ID: 917985898

View in Genome Browser
Species Human (GRCh38)
Location 1:180318261-180318283
Sequence TTTTATCTTTAAAATGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1262
Summary {0: 1, 1: 0, 2: 9, 3: 111, 4: 1141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917985898 Original CRISPR TTTTATCTTTAAAATGTTGA GGG (reversed) Intronic
901113538 1:6819121-6819143 TTTTAAATATAAAATGTTGAGGG + Intronic
902177728 1:14663763-14663785 TTTTATTTTCAAAATGTTTGAGG - Intronic
902893201 1:19460122-19460144 TTCTATCTGTAAAATTGTGAAGG + Intronic
903083310 1:20831307-20831329 TTCAATCTTTAAAATGTTCCTGG + Intronic
904341038 1:29834787-29834809 CTTTATCTTTAAAATGGGGGAGG + Intergenic
904764953 1:32838484-32838506 TTTTATAATTAAAAAGTTGGGGG - Intronic
904783868 1:32970982-32971004 TTTTATCTCCAAAATGCTTATGG + Intergenic
905041411 1:34962761-34962783 TGACATCTTTAAAGTGTTGAGGG + Intergenic
905286948 1:36887123-36887145 TTTTTTCTATACAATGCTGATGG - Intronic
905759882 1:40546499-40546521 TTTTCTCTATAGCATGTTGATGG + Intronic
905782596 1:40725670-40725692 TGTTATATTTTAAATGATGATGG - Intronic
907180729 1:52567852-52567874 ATTTCTCTTTAAAATATTGTTGG - Intergenic
907635309 1:56128591-56128613 TTTAATTTCTAAAAGGTTGAAGG + Intergenic
907741841 1:57173937-57173959 TTTTATATTTAAAATGAACAAGG + Intronic
907745611 1:57210239-57210261 ATTATTCTTTAAAATGTTAATGG - Intronic
907811344 1:57873523-57873545 TTTAATCTTGAAATTGTAGATGG + Intronic
907822346 1:57983234-57983256 TGTTTTATTTAATATGTTGAAGG - Intronic
907836376 1:58112893-58112915 CTTTATCTTTAAAATCTTCAGGG - Intronic
908138061 1:61153565-61153587 TTTTATATTCATACTGTTGATGG - Intronic
908174454 1:61540555-61540577 TTTTATTTTTAAAATTTTTGTGG + Intergenic
908455417 1:64299209-64299231 TTTTTTTTTTAAACTGTTGTTGG - Intergenic
908547358 1:65174929-65174951 TTTTCTTTTTAAAATTTTTATGG + Intronic
908590030 1:65621219-65621241 TTTTATTTTTATATTTTTGAAGG + Intronic
908648921 1:66310835-66310857 TCTTATCTGTAAAATGGGGAAGG + Intronic
908733748 1:67254367-67254389 TATTATATTTAAAATGTTTTGGG - Intronic
909025847 1:70480887-70480909 TTTTATCTTTAAAAATTTAAAGG - Intergenic
909379242 1:74978770-74978792 TAATATCTTCAAAGTGTTGAGGG + Intergenic
909461693 1:75922882-75922904 TTTTATTTTTACAATGTAAATGG - Intronic
909552647 1:76916001-76916023 TTTTTTTTTTAAAATGCAGATGG - Intronic
909738253 1:78994566-78994588 TTTTATTTTTAAACTGACGATGG - Intronic
909794359 1:79714628-79714650 TTTGATATTTAAAATGGTGTGGG - Intergenic
909865467 1:80663069-80663091 TTTTGTCTTCAAAATTTTGGTGG - Intergenic
909877826 1:80832062-80832084 ATTTTTCTTTAAAATTTTGGGGG - Intergenic
910234519 1:85021952-85021974 ATTCAGCCTTAAAATGTTGAAGG - Intronic
910326980 1:86020499-86020521 TTATATTTATAACATGTTGATGG - Intronic
910666591 1:89731588-89731610 TTTTATTTTTAAAATTTAAATGG + Intronic
