ID: 917984390

View in Genome Browser
Species Human (GRCh38)
Location 1:180300054-180300076
Sequence CAGGATTTACAACCTGCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917984387_917984390 -1 Left 917984387 1:180300032-180300054 CCTAGTTTTAATCGGAAGGAGCC 0: 1
1: 0
2: 0
3: 3
4: 45
Right 917984390 1:180300054-180300076 CAGGATTTACAACCTGCTTAAGG 0: 1
1: 0
2: 3
3: 8
4: 129
917984383_917984390 27 Left 917984383 1:180300004-180300026 CCTCTAGTTAACCTGCGATTGGC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 917984390 1:180300054-180300076 CAGGATTTACAACCTGCTTAAGG 0: 1
1: 0
2: 3
3: 8
4: 129
917984384_917984390 16 Left 917984384 1:180300015-180300037 CCTGCGATTGGCTCTGACCTAGT 0: 1
1: 0
2: 0
3: 4
4: 44
Right 917984390 1:180300054-180300076 CAGGATTTACAACCTGCTTAAGG 0: 1
1: 0
2: 3
3: 8
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917984390 Original CRISPR CAGGATTTACAACCTGCTTA AGG Intronic
903934886 1:26888834-26888856 CAGGAGTTAGAACCTGCCTGTGG + Intronic
905620971 1:39447076-39447098 CAGGATCTACAACCTGCTTTGGG - Intronic
907060209 1:51414511-51414533 TAGGATTTAAAACATGCTTTTGG - Intronic
908107424 1:60859551-60859573 TAGGATTTTCCACCTGATTAAGG + Intergenic
916818298 1:168374135-168374157 CAGGAATTACAACCTGCTGAAGG + Intergenic
917984390 1:180300054-180300076 CAGGATTTACAACCTGCTTAAGG + Intronic
918724243 1:187896847-187896869 TAGGTTTTACAACCTACTTTGGG + Intergenic
923200073 1:231703094-231703116 CAGGATTTTCTACCTCCTTTTGG - Intronic
924670559 1:246120206-246120228 AAGGATTTATAACTTGCTTCAGG + Intronic
1063083972 10:2797902-2797924 CAGAATTTCCATCCTTCTTAAGG - Intergenic
1063281838 10:4638084-4638106 CACGACTTGCAACCTGCATATGG - Intergenic
1063513232 10:6667880-6667902 CAGGATTTACAAATTGCACAGGG - Intergenic
1064156303 10:12906020-12906042 CTGCATTTCCAACCTGTTTATGG - Intronic
1068772240 10:60835143-60835165 CAGAGTTTACAACCTGCTGGAGG + Intergenic
1069421107 10:68247358-68247380 TAGCAGTTACAACCTTCTTATGG - Intergenic
1069654691 10:70079183-70079205 CAGGGTTGACAACCTGGTTTAGG - Intronic
1072627256 10:97120611-97120633 CAGGCTTTGCATCCTGCTGAGGG + Intronic
1074994161 10:118741396-118741418 CAGAATTTACCAACTGCTTCTGG + Intronic
1076319536 10:129567528-129567550 CAGGATTTTCAACCTACTGTTGG - Intronic
1077637371 11:3852721-3852743 CAGGATTTCCTTCTTGCTTAAGG + Intergenic
1077960792 11:7074486-7074508 CAGGATTTCCAAGCTGCCCAAGG + Intergenic
1078689913 11:13569410-13569432 CAGGATTTCCATCCTCTTTAAGG - Intergenic
1079946136 11:26743667-26743689 CAATATTTAAAACCTGCTGATGG - Intergenic
1080610771 11:33901802-33901824 CAGGATTTATAGCCTGCTGCTGG + Intergenic
1080672595 11:34394979-34395001 CAGGCTTGAAAACCTGCTTCAGG + Intergenic
