ID: 917985124

View in Genome Browser
Species Human (GRCh38)
Location 1:180308767-180308789
Sequence GGGTGAGCAAACACTCTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 63}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917985124_917985127 -2 Left 917985124 1:180308767-180308789 CCAGTTAGAGTGTTTGCTCACCC 0: 1
1: 0
2: 0
3: 14
4: 63
Right 917985127 1:180308788-180308810 CCATTTACCGCTATAGATACTGG 0: 1
1: 0
2: 0
3: 3
4: 37
917985124_917985133 15 Left 917985124 1:180308767-180308789 CCAGTTAGAGTGTTTGCTCACCC 0: 1
1: 0
2: 0
3: 14
4: 63
Right 917985133 1:180308805-180308827 TACTGGGTTCTTTATTGGGTGGG 0: 1
1: 0
2: 0
3: 13
4: 153
917985124_917985128 -1 Left 917985124 1:180308767-180308789 CCAGTTAGAGTGTTTGCTCACCC 0: 1
1: 0
2: 0
3: 14
4: 63
Right 917985128 1:180308789-180308811 CATTTACCGCTATAGATACTGGG 0: 1
1: 0
2: 0
3: 6
4: 47
917985124_917985132 14 Left 917985124 1:180308767-180308789 CCAGTTAGAGTGTTTGCTCACCC 0: 1
1: 0
2: 0
3: 14
4: 63
Right 917985132 1:180308804-180308826 ATACTGGGTTCTTTATTGGGTGG 0: 1
1: 0
2: 1
3: 31
4: 160
917985124_917985131 11 Left 917985124 1:180308767-180308789 CCAGTTAGAGTGTTTGCTCACCC 0: 1
1: 0
2: 0
3: 14
4: 63
Right 917985131 1:180308801-180308823 TAGATACTGGGTTCTTTATTGGG 0: 1
1: 0
2: 4
3: 11
4: 202
917985124_917985130 10 Left 917985124 1:180308767-180308789 CCAGTTAGAGTGTTTGCTCACCC 0: 1
1: 0
2: 0
3: 14
4: 63
Right 917985130 1:180308800-180308822 ATAGATACTGGGTTCTTTATTGG 0: 1
1: 0
2: 2
3: 13
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917985124 Original CRISPR GGGTGAGCAAACACTCTAAC TGG (reversed) Intronic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
905523291 1:38616647-38616669 GGAAGAGCAAAAACTCTCACTGG + Intergenic
916039904 1:160953043-160953065 GGGAGGGCAAACCCACTAACGGG + Intronic
917985124 1:180308767-180308789 GGGTGAGCAAACACTCTAACTGG - Intronic
920048385 1:203148538-203148560 GGGTGACAAAACACTGTGACAGG - Intronic
921781213 1:219167001-219167023 GGGTTCACAAACCCTCTAACGGG + Intergenic
921791858 1:219299299-219299321 GGGCGAGCAAACACTGTTACCGG + Intergenic
921791925 1:219299953-219299975 GGGTGAGCAAACACTGTTATAGG + Intergenic
922711909 1:227840648-227840670 GGGTGAGCAAACTCTGTAAAGGG - Intronic
1063342600 10:5282230-5282252 CTGTGAGCAAACACTCCAATAGG - Intergenic
1066343270 10:34557174-34557196 AGATGAGCACACATTCTAACAGG - Intronic
1069889924 10:71646331-71646353 GGATGGGCAGAGACTCTAACAGG + Intronic
1074678112 10:115875693-115875715 GGCTGAGCAAAGAACCTAACAGG + Intronic
1076745170 10:132509338-132509360 GGGTGAGCAAACATACAAACAGG + Intergenic
1087824518 11:102749718-102749740 GGGTGAGCAATCACACTACCTGG - Intergenic
1089573443 11:119424543-119424565 GGGTGATGGAACACTCTAACTGG + Intronic
1090065332 11:123498497-123498519 GGGTGAGCAATTACCGTAACTGG - Intergenic
1093223423 12:16450548-16450570 GAGTGAGAAAATACTGTAACAGG + Intronic
1095830899 12:46585718-46585740 GGGTCAACAGACACTCAAACAGG - Intergenic
1101697915 12:107143907-107143929 TGTTGAGCTAACACTCTAACAGG - Intergenic
1120429188 14:84392644-84392666 GGAAGGGCCAACACTCTAACAGG + Intergenic
1121031732 14:90664119-90664141 GGATGAGCAAACAGCCTAAGGGG - Intronic
1122546460 14:102525321-102525343 GGGTGAGCAAACAGTCTATACGG + Intergenic
1126779162 15:52123869-52123891 GGGTGAGCCAACACTCAACAAGG + Intronic
1127178160 15:56383348-56383370 AGGTGAGCAAACACAGTACCTGG - Intronic
1130368833 15:83265672-83265694 AGGTGAGCAAACATTTTTACAGG + Intronic
1150715926 17:67572548-67572570 TGGTAAGCTCACACTCTAACAGG - Intronic