911145694 1:94550412-94550434 TTTTATTTTTATAATGAAGAGGG + Intergenic
911185577 1:94901047-94901069 TTTTATCTTTTATATATAGATGG - Intronic
911641104 1:100290269-100290291 TTTTTTTTTTAAGACGTTGATGG + Intronic
911658952 1:100478046-100478068 TTTTATATTTAAACTTTTAAAGG + Intronic
911660205 1:100493124-100493146 TTTTATATTTAGAATTTTGAAGG + Intronic
911768060 1:101702609-101702631 TTTAATCCTTGAAATTTTGAGGG - Intergenic
911868665 1:103062545-103062567 TTTTTTCTTTAGCTTGTTGATGG - Intronic
913092460 1:115487107-115487129 TTTAATCTTCAAAATTTTGAGGG - Intergenic
913092479 1:115487542-115487564 TATTATCCTTAAAATGTCCATGG - Intergenic
913117969 1:115713931-115713953 TCTTGTCTTTCAAATGTTGGAGG + Intronic
913304441 1:117411407-117411429 ATTTTTCTATACAATGTTGAAGG - Intronic
913420491 1:118662320-118662342 TAATATCTTTAAAATGCTGGGGG + Intergenic
913613048 1:120527277-120527299 ATTTAACCTTAAAATGTTGGGGG + Intergenic
914371397 1:147028007-147028029 ATTTAACCTTAAAATGTTGGGGG + Intergenic
914382392 1:147128931-147128953 CTTTATTTTAAAAATGGTGAAGG + Intergenic
914445046 1:147743093-147743115 TTTGATTTTTAAGAAGTTGATGG + Intergenic
914576833 1:148979548-148979570 TTTTATCTTTAAAACCTGTAAGG - Intronic
914578138 1:148994972-148994994 ATTTAACCTTAAAATGTTGGGGG - Intronic
915749700 1:158194677-158194699 TTTTATCTTTAAAAGCTAGGGGG - Intergenic
916339398 1:163712368-163712390 TTATATCTTTATAATTGTGATGG + Intergenic
916360737 1:163964478-163964500 TGACATATTTAAAATGTTGAAGG + Intergenic
916379344 1:164191344-164191366 TGACATATTTAAAATGTTGAAGG + Intergenic
916391439 1:164335155-164335177 TTCTACCTTTAGAATGTTCAAGG + Intergenic
916640986 1:166729009-166729031 TTTTATCTTGAAAATCTGGTAGG - Intergenic
916642814 1:166749400-166749422 TTAGTTCTTTAAAATTTTGATGG - Intergenic
916753806 1:167748480-167748502 TTTAATCTTTGCAATGTTGATGG + Intronic
917267674 1:173239030-173239052 TGTTATCTCCAAGATGTTGATGG + Intergenic
917467971 1:175299977-175299999 TTACAACTTTAAAAGGTTGATGG - Intergenic
917735279 1:177914507-177914529 TTGTATCTTTAACATGGAGATGG - Intergenic
917772298 1:178292870-178292892 TTCTATATTTAGAATGTTTAAGG + Intronic
917985898 1:180318261-180318283 TTTTATCTTTAAAATGTTGAGGG - Intronic
918495643 1:185132755-185132777 TTTTTTCCTCAAAATGTTCAAGG - Intronic
918524133 1:185446705-185446727 TTTTATCTTTAAAATATAAATGG + Intergenic
918627371 1:186672049-186672071 TTTTACGTTTAGAATGTTTAAGG - Exonic
918723721 1:187890093-187890115 TATTATCTGTAGAATTTTGAAGG + Intergenic
918747719 1:188227315-188227337 TGCTATATTTAAAATGCTGAAGG - Intergenic
918751422 1:188275906-188275928 TATTATTTTTAACATCTTGAAGG - Intergenic
918905032 1:190480271-190480293 TTTTCTCTTGCAAATGTTGATGG - Intergenic
918909809 1:190552742-190552764 TTTTAATTTAAAAATGTAGAAGG - Intergenic
919055210 1:192562261-192562283 TTTTATTCTTGAAATGTTAATGG + Intergenic