1085669325 11:78447665-78447687 CTGGATTTACCCCCTTCTTAAGG - Intronic
1088102190 11:106167782-106167804 CATGATTTACCACCTGGTTTTGG - Intergenic
1089565314 11:119368236-119368258 CAGGAAGTTCAACCTCCTTAGGG + Intronic
1097193884 12:57233336-57233358 CAGGATCCCCAACCTGCTTTAGG - Exonic
1097503302 12:60433751-60433773 TAGGATTTTCAACCTGCTTCAGG - Intergenic
1097552340 12:61090521-61090543 CAGGATTCATCACCTGCTAATGG - Intergenic
1097819253 12:64111244-64111266 CAGGCTTTATAATCTGCTTTTGG - Intronic
1099019938 12:77390762-77390784 CAGGTTATACACCCTTCTTAGGG - Intergenic
1100260151 12:92925550-92925572 CAAGGTTTACAAGCTGCCTAAGG + Intronic
1105654767 13:22424397-22424419 CAGGAGTTACAACCAGCATTTGG - Intergenic
1107093832 13:36513293-36513315 CAGGATATAGAAGCTGCTTAAGG + Intergenic
1108691965 13:52867231-52867253 CAGGATGTACAGCCTGGTCAGGG - Intergenic
1109944253 13:69411384-69411406 TAGGATTTACAACATGCTTATGG + Intergenic
1110282230 13:73707483-73707505 CAGGACTTACAAACAACTTACGG + Intronic
1112497405 13:99915928-99915950 CAGGATTTTCATTCTCCTTAGGG - Intergenic
1112954497 13:105041696-105041718 TTGGATTTCCAACTTGCTTAGGG - Intergenic
1113244154 13:108376498-108376520 CTGGATTTTCCACCTGCTGACGG - Intergenic
1114456272 14:22855886-22855908 CAGGATATATAACTTGCTGAAGG - Intergenic
1123929805 15:25160493-25160515 CAAGCTTTACAACCTCCTTGAGG + Intergenic
1127826285 15:62706679-62706701 CATGAATTATAACCTTCTTATGG + Intronic
1131919753 15:97311815-97311837 CTTCATTGACAACCTGCTTATGG - Intergenic
1133528365 16:6628606-6628628 AAAGATTTACACCCTGCTGAAGG - Intronic
1135209974 16:20516996-20517018 CAGGTTCTGCAACCTCCTTATGG - Intergenic
1136738268 16:32484423-32484445 CAGTGTTTACAAACTGCTGAAGG - Intergenic
1140929013 16:79609875-79609897 CAGGATTTACATCCTCATTTTGG - Intergenic
1142897096 17:2987945-2987967 CAGGATGTACAAACAGCTGAAGG - Intronic
1144747537 17:17625876-17625898 AAGGATTTGAAACCTGATTAGGG - Intergenic
1147961138 17:44168350-44168372 CAGGAGCTAGAACTTGCTTATGG + Intergenic
1150590129 17:66554860-66554882 AAGAATTTACAATCTACTTAAGG - Intronic
1150633618 17:66897753-66897775 CTCGATTTACAACCTGATGAAGG + Intergenic
1158480845 18:57820530-57820552 CAGAATTTCCTACCTGTTTAAGG - Intergenic
1163868824 19:19800858-19800880 CAGGATTAAAAACCTGTTTCAGG + Intronic
1165752476 19:38268862-38268884 CAGGATTTACCACCTGGGTGGGG - Intronic
925359008 2:3264305-3264327 CAGGATTTCCTTCCTTCTTAGGG + Intronic
930536040 2:52647852-52647874 CTGGATTTTCAACTTGCATAGGG - Intergenic
930731787 2:54734848-54734870 CTAGATTTAAAACTTGCTTAAGG + Intronic
932625800 2:73294851-73294873 CAAGATTCACAGCCTCCTTAAGG - Intergenic
933813366 2:86047315-86047337 CTGGATTTACATCCTGATTCTGG - Intronic
935760871 2:106319481-106319503 AAGGCCTTACAACCTGCTTCAGG - Intergenic
