ID: 917983396

View in Genome Browser
Species Human (GRCh38)
Location 1:180289481-180289503
Sequence GTGTACACTCTGACATCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917983396_917983398 15 Left 917983396 1:180289481-180289503 CCTTTAGATGTCAGAGTGTACAC 0: 1
1: 0
2: 1
3: 6
4: 90
Right 917983398 1:180289519-180289541 AGACAACACTAGAGCATTACAGG 0: 1
1: 0
2: 0
3: 11
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917983396 Original CRISPR GTGTACACTCTGACATCTAA AGG (reversed) Intronic
905547615 1:38811976-38811998 GTGTACGGTCTGAAATCAAAAGG - Intergenic
905609087 1:39333088-39333110 TTGTTCATTCTGACATGTAAAGG - Intronic
913817670 1:123005162-123005184 GTGGATATTCTGACATCTTATGG + Intergenic
913821431 1:123072455-123072477 GTGGATACTCTGACATCTTGTGG + Intergenic
913833701 1:123292681-123292703 GTGGATATTCTGACATCTAGTGG + Intergenic
913836533 1:123342825-123342847 GTGGATACTCTGACATCTTGTGG + Intergenic
913846404 1:123520056-123520078 GTGGATATTCTGACATCTAGTGG + Intergenic
913860487 1:123773108-123773130 GTGGATATTCTGACATCTTATGG + Intergenic
913861676 1:123794188-123794210 GTGGATATTCTGACATCTAGTGG + Intergenic
913864986 1:123853995-123854017 GTGGATATTCTGACATCTAGTGG + Intergenic
913890836 1:124316815-124316837 GTGGATACTCTGACATCTTGTGG + Intergenic
913894085 1:124374962-124374984 GTGGATATTCTGACATCTAGTGG + Intergenic
917983396 1:180289481-180289503 GTGTACACTCTGACATCTAAAGG - Intronic
922545091 1:226450708-226450730 TTCTACCCTCTGACATCAAAAGG - Intergenic
924001259 1:239555177-239555199 GTGAGCACTCTGAGACCTAAAGG + Intronic
924825974 1:247539330-247539352 TTGGGCACTGTGACATCTAAAGG + Intronic
1064142284 10:12800510-12800532 GGGCACACTCTGACATCCTAAGG + Intronic
1065559424 10:26946873-26946895 GTGCACTCTCTGGCATCCAAAGG + Intergenic
1067006985 10:42673597-42673619 ATGTACACTCTGCCATATGATGG + Intergenic
1069651927 10:70054925-70054947 GTGTAAAGTCTGACAATTAATGG - Intronic
1071263871 10:83946299-83946321 ATTTACTCTCTGAAATCTAAGGG + Intergenic
1079698249 11:23510922-23510944 GTTTACACTCTGACATGAAGTGG + Intergenic
1080648063 11:34201608-34201630 GGGTACACTCTGAGGTCCAAGGG + Intronic
1080680464 11:34470765-34470787 GTGAACACTCTGACATATACTGG - Intronic
1082429862 11:52651038-52651060 TTGGAAACTGTGACATCTAAGGG - Intergenic
1085197091 11:74679358-74679380 GTGTAGACACTGCCATCAAAAGG - Intergenic
1086359417 11:86042071-86042093 CTGTACAGTCTGCCATCTAGTGG - Intronic
1086980656 11:93194860-93194882 ATGTGCACTTTGATATCTAATGG + Intronic
1094180760 12:27590523-27590545 CTGTAGACTGTGAGATCTAAAGG - Intronic
1110364885 13:74671079-74671101 TTGTAAAATCTGACATCTACAGG - Intergenic
1115478584 14:33839794-33839816 ATGTACACTCTGCCCTCTAGTGG - Intergenic
1116549409 14:46216351-46216373 ATGTATACTCTGAAATCTAGGGG - Intergenic
1118576086 14:67241935-67241957 GACTACATTCTGACTTCTAAAGG - Intronic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122649177 14:103216327-103216349 ATGTACACTCACACATCTATGGG + Intergenic
1123791376 15:23724037-23724059 GTGTACCCTATGAGACCTAATGG + Intergenic
1125246084 15:37642323-37642345 AAGTACACGCTGACATGTAAAGG + Intergenic
1128007737 15:64260869-64260891 GTGTACTCTTTGACACGTAAAGG - Intronic
1138111945 16:54330821-54330843 TGGTCCACTCTGACATCTGATGG + Intergenic
1140801481 16:78492180-78492202 GTGCACACACTGTCACCTAATGG - Intronic
1148447483 17:47746361-47746383 GTGTGCACCCTGACATTGAAAGG + Intergenic
1149500726 17:57150370-57150392 GTGATCACTCAGTCATCTAAGGG + Intergenic
1159316732 18:66784592-66784614 GTGTACACACTAACATGTGAGGG + Intergenic
1159366151 18:67467999-67468021 ATGTACACTCTCAAAGCTAAAGG + Intergenic
1161444792 19:4312036-4312058 GAGTACACCCTGACAGGTAAGGG + Exonic