919192500 1:194241397-194241419 TTATATCTTCAAAGTGCTGATGG - Intergenic
919284651 1:195540059-195540081 ATTTATCTTTAACATTTTCAAGG - Intergenic
919583072 1:199401164-199401186 TTTTATCTTTATATTGTGTATGG - Intergenic
919976102 1:202613936-202613958 ATTTATTTTTAAAATTTTCACGG - Intronic
920578535 1:207082502-207082524 TTTTTTCTTTTACATGTTAAAGG - Intronic
920616546 1:207497885-207497907 TTTAAATTTTAAAATGCTGATGG + Intronic
920754093 1:208711425-208711447 CTTTATGTTTAACATTTTGAGGG + Intergenic
920909846 1:210206191-210206213 TTTAATCTTTAAAACTTTGTGGG + Intergenic
921307407 1:213810817-213810839 TCTTATCTGTAAAATGAGGATGG - Intergenic
921361981 1:214338850-214338872 TATTATCATTAAAATGTTTTTGG + Intergenic
921373855 1:214452966-214452988 ATTGATCTGTATAATGTTGAGGG - Intronic
921374331 1:214458575-214458597 TCTTATCTGTAAAATGGAGATGG - Intronic
921476033 1:215610772-215610794 TTTCATCTGTAAAATGGAGATGG + Intronic
921515274 1:216083578-216083600 TTTTATCTTTAAAGGGTTCCTGG - Exonic
921760440 1:218907665-218907687 TTTTATATTTTAAATGTTTGTGG + Intergenic
921800311 1:219395566-219395588 TTGTCTGTTTAAGATGTTGATGG + Intergenic
922436174 1:225608915-225608937 ATTTTTCTTCAAAATTTTGAAGG - Intronic
922546168 1:226458635-226458657 GTTTTTGTTTAACATGTTGAAGG + Intergenic
922946478 1:229520126-229520148 TTTTATTTTTAAATTTGTGACGG - Intronic
923327406 1:232892854-232892876 TATTATCTTTCAACTCTTGAGGG - Intergenic
923578361 1:235183032-235183054 TTTTATGTTTAAAATGTGATGGG - Intronic
923648850 1:235852794-235852816 GTTTATCTGTAAAATTTTGAGGG - Intronic
923734396 1:236590109-236590131 GTTTGTCTTTAAAATGTTAGTGG - Intronic
923909422 1:238423933-238423955 TTTATTCATTAAAATATTGATGG + Intergenic
924266069 1:242283838-242283860 TTTTATCTTTCAAATGGAAAAGG - Intronic
924905549 1:248448251-248448273 CTTTATCTTTGAAATCATGAAGG + Intergenic
924922341 1:248643785-248643807 CTTTATCTTTGAAATCATGAAGG - Intergenic
1063270500 10:4504815-4504837 TTTTATTTTTAAATTGTAGTGGG + Intergenic
1063771594 10:9209350-9209372 TTTTGTCTCTAAAATGTGCATGG - Intergenic
1063945458 10:11171842-11171864 TTTCTTCTTTAAAATGTTAAAGG + Intronic
1064452566 10:15456154-15456176 TTTTATTTTTATAATGTTACTGG + Intergenic
1064521067 10:16201796-16201818 TTTTGTTTTTAAAATGTTTGTGG + Intergenic
1064582505 10:16808580-16808602 TCTCATCTATAAAATGCTGACGG + Intronic
1065074502 10:22063269-22063291 GTTGATCTTTCTAATGTTGACGG - Intergenic
1065329281 10:24577077-24577099 TAATATCTCCAAAATGTTGAGGG + Intergenic
1065758255 10:28955347-28955369 TTTTGTCTGTAATAAGTTGATGG - Intergenic
1066119637 10:32272679-32272701 ATATATTTTTAAAAAGTTGAGGG - Intronic
1066333912 10:34456744-34456766 TTTTTCCTTTGAAATGTTAAAGG + Intronic
1066429761 10:35340471-35340493 TTTTACCTTAAAATGGTTGATGG + Intronic
1066718764 10:38314699-38314721 TTTTATCTTTCAAATGGAAAAGG + Intergenic