942879803 2:180845469-180845491 AAATATTTACAACCTGCTTTTGG - Intergenic
946108711 2:217395125-217395147 AATGTTGTACAACCTGCTTAGGG - Intronic
1184177588 22:42797812-42797834 CAGGATTCACATCCTGCCTCTGG + Intronic
1184550028 22:45199561-45199583 AAGGCTTTTCAGCCTGCTTAAGG - Intronic
952954291 3:38547435-38547457 CAGAATTTACATCCTTTTTAAGG - Intergenic
952956337 3:38560137-38560159 CAGGACTTACCACCTGCAGAAGG + Exonic
956474564 3:69606643-69606665 CAGGATTATTAACCTGCATAAGG + Intergenic
956714723 3:72068752-72068774 GGGGACTTACAACTTGCTTAAGG - Intergenic
957461144 3:80522006-80522028 CAGGATTTTCCCCCTTCTTAAGG - Intergenic
957698458 3:83676849-83676871 CAGGAATTACAAACTGCTTTAGG + Intergenic
957818419 3:85334691-85334713 CAAGATTTAGAACCTTCTTAAGG - Intronic
958266286 3:91441277-91441299 TAGGTTTTATAACCTGCTTTAGG - Intergenic
958267645 3:91458270-91458292 CAGGATTTGGAACATGCTTCAGG - Intergenic
962079863 3:132126782-132126804 CACGTTTTACATCCTCCTTAAGG - Intronic
967234414 3:187370328-187370350 AAGGATACGCAACCTGCTTAAGG - Intronic
970697791 4:18697891-18697913 TAGGTTTTATAACCTGCTTCAGG + Intergenic
972739181 4:41874469-41874491 CAGGATTGACCAGCTGCTTGAGG - Intergenic
974597169 4:64029686-64029708 AAGGATTTTGAACCTGCTTGGGG - Intergenic
974639832 4:64614077-64614099 CAGAATTTATTACCTGTTTAAGG + Intergenic
978277425 4:106968376-106968398 CAGGATAATCAACTTGCTTAAGG + Intronic
985041095 4:185892586-185892608 CAGGATTTCCTTCCTTCTTAAGG - Intronic
985148112 4:186915704-186915726 CCGCATTTCCAACCTGCTTCTGG + Intergenic
986439819 5:7770518-7770540 CAGAATTTACAAGCTTCTCATGG + Intronic
987338448 5:16918311-16918333 CAAGATTTACAAACTGCATATGG + Intronic
987484385 5:18506027-18506049 CAGCATTACCCACCTGCTTATGG + Intergenic
989830414 5:45910506-45910528 CAGTGTTTACAAACTGCTGAAGG - Intergenic
990899919 5:60739109-60739131 CAGGATTCATGACCTGCTGATGG + Intergenic
995519566 5:112988772-112988794 CAGGAGTTACAATCTAGTTAAGG + Intronic
996056141 5:118984718-118984740 CATGTTTTAAAACCTGTTTAAGG - Intronic
997705129 5:135943477-135943499 CAGGACTTAAAACCTGATTAGGG + Intronic
998141292 5:139701040-139701062 AAGAATTTACAACCTACTTTGGG - Intergenic
999802726 5:155052790-155052812 TACAATTTACAACCTGCTTCTGG - Intergenic
1004348786 6:14872683-14872705 CAGGTTTTAGGACCTGCTTCAGG + Intergenic
1007071330 6:39040476-39040498 CAGAATTTAAAACCGGCCTATGG - Intergenic
1008600984 6:53094520-53094542 CAGGATTGAAAACGTGCATATGG - Intronic
1008987569 6:57563320-57563342 CAGGATTTGGAACATGCTTCTGG + Intronic
1008988990 6:57580699-57580721 AAGGTTTTATAACCTGCTTTAGG + Intronic
1009176171 6:60461925-60461947 CAGGATTTGGAACATGCTTCAGG + Intergenic