1163740374 19:19008127-19008149 GTGAACACACTCAAATCTAAAGG + Intronic
1164388985 19:27801331-27801353 TTGAACACTCTTACATCTCACGG + Intergenic
1168194953 19:54767300-54767322 GTGTACACTCTGGTATCTGTTGG - Intronic
929310415 2:40417745-40417767 GTGGACACTGTGCCATCCAAAGG - Intronic
929870056 2:45751659-45751681 GATTACATTCTGACATCTATTGG - Intronic
933408490 2:81894044-81894066 GTGTACCCTATGACCTCTACAGG - Intergenic
934508601 2:94917578-94917600 GTGTACACTCTGACATAGGATGG + Intergenic
941022809 2:160427143-160427165 GTGGACACTTTTCCATCTAAGGG + Intronic
946160799 2:217834882-217834904 GTCCACACTCACACATCTAAGGG - Intronic
1169709625 20:8547207-8547229 GTGTTCAGTCTGTCATCTTACGG + Intronic
952952777 3:38538340-38538362 GTGGACACACTGACATTTGAAGG - Intronic
955751034 3:62185606-62185628 GAGTACACACTCCCATCTAAAGG + Intronic
956295205 3:67704799-67704821 GTTTACATTCTCACATCTGAGGG - Intergenic
961300458 3:125918693-125918715 GTGCACCCTGTGACATCTGAAGG + Intergenic
963680623 3:148371171-148371193 TTGTAAACTCTCACATCTCATGG + Intergenic
965661913 3:171050976-171050998 TTGAATTCTCTGACATCTAAAGG + Intergenic
972490447 4:39582219-39582241 GAGTACCCTCTGAAACCTAAAGG + Intronic
977553065 4:98462637-98462659 GTCATCACTCTGACAACTAATGG - Intergenic
979862457 4:125710587-125710609 ATGTACACTCTGACTTATTATGG + Intergenic
979881387 4:125963865-125963887 GTACACCCTCTGAAATCTAAGGG - Intergenic
984091368 4:175379127-175379149 TTTTACACTCTGACATCTCAGGG - Intergenic
987669033 5:20984239-20984261 GTCTACTCTCTTACAGCTAAAGG - Intergenic
988355767 5:30171969-30171991 GTTTACATTCTAACATCTAGTGG - Intergenic
988725533 5:33922712-33922734 GTTTCCACTCTGCCAACTAAAGG + Intergenic
989768242 5:45111984-45112006 GTGTACACTCTAATATATAGGGG + Intergenic
990010847 5:50995453-50995475 GTGTACACTCCCACATCCTAGGG + Intergenic
991272819 5:64805856-64805878 GTGTTCACTCTTACAATTAAGGG + Intronic
992942334 5:81774672-81774694 GAGAAGACTCTGACATGTAAGGG + Intergenic
994603904 5:101942866-101942888 GGGTGCAGCCTGACATCTAAAGG + Intergenic
1005254448 6:23985842-23985864 TTTTACAATCTGAAATCTAAAGG - Intergenic
1006380140 6:33692565-33692587 GGGTCCACTCTGCCATCTGATGG + Intronic
1007908403 6:45487976-45487998 GTGTTCATTCTGAGGTCTAAGGG + Intronic
1012257645 6:97052144-97052166 ATGTACACACTGAAATATAAAGG - Intronic
1033426795 7:141252143-141252165 GTCCACACTCTGCCCTCTAATGG - Intronic
1035861000 8:3027563-3027585 GTGTACACGATGACATTCAAGGG + Intronic
1039634817 8:39152957-39152979 GTGGACATACTGACATGTAATGG + Intronic
1040792272 8:51246007-51246029 GTTTCCAGTCTGGCATCTAAGGG + Intergenic
1041388553 8:57329391-57329413 GTGAACACTCCAACATCTACTGG + Intergenic
1041964040 8:63653686-63653708 TTGTACAATCTGATAACTAAAGG + Intergenic
1042233951 8:66589083-66589105 GTGTATATTCTGAAATCTAGAGG - Intronic
1046949268 8:120004191-120004213 GAGAAAACTCTGTCATCTAATGG + Intronic
1047623350 8:126631029-126631051 GTTCAGACTCTGACATCTAAAGG + Intergenic
1048037573 8:130692454-130692476 GTGTACACACTGAAATACAAAGG - Intergenic
1048846329 8:138606521-138606543 GTGACCACTCTGAAATCAAAAGG + Intronic
1050299327 9:4241139-4241161 GTGCACACTCTGAAATCTAAAGG + Intronic
1053473906 9:38367792-38367814 GTGCCCACTCTGACTTCTAAGGG - Intergenic
1059305130 9:113348129-113348151 GAGTACTCTCTGACACCTGAAGG + Intergenic
1059938124 9:119332113-119332135 GTGCACTCTCTGATTTCTAAGGG + Intronic
1189236479 X:39490895-39490917 GTCAACAATCTCACATCTAAGGG + Intergenic
1189580937 X:42405642-42405664 TTCTACATTCTGACATTTAATGG + Intergenic
1197888088 X:131238946-131238968 GTTTCAACTTTGACATCTAATGG + Intergenic
1198717864 X:139580793-139580815 GTGTACACTCTTCCACCTAAAGG + Intergenic
1199442177 X:147880918-147880940 GTCTAGACTCTGGAATCTAAAGG - Intergenic