1066988275 10:42487573-42487595 CTTTTTCTTCAAAATGATGAGGG - Intergenic
1067357394 10:45542712-45542734 TTTTATTTTTTAGATTTTGAAGG + Intronic
1067550928 10:47235616-47235638 TTCTATGTTTAATATTTTGAGGG - Intergenic
1067934437 10:50597014-50597036 TTTTATCCTTAAAATCTTTGTGG - Intronic
1068014899 10:51503825-51503847 ATTTTTCTTTACAGTGTTGATGG + Intronic
1068042161 10:51838964-51838986 TTTTAAGTTTAATATTTTGAAGG + Intronic
1068132965 10:52918103-52918125 TTTTAACTTGAAAATGTTGGGGG - Intergenic
1068392202 10:56412968-56412990 TGGCATATTTAAAATGTTGAAGG - Intergenic
1068423574 10:56826046-56826068 TTTTTTTTTTAAACTGTTGTTGG - Intergenic
1068439699 10:57035782-57035804 TTTTATTTTTAAAATGTTTAGGG + Intergenic
1068929890 10:62578763-62578785 TTTTTTCTTTCATATTTTGAAGG - Intronic
1069002594 10:63282614-63282636 TTATATTTTTAAAATGTACAGGG + Intronic
1069389463 10:67918297-67918319 TTTTGTATTTCAAAAGTTGAAGG - Exonic
1069973267 10:72191600-72191622 TTTTCTTTTTAGAATGTTTATGG - Intronic
1070259163 10:74837421-74837443 TTTTTTCTATAAAAACTTGAAGG - Intronic
1070808264 10:79283626-79283648 TTTTGTTTTTAAAATGTTCTTGG - Intronic
1070942790 10:80361181-80361203 TGTACTCTTAAAAATGTTGAGGG - Intronic
1071088059 10:81887146-81887168 TGTCAGCATTAAAATGTTGATGG + Intronic
1071260147 10:83912352-83912374 TTTTAACTTACAGATGTTGAGGG + Intergenic
1071261296 10:83921601-83921623 TTCTATTTTTAATATTTTGAGGG - Intergenic
1071309881 10:84332784-84332806 TTTTTTCTTTAAAATAGAGATGG - Intronic
1071618638 10:87097735-87097757 TTTTATTTTTAAAATCATCATGG + Intronic
1071664065 10:87536498-87536520 TTTTATCTTGATTATGGTGATGG - Intronic
1071982433 10:91016995-91017017 TTTTTTCTTAAAAATTTTAATGG - Intergenic
1072232014 10:93421937-93421959 TTTTTTTTTTTAAATGCTGAAGG + Intronic
1072515455 10:96177232-96177254 TGATATTTTTAAAATATTGAAGG + Intronic
1072557530 10:96532716-96532738 TTTTATCTATAAAGTTTTGTTGG - Intronic
1072575574 10:96696996-96697018 TGTTCTCTTTAAAATGCTTATGG - Intronic
1072975566 10:100054541-100054563 TTTTATCTTCACAAAGATGATGG + Intronic
1073219742 10:101861114-101861136 TTTTCTCTTTATTATGTTAATGG - Intronic
1073608323 10:104918284-104918306 TCTCATCTGTAAAATGTTGTTGG - Intronic
1073872605 10:107882131-107882153 TGATATATTTAAAATGCTGAAGG + Intergenic
1074333966 10:112549582-112549604 TTTTTTCTCTAAAATATTTATGG - Intronic
1074455982 10:113595414-113595436 TTTTATCTGCAAAATGGTAATGG - Intronic
1074518879 10:114198647-114198669 TTTTTTCTTTTAAATGATGAGGG + Intronic
1074599303 10:114897563-114897585 TTTTATATCTAAATTGTTGGAGG + Intronic
1074641036 10:115380933-115380955 TTTTATGTTTAATATTTTCATGG + Intronic
1074641465 10:115387806-115387828 TTTTATCATTTATAAGTTGATGG + Intronic
1074747729 10:116552236-116552258 ATTTTTCTTTAATAAGTTGAAGG - Intronic
