254667 CCTACCATGCTGAGTGTGTGTGG - Intronic
960154057 3:114279736-114279758 CATTCAAAGCAGTGTGTGGAGGG + Intronic
961185967 3:124915293-124915315 ATTACCAAGCACAGTGTGGAAGG - Intronic
965645951 3:170881713-170881735 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
967282264 3:187833840-187833862 CTTACTGAGCAGAGTGTGCATGG - Intergenic
968388583 4:169004-169026 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
970278066 4:14423691-14423713 CATACAAAGCAGTGTGTAGAGGG - Intergenic
971066678 4:23040725-23040747 CCTACCCAGCAGAAAGTAGATGG - Intergenic
972175518 4:36400909-36400931 GCAACCAAGAAGAGAGTGGAGGG - Intergenic
974530379 4:63099913-63099935 CCTTCAAAGCAGTGTGTAGAGGG + Intergenic
976246634 4:83012189-83012211 ACAACCAAGCAGAGTGCGGATGG - Intronic
977391191 4:96412349-96412371 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
977677952 4:99768592-99768614 CCTTCAAAGCAGTGTGTAGAGGG - Intergenic
977680714 4:99795788-99795810 CCTTCAAAGCAGTGTGTAGAGGG - Intergenic
977703451 4:100046677-100046699 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
979115556 4:116818046-116818068 CATACAAAGCAGTGTGTAGAGGG + Intergenic
979309810 4:119190011-119190033 CCTACAGAATAGAGTGTGGAGGG - Intergenic
980507021 4:133737086-133737108 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
981161742 4:141507041-141507063 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
981299368 4:143169421-143169443 CCTTCAAAGCAGTGTGTAGAGGG + Intergenic
983004369 4:162465773-162465795 CATTCAAAGCAGAGTGTAGAGGG - Intergenic
983515002 4:168646288-168646310 CCTACCAAGTAGAATATTGATGG + Intronic
983750786 4:171266968-171266990 CGCACCAAGCAGGCTGTGGAAGG + Intergenic
986597373 5:9437751-9437773 CTTACCAAGGAGAGAGAGGATGG + Exonic
989655584 5:43744368-43744390 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
991629684 5:68644092-68644114 CTGACCAAGAAGAGTGTGTATGG - Intergenic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
996114423 5:119602296-119602318 CCTTCAAAGCAGTGTGTAGAGGG + Intronic
998407086 5:141880061-141880083 CCCAGCAAGCAGACTGGGGAGGG - Intergenic
998803450 5:145894123-145894145 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1000271409 5:159687241-159687263 CATTCAAAGCAGAGTGTAGAGGG - Intergenic
1001027819 5:168238939-168238961 CCTACCAAGCCGACTGGGAAGGG + Intronic
1003487972 6:6595872-6595894 CCTATTCAGCAGTGTGTGGAGGG + Intronic
1005853623 6:29843215-29843237 ACTGCCCAGCAGAGTGTTGAGGG - Intergenic
1008643364 6:53487745-53487767 CATTCCAAGCAGTGTGTAGAGGG + Intergenic
1010744584 6:79546571-79546593 TCTCCCAAGGAGAGAGTGGATGG + Intergenic
1010827858 6:80495424-80495446 CCTTCAAAGCAGTGTGTAGAGGG - Intergenic
1010853015 6:80801318-80801340 CCTTCAAAGCAGTGTGTAGAGGG + Intergenic
1010997091 6:82546155-82546177 CATATAAAGCAGTGTGTGGAGGG - Intergenic
1011376460 6:86692533-86692555 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1012108385 6:95195667-95195689 CTTACAAAGAAGAGTGTAGAAGG - Intergenic
1012504445 6:99928989-99929011 CATTCAAAGCAGAGTGTAGAGGG - Intronic
1012671322 6:102051308-102051330 CCTAGCTTGCAGAGAGTGGAAGG - Intronic
1014633342 6:123814138-123814160 CCTACAAGGCAGGGGGTGGAGGG + Intronic
1017381123 6:153831492-153831514 CCCACACAGCAGAGTGTTGAAGG - Intergenic
1020019091 7:4851659-4851681 GTTTCCAAGCAGAGTGTAGAAGG + Intronic
