ID: 917982731

View in Genome Browser
Species Human (GRCh38)
Location 1:180281735-180281757
Sequence CTGTGGAGAAGTATTGAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917982728_917982731 6 Left 917982728 1:180281706-180281728 CCACAGGGAAGTACATAGTTCAG 0: 1
1: 0
2: 0
3: 15
4: 128
Right 917982731 1:180281735-180281757 CTGTGGAGAAGTATTGAGTTAGG 0: 1
1: 0
2: 0
3: 9
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917982731 Original CRISPR CTGTGGAGAAGTATTGAGTT AGG Intronic
900189198 1:1346170-1346192 CTGTGGGGAGCTATGGAGTTGGG - Intronic
900525303 1:3125575-3125597 CTCTGGAGGAGCAATGAGTTAGG + Intronic
901910925 1:12457344-12457366 CTGGGAAAATGTATTGAGTTGGG - Intronic
903826789 1:26151468-26151490 ATGTGGAGAAGCATGGTGTTTGG - Intergenic
904254183 1:29244092-29244114 CTGGGGAGAAAGATTGAGATGGG + Intronic
908035685 1:60049806-60049828 CTATAGAGAAGTTTTAAGTTGGG - Intronic
908344045 1:63213294-63213316 TTGTGGAGAGGTAGGGAGTTAGG - Intergenic
909338346 1:74502793-74502815 CTGTGGAGTTGTGTTCAGTTTGG - Intronic
913009318 1:114667282-114667304 CTGTAAAGAAGTATAGATTTAGG - Intronic
915777757 1:158509676-158509698 CTGTGGAGAAATGTTTATTTAGG + Intergenic
916368141 1:164057200-164057222 GTCTGGGGAAGTGTTGAGTTAGG + Intergenic
917747882 1:178028108-178028130 CTGTGGGGAAGTCTGGGGTTTGG + Intergenic
917942243 1:179933887-179933909 ATCTGAAGGAGTATTGAGTTTGG + Intergenic
917982731 1:180281735-180281757 CTGTGGAGAAGTATTGAGTTAGG + Intronic
918226866 1:182491841-182491863 CGGAGGAGAAGTATTCATTTGGG - Intronic
919871246 1:201823133-201823155 CTGTGGTGAGGGATGGAGTTGGG - Exonic
920570848 1:207016196-207016218 CTGTAGAGATGTACAGAGTTTGG + Intronic
922285840 1:224169895-224169917 CTTCGGAGAAGCTTTGAGTTGGG + Intergenic
923276304 1:232399977-232399999 CTGTGCAGGAGCATTGAGTGAGG + Intronic
1068241715 10:54310450-54310472 CTTTGGAGATTGATTGAGTTTGG + Intronic
1070403331 10:76072889-76072911 CTGTGGAGTAGTCTTGAAGTAGG + Intronic
1071530289 10:86385754-86385776 CTGTTTAGAAGTATTTATTTTGG - Intergenic
1072969768 10:100007221-100007243 CTGTGGAGAACTTTAGAGTCAGG - Intronic
1074184655 10:111089918-111089940 CTTTGGAGAACTCATGAGTTAGG - Intergenic
1075603714 10:123789347-123789369 CAGTGGAGAAGTCGTGAGATGGG - Intronic
1076609628 10:131714298-131714320 CTGTGCAGAGCTTTTGAGTTTGG + Intergenic
1079590754 11:22179607-22179629 ATGTGGAAAATTATTGGGTTGGG - Intergenic
1080148399 11:29018112-29018134 CTGTGCACAAGTATTGTCTTTGG + Intergenic
1087554449 11:99697276-99697298 GTGTGGAGAAGGATGGGGTTGGG + Intronic
1092437901 12:8467174-8467196 CTTTGTAGAAGTTTTTAGTTTGG + Intronic
1093119126 12:15246363-15246385 CAGTGGAGAAGCTGTGAGTTAGG - Intronic
1093452358 12:19330978-19331000 CTTTGGAAAAGTATTGACATAGG - Intronic
1093519968 12:20037611-20037633 CTGTGGACAAATATTGATTGTGG - Intergenic
1097945771 12:65366168-65366190 ATGTGAAGAAGTATTGAGACAGG + Intronic
1098115631 12:67173390-67173412 CTGTGTAGTGGTACTGAGTTGGG + Intergenic
1098896917 12:76073473-76073495 TTGTGGAGAAGTATTGGGCAAGG - Intronic
1099013817 12:77322684-77322706 ATGTGGAGAAGAGTTGGGTTGGG + Intergenic
1101904802 12:108816624-108816646 CCGGGGAGAAGTATGGAGATTGG - Intronic