1074775496 10:116765533-116765555 TTTTATTTTTAATATGATTATGG - Intergenic
1074913886 10:117937647-117937669 TCTCATCTGTAAAATGTTGATGG - Intergenic
1075039744 10:119098530-119098552 TTTTATTTTTAAAAATCTGAGGG + Intergenic
1075214594 10:120520936-120520958 TTTTATATTGAAAATGTCCATGG + Intronic
1075525797 10:123185391-123185413 ATTTATGTTTAAAATATTCAAGG - Intergenic
1075981522 10:126744439-126744461 ATTTTTCTTTAGAATTTTGAAGG + Intergenic
1076073001 10:127507446-127507468 CTTTATCTGTAAAATGTAGTTGG - Intergenic
1077785887 11:5383095-5383117 TTTTTTTTTCTAAATGTTGATGG + Intronic
1077904716 11:6521521-6521543 TCTTACCTTCAAAATGTTTAGGG + Intronic
1078088641 11:8250085-8250107 AATTATTTTTAAATTGTTGAAGG + Intronic
1078306734 11:10195673-10195695 TTTTATGTTTAAAATATAAATGG + Intronic
1078324177 11:10366090-10366112 TTTTAACTTTCAAATTTTTAGGG - Intronic
1078556242 11:12328674-12328696 TTTTATATCTCAAATGCTGAAGG - Intronic
1078667362 11:13337656-13337678 TATTATCTATTAAATTTTGACGG + Intronic
1079016026 11:16869445-16869467 CTTCATCTCTAAAATGGTGATGG + Intronic
1079287251 11:19147193-19147215 TTCTACTTTTAAACTGTTGAAGG + Intronic
1079557918 11:21784059-21784081 TTGTATCTTAAAGAGGTTGAGGG + Intergenic
1079774212 11:24502965-24502987 TTGTACCTTTTAAATGTTGCTGG - Intronic
1079801703 11:24877443-24877465 TTTTATGTTTTAAATTTTTATGG + Intronic
1080026522 11:27620927-27620949 TGTTATTTTTAAAATACTGAGGG + Intergenic
1081143285 11:39531165-39531187 TTTAATTTTTAAAATGTTTGTGG + Intergenic
1081267136 11:41038780-41038802 TGTTTTAATTAAAATGTTGATGG + Intronic
1081282456 11:41226445-41226467 ATTTATCTGTAAAAGGTAGATGG - Intronic
1081439864 11:43068084-43068106 ATCCATCTTTAAAATGTTGTTGG - Intergenic
1081473234 11:43397202-43397224 TTTCATTTTTAAATTATTGATGG - Intronic
1081516544 11:43836981-43837003 TTTTATCATCAAAATCTTAATGG + Intronic
1081651689 11:44828068-44828090 TGTTATCATTATTATGTTGAGGG + Intronic
1081761421 11:45578870-45578892 TTTTATTTTAATTATGTTGATGG + Intergenic
1082689864 11:56287253-56287275 TTTTTTCTTTCAAATAATGATGG - Intergenic
1082709024 11:56530289-56530311 TTTTCTCTTTAAGCTGTAGAGGG - Intergenic
1082751851 11:57028029-57028051 TTTAACCATTAACATGTTGAAGG - Intergenic
1082910908 11:58373269-58373291 TTTTATTTTTAAAATCTTACTGG - Intergenic
1083122164 11:60524446-60524468 TTTTATCTGTAAAATTATGAGGG - Intronic
1084123233 11:67081780-67081802 TTATTTCTGTAAAATGTTGGTGG - Intergenic
1084351631 11:68604992-68605014 TTTTTTCTTTAAAATGTTTTTGG - Intronic
1084474157 11:69379191-69379213 GTCTGACTTTAAAATGTTGAGGG - Intergenic
1084628573 11:70329617-70329639 TTGTTTCTTTAAAATGTTTTTGG + Intronic
1084924012 11:72497073-72497095 ATAAGTCTTTAAAATGTTGAGGG + Intergenic
1085449066 11:76621220-76621242 TGTTATTTTTAAAATATGGAAGG + Intergenic
1085483839 11:76845154-76845176 TCTTATCTATAAAATGAGGATGG + Intergenic