1020045355 7:5036479-5036501 CCTACCAAGCAGCCTGTTGAAGG + Intronic
1020333160 7:7040729-7040751 CTTAGGAAGCTGAGTGTGGAGGG - Intergenic
1021549648 7:21856407-21856429 TCTAACAAGCACAGTGTGGTTGG + Intronic
1021645149 7:22782397-22782419 CCTGACAGGCAGAGTGTAGAAGG - Intergenic
1022805675 7:33819863-33819885 ATTTCCAAGCAAAGTGTGGAAGG - Intergenic
1023824961 7:44002800-44002822 CCTACCAAGCAGCCTGTTGAAGG - Exonic
1023985099 7:45089384-45089406 CTGACCAAGCAGAGGGTGCAGGG + Intergenic
1024215659 7:47246162-47246184 CCTACCAAGGAGAGGAGGGATGG + Intergenic
1024310721 7:47966567-47966589 CCTGACAAGCACAGTGTGAATGG - Intronic
1024904820 7:54365120-54365142 CCTATCAAGCAGAATGTGAGGGG - Intergenic
1025251294 7:57353238-57353260 CCTACCAGGGAGAGAGGGGAAGG + Intergenic
1026088512 7:67281587-67281609 CCTACCAAGCAGCCTGTTGAAGG - Intergenic
1026725740 7:72868765-72868787 CCTACCAAGCAGCCTGTTGAAGG + Intergenic
1026747819 7:73026630-73026652 CCTACCAAGCAGCCTGTTGAAGG + Intergenic
1026751469 7:73054769-73054791 CCTACCAAGCAGCCTGTTGAAGG + Intergenic
1026755118 7:73082883-73082905 CCTACCAAGCAGCCTGTTGAAGG + Intergenic
1026758768 7:73110917-73110939 CCTACCAAGCAGCCTGTTGAAGG + Intergenic
1027034025 7:74911924-74911946 CCTACCAAGCAGCCTGTTGAAGG + Intergenic
1027088638 7:75282569-75282591 CCTACCAAGCAGCCTGTTGAAGG - Intergenic
1027092281 7:75310497-75310519 CCTACCAAGCAGCCTGTTGAAGG - Intergenic
1027095924 7:75338464-75338486 CCTACCAAGCAGCCTGTTGAAGG - Intergenic
1027118112 7:75496887-75496909 CCTACCAAGCAGCCTGTTGAAGG - Intergenic
1027273692 7:76538581-76538603 CCTACCAAGCAGCCTGTTGAAGG + Intergenic
1027323417 7:77029228-77029250 CCTACCAAGCAGCCTGTTGAAGG + Intergenic
1027327141 7:77057632-77057654 CCTACCAAGCAGCCTGTTGAAGG + Intergenic
1028577783 7:92371387-92371409 CCTGCAAAGAAAAGTGTGGAGGG + Intronic
1029396023 7:100309175-100309197 CCTACCAAGCAGCCTGTTGAAGG - Exonic
1029396246 7:100310561-100310583 CCTACCAAGCAGCCTGTTGAAGG - Exonic
1029396471 7:100311951-100311973 CCTACCAAGCAGCCTGTTGAAGG - Exonic
1029396696 7:100313341-100313363 CCTACCAAGCAGCCTGTTGAAGG - Exonic
1029396921 7:100314733-100314755 CCTACCAAGCAGCCTGTTGAAGG - Exonic
1029719390 7:102353153-102353175 CCTACCAAGCAGCCTGTTGAAGG + Intergenic
1029753224 7:102556113-102556135 CCTACCAAGCAGCCTGTTGAAGG - Exonic
1029771176 7:102655197-102655219 CCTACCAAGCAGCCTGTTGAAGG - Exonic
1030851562 7:114492563-114492585 CATTCAAAGCAGTGTGTGGAGGG - Intronic
1031673594 7:124581700-124581722 CCTTCAAAGCAGTGTGTAGAGGG - Intergenic
1032535989 7:132664529-132664551 CCTTCAAAGCAGTGTGTAGAGGG + Intronic
1032537418 7:132676546-132676568 CCTTCAAAGCAGTGTGTAGAGGG - Intronic
1034889519 7:154827677-154827699 CAGCCCAAGCAGAGTGAGGAGGG + Intronic
1035881982 8:3253180-3253202 CATACAAAGCAGTGTGTAGAGGG - Intronic
1037588598 8:20294972-20294994 TCCCCCAAGCAGAGTGTGGGAGG + Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1037930621 8:22878079-22878101 CCAGCCAAGCTGAGTTTGGAGGG - Intronic
1038116512 8:24561679-24561701 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1038225952 8:25658092-25658114 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1039174481 8:34787295-34787317 CCTACTAAGCAAAGAGTAGAGGG - Intergenic
1039751622 8:40483922-40483944 GCTTCCAAACAGAGTATGGAGGG + Intergenic
1039794444 8:40900299-40900321 CCAGCAGAGCAGAGTGTGGAGGG + Intergenic