1151651905 17:75475445-75475467 GGGAGAGGAAACAGCCTAACAGG - Intronic
1153715225 18:7840187-7840209 AGGTGAGCACACACAGTAACTGG - Intronic
1155013045 18:21801856-21801878 GGGTGAGAAGACACTCCAAGTGG - Intronic
1158325239 18:56306800-56306822 GTGTGAGCAAACCCTCCAACAGG + Intergenic
1159732048 18:72039808-72039830 TTGTGAGCAAAAACTCGAACAGG - Intergenic
927292860 2:21421803-21421825 GCGTGAGCACACAGTGTAACTGG + Intergenic
934960963 2:98672489-98672511 GGCTGAGCAAAGACTCTCATTGG - Intronic
945951431 2:216042321-216042343 AGGCGAGCAAAAACTCAAACTGG - Intronic
945973291 2:216251310-216251332 GGGAGACCAAAGACTGTAACAGG - Intergenic
947883837 2:233546469-233546491 GGCTGAGCAAAAACTGTAGCAGG + Intronic
1170530220 20:17283814-17283836 GGCTGAGCAAACATGCTAGCTGG - Intronic
1171778006 20:29388748-29388770 GGGTGAGCAATCACAGTACCTGG - Intergenic
1171819774 20:29824140-29824162 GGGTGAGCAATCACAGTACCTGG - Intergenic
1180323774 22:11348831-11348853 GGGTGAGCAATCACAGTACCTGG - Intergenic
962767447 3:138578919-138578941 AGGTGAGCAATCACAGTAACTGG + Intronic
963797596 3:149646599-149646621 GGTTGGGCATCCACTCTAACTGG + Intronic
970832274 4:20354696-20354718 GGGTTTGCAAACAATCTAAATGG + Intronic
973987938 4:56373720-56373742 GGGAGAGCAAACTTTCTAACAGG + Intronic
974896471 4:67945646-67945668 GGGGGAGCAAAGACTCTACTTGG - Intronic
976901638 4:90184667-90184689 GGCTGAGCAAACACTTTACCTGG - Intronic
980966162 4:139523119-139523141 GGGTGAGGAAACTCTCTTACAGG + Intronic
983373297 4:166892903-166892925 GGGTCAGCAAACACTGCGACAGG + Intronic
992006076 5:72478775-72478797 GGGTGAGCAAACCCTTTCAATGG - Intronic
993201528 5:84822290-84822312 AGGTGAGAAAACACTCAAAGAGG - Intergenic
1003795634 6:9599843-9599865 GGGTGAGCAAACAGAGAAACAGG + Intronic
1003843920 6:10152707-10152729 GGATGAACAAACTCTCTAAAGGG + Intronic
1006018820 6:31104471-31104493 AGGTGAGCAATCACAGTAACTGG - Intergenic
1009039588 6:58160131-58160153 AGGTGAGCAATCACACTACCTGG - Intergenic
1009215485 6:60914970-60914992 AGGTGAGCAATCACACTACCTGG - Intergenic
1011134364 6:84084259-84084281 GGGTGAGGAAGCATTTTAACAGG + Intronic
1018247378 6:161835819-161835841 GGGTTTGCAAACACGCTAACTGG + Intronic
1023076708 7:36490346-36490368 GGCAGAGCCAACACTCAAACTGG + Intergenic
1028097615 7:86781639-86781661 AGGTGAGAAAACAATCTCACAGG - Intronic
1029513666 7:101012689-101012711 GGGTGGGCAAAGACTCCCACGGG + Intronic
1031412621 7:121457594-121457616 AGGTGAGCAATCACTGTACCTGG - Intergenic
1031827864 7:126588830-126588852 GGGTGAACACACACCCTCACTGG + Intronic
1034070142 7:148176558-148176580 GGGAGAGCTAACACTTTAACTGG - Intronic
1035006893 7:155670324-155670346 GGGTGAGCAGTCACTCTGGCTGG - Intronic
1038244282 8:25840263-25840285 GGCTGAGCAACCTCTCCAACAGG + Intergenic
1043441389 8:80279698-80279720 GAGTCAGCAAACACTCTTGCAGG + Intergenic
1045621095 8:103979628-103979650 AGGTGAGCAAACACAGTACCTGG + Intronic
1054256126 9:62815178-62815200 GGGTGAGCAATCACAGTACCTGG + Intergenic
1054335182 9:63800435-63800457 GGGTGAGCAATCACAGTACCTGG - Intergenic
1203371448 Un_KI270442v1:309405-309427 GGGTGAGCAATCACAGTACCTGG - Intergenic
1185495052 X:548253-548275 AGGTGAGCAAACACTTTCCCTGG - Intergenic
1189890179 X:45592577-45592599 GGGTGAGCACTCACAGTAACTGG - Intergenic
1190088841 X:47419918-47419940 GGGTCAGCAAACACTGTGATTGG - Intergenic
1192046132 X:67675743-67675765 AGGTGAGCAATCACAGTAACTGG - Intronic
1197005676 X:121493902-121493924 GGGTGCCCAGACAATCTAACAGG - Intergenic
1200697018 Y:6369932-6369954 GGGTATGAAAACACTCAAACTGG + Intergenic
1201037095 Y:9794767-9794789 GGGTATGAAAACACTCAAACTGG - Intergenic