1102633745 12:114304446-114304468 CTGTGAAGATGCATGGAGTTGGG - Intergenic
1102719490 12:115003751-115003773 CTATGGAGAAGGAATGAGTTTGG - Intergenic
1105225173 13:18425207-18425229 CTTTGGAGAGATTTTGAGTTTGG - Intergenic
1105318882 13:19297760-19297782 GTGTGGAGAACTACTGTGTTAGG + Intergenic
1112607819 13:100924646-100924668 CTGTGGATAAGATTTGAGATGGG - Intergenic
1112609943 13:100946212-100946234 CTGTGGGGAAGGAATGAGCTTGG - Intergenic
1113381487 13:109809978-109810000 CTGTGGAGAAGCTCTGAGTGAGG + Intergenic
1113545869 13:111149516-111149538 CTGAGGAGAAATATAGCGTTAGG + Intronic
1115308234 14:31953821-31953843 CTGAGGAGAAGCAGAGAGTTGGG - Intergenic
1117868273 14:60171767-60171789 CTCTGCAGAAGCATGGAGTTTGG + Intergenic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1118543404 14:66857644-66857666 CTGTGGAGAGTTGTTAAGTTTGG - Intronic
1119402773 14:74375369-74375391 CAGTGGAGAAGTATTGTTTGGGG + Intergenic
1122416562 14:101552496-101552518 CTGGTGAGGAGGATTGAGTTGGG + Intergenic
1131802746 15:96088840-96088862 CTGTGGAGAGGTGTTTAGTTTGG + Intergenic
1132121529 15:99180119-99180141 CTGAGGAGAAGGAGTGAGTGTGG - Intronic
1137758878 16:50924681-50924703 CTCTGGAGGAGTTTGGAGTTGGG - Intergenic
1139395873 16:66638373-66638395 CTGTGTAGAAGTATTGACAATGG - Intronic
1140679591 16:77371966-77371988 CTTTTGAGAAGTATTTATTTAGG - Intronic
1141047843 16:80733157-80733179 CCTGGGAGAAGTATAGAGTTAGG + Intronic
1141737112 16:85861120-85861142 CTGTTGAGAACTACTGAATTAGG - Intergenic
1141863234 16:86732335-86732357 GTGAGGAGAAATAGTGAGTTAGG + Intergenic
1143318953 17:6055262-6055284 GAGTGCAGAAGGATTGAGTTCGG + Intronic
1144103465 17:11964455-11964477 TGGTGAAGAAGTATTGATTTTGG - Intronic
1147019780 17:37521914-37521936 CTGAGGAGAAGAGTTCAGTTTGG + Intronic
1149058010 17:52388301-52388323 CTTTGGAGAACTATTGAGTAGGG + Intergenic
1149276644 17:55047428-55047450 CAATGGAGAAGTAATGAGATTGG - Intronic
1149348502 17:55763536-55763558 TTTTGGAGAATAATTGAGTTAGG + Intronic
1152060896 17:78074523-78074545 CTGTGGAGTAGGACAGAGTTAGG + Intronic
1154240115 18:12645685-12645707 CTTTGTAGATGTATTGAATTGGG - Intronic
1155208456 18:23580702-23580724 CTCTGGAGAAGCAATGAGGTAGG - Intronic
1155403748 18:25465553-25465575 CTGAAGAGAAGTGTTGAGTGGGG + Intergenic
1157645081 18:49260407-49260429 CTGTGGAGAACTTCTCAGTTTGG - Intronic
1159275369 18:66213046-66213068 CAGAGGATAAGTATTGATTTTGG + Intergenic
1163618189 19:18341789-18341811 CTGTACAGAAGGATAGAGTTAGG + Intronic
1164585699 19:29473885-29473907 TTGTGCAGAAGTTTTTAGTTTGG + Intergenic
1166161218 19:40954874-40954896 CTGTGGATAAGTAGTGTGCTTGG + Intergenic
1168372345 19:55846729-55846751 CCTTGGAGAAGTATTGCCTTAGG + Intronic
927631776 2:24780753-24780775 CTGTGGAGAAAAATTAAGTAGGG + Intergenic
929646515 2:43633757-43633779 CTGGGGAGAAGGTTTGAATTTGG - Intergenic
930784204 2:55255274-55255296 CTGAGGGGAAATATAGAGTTGGG + Intronic
930806134 2:55492448-55492470 CTGTGGAGAATTATGGAGTGGGG + Intergenic
933877844 2:86636854-86636876 CTTTGCAGAAGTTTTGAGTCAGG + Intronic
934144768 2:89081047-89081069 CTGTGATGAGGTTTTGAGTTGGG + Intergenic