1040086414 8:43347589-43347611 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1041286087 8:56263536-56263558 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1047364080 8:124196244-124196266 CCTACCAAGAAGAGAGGGAAGGG - Intergenic
1047710843 8:127550747-127550769 ACTACCCTGCAGAGAGTGGAGGG + Intergenic
1047837498 8:128710222-128710244 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1048883376 8:138888360-138888382 CCTTCCAAGGTGAGTTTGGAAGG + Intronic
1049025897 8:139988659-139988681 CCTCCCAAGCAGCGTGGTGAAGG + Intronic
1049069160 8:140343883-140343905 CACACCCAGCTGAGTGTGGAGGG + Intronic
1049691519 8:143962778-143962800 ATTTCCAAGCAAAGTGTGGAAGG + Intronic
1050373877 9:4950861-4950883 CATTCAAAGCAGAGTGTAGAGGG - Intergenic
1050659273 9:7865257-7865279 CATACAAAGCAGTGTGTAGAGGG - Intronic
1052239350 9:26252623-26252645 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1052645366 9:31227662-31227684 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1053718254 9:40918769-40918791 CATACAAAGCAGTGTGTAGAGGG + Intergenic
1055333224 9:75205783-75205805 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1056192141 9:84194850-84194872 CCTACCCAGGAGGGTGGGGATGG + Intergenic
1056985272 9:91358250-91358272 ACTACCAAGGTGAGGGTGGAGGG + Intronic
1061604432 9:131698237-131698259 CCTAACAAGCAAAGGGAGGAGGG + Intronic
1061885155 9:133587632-133587654 CCCACCAGGCAGGGTGTGGGAGG + Intergenic
1062161585 9:135083359-135083381 CCTGCCAGGGAGAGTGCGGAGGG + Intronic
1203688914 Un_GL000214v1:23665-23687 CCTGCCAGGCTGAGTGTGCAGGG + Intergenic
1203757970 Un_GL000218v1:153541-153563 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1203647361 Un_KI270751v1:80388-80410 CCTGCCAGGCTGAGTGTGCAGGG - Intergenic
1187118448 X:16379060-16379082 CTTACCAAGGAGAATGTTGATGG - Intergenic
1187260593 X:17682104-17682126 ACTGCCAAGCAGAGTGGGCAAGG + Intronic
1188494656 X:30770916-30770938 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1190562075 X:51695930-51695952 CCTTCCAAGCAAATTGCGGAAGG + Intergenic
1190601106 X:52093777-52093799 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1191028801 X:55944982-55945004 CATACAAAGCAGTGTGTAGAGGG - Intergenic
1191118081 X:56871963-56871985 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1191134781 X:57051894-57051916 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1191681186 X:63841620-63841642 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1191890847 X:65938766-65938788 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1192253362 X:69432699-69432721 CCAACCAAGTAGAGTTTGAAGGG + Intergenic
1192712090 X:73601550-73601572 CATTCAAAGCAGTGTGTGGAGGG + Intronic
1192842913 X:74876142-74876164 CATTCAAAGCAGTGTGTGGAGGG - Intronic
1193164056 X:78261795-78261817 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1193987841 X:88268222-88268244 TCTACCAGGCAGAGTGTTGAAGG + Intergenic
1195099755 X:101543190-101543212 CATACAAAGCAGTGTGTAGAGGG + Intergenic
1195827043 X:109013357-109013379 CATACAAAGCAGTGTGTAGAGGG + Intergenic
1201570550 Y:15409094-15409116 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1201780103 Y:17711332-17711354 CATTCAAAGCAGAGTGTAGAGGG + Intergenic
1201821452 Y:18194660-18194682 CATTCAAAGCAGAGTGTAGAGGG - Intergenic
1201976314 Y:19852952-19852974 CATTCAAAGCAGAGTGTAGAGGG + Intergenic