1009177532 6:60478937-60478959 TAGGTTTTATAACCTGCTTTAGG + Intergenic
1010952204 6:82050107-82050129 TAGGATTTATACCCTGCTTCAGG + Intergenic
1012189483 6:96261873-96261895 CAGCATTTATCACCTGCTAATGG + Intergenic
1013422495 6:109979085-109979107 CCGGATTTGCACCCTGCATAGGG - Exonic
1016322927 6:142867038-142867060 CAGTATTTCCAACCTGCTCTGGG + Intronic
1017281468 6:152630462-152630484 CAGGATATACAGGCTGCTAATGG - Intronic
1019780831 7:2938711-2938733 CAGGATCTACAACCTGCAGGAGG - Exonic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1024743403 7:52379814-52379836 CAGGATTTCCATCCTTTTTATGG - Intergenic
1025526516 7:61819572-61819594 CAGTGTTTACAAACTGCTGAAGG - Intergenic
1025549892 7:62232128-62232150 CAGTGTTTACAAACTGCTGAAGG - Intergenic
1025579856 7:62698650-62698672 CAGGGTTTCCAAACTGCTGATGG + Intergenic
1028394258 7:90349771-90349793 CAGCATTAACAACCTGATTTGGG + Intronic
1038232533 8:25715887-25715909 CAAGATTTCCATCCTTCTTATGG + Intergenic
1039311755 8:36323944-36323966 GAGGATTTACAGCCTGCTAAAGG + Intergenic
1040347662 8:46523904-46523926 CAGTGTTTCCAACCTGCTGAAGG - Intergenic
1041214016 8:55581923-55581945 CAGAGTTTACAAACTGCTTCAGG - Intergenic
1041784241 8:61613749-61613771 CAGGATATAGCCCCTGCTTATGG - Intronic
1043392947 8:79808960-79808982 TAGGATTTAGTGCCTGCTTAGGG + Intergenic
1043793854 8:84510445-84510467 CATTATGTACAACTTGCTTATGG + Intronic
1048703199 8:137118354-137118376 CTGAATCTACCACCTGCTTAGGG - Intergenic
1048928789 8:139294310-139294332 CAGGATTTGCTTCCTTCTTAAGG - Intergenic
1049333520 8:142069034-142069056 CAGGATTTTCTTCCTGCTTAAGG - Intergenic
1051027042 9:12625360-12625382 AAGTATTTATAATCTGCTTAAGG - Intergenic
1051448957 9:17173998-17174020 CAGGATTTACAAACAGGCTAGGG - Intronic
1051754337 9:20380352-20380374 CATGATTTACAGCATTCTTAGGG + Intronic
1052482937 9:29055374-29055396 CAGGATTTACTTCCTTATTAAGG + Intergenic
1055150828 9:72997411-72997433 CAGCATTTACAAACTGAGTATGG - Intronic
1058590923 9:106564986-106565008 CAGGATTCACATGCTGATTACGG - Intergenic
1203787078 EBV:134074-134096 TAAGATTTACAACCTGTTTGTGG + Intergenic
1191680845 X:63838621-63838643 CAGGATTTACTTCCTTTTTAAGG - Intergenic
1195634157 X:107094524-107094546 GAGCATCTTCAACCTGCTTATGG + Intronic
1195949141 X:110248992-110249014 CAGAATTTACCACCTTCTCAGGG - Intronic
1196728813 X:118921560-118921582 CAGCATTGACAACCTGATTGGGG - Intergenic
1196867254 X:120081454-120081476 CAGGAGAAACAACCTGCCTAGGG - Intergenic
1196875845 X:120154828-120154850 CAGGAGAAACAACCTGCCTAGGG + Intergenic
1199883631 X:151996911-151996933 CAGCATTTAGAACTTTCTTAAGG - Intergenic
1202358388 Y:24075798-24075820 CAGGATTTAACACCTGCCAAGGG - Intergenic
1202512390 Y:25594315-25594337 CAGGATTTAACACCTGCCAAGGG + Intergenic