934224489 2:90119504-90119526 CTGTGATGAGGTTTTGAGTTGGG - Intergenic
936376984 2:111949105-111949127 CTCTGAAGAAGTGATGAGTTGGG - Intronic
936476747 2:112846201-112846223 CTGTGGAGTAGGATTATGTTGGG - Intergenic
937671463 2:124541930-124541952 CTATTGAGAAAAATTGAGTTGGG - Intronic
942609592 2:177729175-177729197 CTATGGAGGAGCATAGAGTTGGG - Intronic
943610228 2:190024103-190024125 ATGTGGAGAAGTAATGAGATGGG + Intronic
945150338 2:206784047-206784069 CTTTGGAGAAATGTTGAGGTGGG - Intronic
945935249 2:215897230-215897252 CTGGGGAGAATTATTGAGCAGGG + Intergenic
947738645 2:232474412-232474434 CTGTGGGGAACTTTAGAGTTAGG + Intergenic
1171856773 20:30352099-30352121 CTTTGGAGATGTATTTATTTAGG + Intergenic
1174982933 20:55418050-55418072 CTTAAGAGAAGTATGGAGTTGGG + Intergenic
1176074777 20:63243469-63243491 CTGTGGAGAAGGATAGAGCCGGG - Intronic
1176313376 21:5217795-5217817 CTCTGGAGATGTATTTATTTAGG - Intergenic
1176769225 21:13054225-13054247 CTTTGGAGAGATTTTGAGTTTGG - Intergenic
1179928077 21:44549558-44549580 CTGTGGAGAAGTAAAGACTCAGG + Intronic
1182431704 22:30302642-30302664 CTGGAGAGAAGCAGTGAGTTAGG + Intronic
949850559 3:8416301-8416323 CTGTTAAAAACTATTGAGTTTGG + Intergenic
953193139 3:40708392-40708414 CAGTGGTGAGGTATGGAGTTGGG + Intergenic
953690809 3:45117515-45117537 CTTTGGAGAATGATGGAGTTGGG - Intronic
955081577 3:55662578-55662600 CTGGGGAGAAGTGTAGAGTTGGG + Intronic
957912743 3:86642781-86642803 CTGTGGTGAATTATTGAAATAGG + Intergenic
959398778 3:105873752-105873774 GTGTGGAAAAGAATTGATTTGGG - Intergenic
962017384 3:131455825-131455847 GTGTGGAGAACTACTGTGTTAGG + Intergenic
963940200 3:151089660-151089682 ATGTGGAGAAGTATGGGGGTGGG + Intronic
964445839 3:156756426-156756448 CTGTTGAGAAATCCTGAGTTAGG - Intergenic
964812731 3:160683214-160683236 CTGTGGGGCAGTAATGAGCTGGG - Intergenic
965328146 3:167333840-167333862 CTCTGGAGAAGTACAGATTTGGG + Exonic
967956868 3:194884124-194884146 CTGTGGAGAGATATTGACATTGG + Intergenic
970243514 4:14033982-14034004 CTTTTGAGAAATATTGATTTAGG - Intergenic
970394181 4:15649208-15649230 ATGTGGAGAAAAACTGAGTTGGG - Intronic
971357715 4:25910046-25910068 CTGGGGGGAAGAATTGGGTTGGG - Intronic
982956763 4:161779110-161779132 CTGGGGAGAGGGATAGAGTTTGG + Intronic
983336506 4:166400380-166400402 CTCTGGATAAATATGGAGTTGGG - Intergenic
983925415 4:173396011-173396033 CTGTGAAGATGTATTGTGGTGGG + Intronic
984422090 4:179536585-179536607 CTGTGGAGAAATAAGGAATTTGG + Intergenic
986506900 5:8461338-8461360 ATGTGGAGAAGAAATGAGTGAGG + Intergenic
994071372 5:95606697-95606719 GTTTGAAGAAGTATTAAGTTGGG - Intergenic
997849714 5:137320406-137320428 CAGTGGAGAAGCCATGAGTTGGG - Intronic
999339151 5:150753860-150753882 CTGTGGAGTAGGATTGGGTTGGG - Intronic
1001175588 5:169465514-169465536 ATGGGGAGAATAATTGAGTTAGG - Intergenic
1001195683 5:169671596-169671618 CTATGAAGAAGTTTTGACTTTGG + Intronic
1002096162 5:176832281-176832303 CTGTGGAGAAGTCAGGTGTTTGG + Intronic
1003181181 6:3793207-3793229 CTGTGGAGAAGTTAGGAGATTGG - Intergenic
1007285015 6:40741374-40741396 CTGGGGAGAAGGCTTGAGTTTGG - Intergenic
1007326698 6:41067109-41067131 TTGTGGAAAAGTAAGGAGTTAGG - Exonic
1007694570 6:43724117-43724139 CTGGGGAGAAGGATTGGGATTGG + Intergenic
1008595863 6:53041157-53041179 CTGGGAAGAAGCATTGAGTCTGG - Exonic
1009672303 6:66771785-66771807 CTTGGGAGGAGTATTGAGGTAGG + Intergenic
1011615456 6:89193952-89193974 CAGTGTAGAAGTCATGAGTTGGG - Intronic
1012391043 6:98740493-98740515 CTATGGAGAAGCATTGACTGTGG + Intergenic
1012643973 6:101656829-101656851 TTTTGGAGAAGTGTTGTGTTTGG - Intronic
1023039076 7:36156412-36156434 CTTTGCAGAAGGAGTGAGTTAGG - Intronic
1024483239 7:49887183-49887205 CTGTTCAGTAGTATTGAGATTGG - Intronic
1026422292 7:70252398-70252420 CTTTGGAGAAGTATCTATTTAGG + Intronic
1026851772 7:73728650-73728672 CTGTGGAGAAGAATTAAGCAGGG - Intergenic
1027799128 7:82730551-82730573 CTGTGGATGAGAATTGAGTAGGG - Intergenic
1028230728 7:88303606-88303628 TTGTGGAGAAGAATTTAGATTGG + Intronic
1029106447 7:98180606-98180628 TTGTGGAGAAGTAGAGAGTTTGG + Intronic
1030443179 7:109614700-109614722 CTGTGGTTAAGGAATGAGTTGGG + Intergenic
1031201002 7:118685300-118685322 CTGTTAAGAAGTAAGGAGTTAGG + Intergenic
1033136082 7:138785578-138785600 CAGTGAAGAAGTATTCAGCTTGG - Intronic
1035166064 7:156990596-156990618 CTGTGGACAAGTGCTGAGATAGG + Intergenic
1040700394 8:50056467-50056489 CTGTGGAGAAGGATGAAGTCAGG + Intronic
1043280427 8:78458762-78458784 CTGTGCAGAAGCTTTTAGTTTGG - Intergenic
1043414954 8:80038178-80038200 TTTTGGAGAAGTCTTGAATTCGG - Exonic
1044833302 8:96271125-96271147 CTGGGGAGAAGTATGGAGAGAGG - Intronic
1048604920 8:135957533-135957555 CTTTGCAGAAGAATAGAGTTAGG - Intergenic
1048691461 8:136969354-136969376 CTGTGAAGCAGGAATGAGTTTGG - Intergenic
1052302982 9:26974496-26974518 CTTTAGAGAGGTTTTGAGTTTGG + Intronic
1056655174 9:88503076-88503098 CTGGGGAGAAGGATGGAGCTGGG + Intergenic
1056721864 9:89078910-89078932 ATCTGAAGAAGTATTGAGCTCGG - Intronic
1058062622 9:100514470-100514492 CTGTGGTCAGGTATTCAGTTAGG + Intronic
1058295829 9:103305250-103305272 CTATGGAGAAGTTTGGAGGTGGG - Intergenic
1058747684 9:108007812-108007834 CTGTGGAGAGGTCTAGAGCTGGG - Intergenic
1059285067 9:113165489-113165511 CCTTGGAGAAAAATTGAGTTTGG - Intronic
1059688879 9:116664494-116664516 CTGTAGATAACTATTGTGTTAGG - Intronic
1060425600 9:123502481-123502503 CTTTGGAGAAATATCGAGTCAGG + Intronic
1186693701 X:12006649-12006671 CTGTGGAGAAGGAGGGAGTCTGG - Intergenic
1186768372 X:12793071-12793093 CTCTGGAGAAGGATAGAGCTAGG + Intronic
1188316110 X:28675685-28675707 CTGTGGAGAAATATGGGGGTGGG + Intronic
1188649766 X:32617720-32617742 CTGTGCAGAAATTTTTAGTTTGG - Intronic
1189218197 X:39345172-39345194 GTGTGGAGAGATATTGAGGTGGG - Intergenic
1191017337 X:55823531-55823553 ATTTGGACAAGTGTTGAGTTTGG + Intergenic
1191979627 X:66911672-66911694 CTGTGAGGAAGTTTGGAGTTTGG - Intergenic
1195727418 X:107932789-107932811 CTGAGAAGCAGTATTGAATTGGG - Intergenic
1195918443 X:109958702-109958724 CAGGGGAGAAGTATAGCGTTTGG - Intergenic
1196759606 X:119189743-119189765 CTGGGGAGAAGCTCTGAGTTGGG - Intergenic
1198220017 X:134590343-134590365 CTTTGGACCAGTATTGTGTTAGG + Intronic
1199107361 X:143886098-143886120 GTGTGGAGAATAATTAAGTTAGG + Intergenic
1201540715 Y:15102309-15102331 CTGTGGAGAGGGTTTAAGTTAGG + Intergenic