1085865510 11:80286877-80286899 TTTTATTTTTAAAATGACTATGG - Intergenic
1085881740 11:80475192-80475214 TTTTAGCATTAAAATGAGGAAGG - Intergenic
1085909612 11:80806303-80806325 TTTTATTTTTATAATTTTGGGGG + Intergenic
1085949225 11:81309116-81309138 TTTTGTCTTTAACATCTTAAGGG - Intergenic
1086142127 11:83510937-83510959 TTTTATCTCTAAAATCTTGGAGG - Intronic
1086250186 11:84803141-84803163 TTTTATCTTTACAATTTTGTTGG - Intronic
1086348132 11:85918728-85918750 TTTTCTCCTTTAAATATTGAAGG - Intronic
1086396697 11:86422752-86422774 TTTTATCTTTTACATGTTTGGGG + Exonic
1086589712 11:88498661-88498683 TTTTCTGTTTAATATGTTAATGG + Intergenic
1086823201 11:91461679-91461701 TTTATTCTTTAAAATGATAAGGG - Intergenic
1087300924 11:96434151-96434173 TGTGATCTTTAAAATATTGTAGG + Intronic
1087441545 11:98190137-98190159 TTTTTTGTTTGAAATGTTGTTGG + Intergenic
1087539780 11:99501853-99501875 TTTGATTTTAAAAATGTGGAAGG + Intronic
1087803993 11:102535861-102535883 TTTAATTTTTAAAATGATCATGG + Intergenic
1087824884 11:102753849-102753871 TTTGATCCTTAAAATGATAAAGG + Intergenic
1088021034 11:105119818-105119840 TTTTGTCTTTACATTGTTGATGG - Intergenic
1088052273 11:105531804-105531826 TTTTTTGTTTAAAATGTTCTTGG + Intergenic
1088060903 11:105648503-105648525 TTTTATCTTTAAACTCTTTGAGG - Intronic
1088135944 11:106555246-106555268 TTTTAACTTTATATTGCTGAGGG - Intergenic
1088314687 11:108496157-108496179 TTATATTTTTAAAATGGGGATGG + Intronic
1088398512 11:109396178-109396200 TTTTATTTTTAAAATGTATTTGG - Intergenic
1090310432 11:125731951-125731973 TTTTATCATTAAAGTGCAGATGG - Intergenic
1090526307 11:127541550-127541572 TTTTATCATTAAAATTATAAAGG - Intergenic
1091053627 11:132397850-132397872 TTTGTTTTTTAAAATGTTGATGG - Intergenic
1091056659 11:132425475-132425497 TTTTATGTATAAAATGTGGAAGG + Intronic
1091147658 11:133293861-133293883 TTTTTTCTTTAGGATGTTAAGGG - Intronic
1091152197 11:133339291-133339313 TTTCATCTTTAAATTGGAGAAGG - Intronic
1091961483 12:4698805-4698827 TTTTCTCCTTTAAATATTGAAGG + Intronic
1092313655 12:7386592-7386614 TTTTTTTTTTGATATGTTGACGG - Intronic
1093538927 12:20257108-20257130 TTTTATCTTAGAAATGTTTTTGG + Intergenic
1093566122 12:20606094-20606116 TTTATTCTTTAAAATGATTAAGG - Intronic
1093827023 12:23705453-23705475 CTTTATCTTTCTAATGTTGAGGG + Intronic
1093879330 12:24385651-24385673 TTTTATCTTTAAGATTTATATGG + Intergenic
1094076635 12:26483480-26483502 TTTTATCTTGAACATTTTCATGG + Intronic
1094547028 12:31414268-31414290 TTTTATCTTTTAAATATTTTAGG - Intronic
1095421313 12:42027400-42027422 TTTTATTTTCATAATGGTGAGGG - Intergenic
1095591490 12:43908497-43908519 TATTAACTTTAAAATGTAAATGG + Intronic
1095605084 12:44057667-44057689 TTTGTTATTTAAATTGTTGAGGG + Intronic
1095644289 12:44524513-44524535 CTTTATTTTTAAAATCTTCAAGG - Intronic
1096396855 12:51272701-51272723 TTTTCTCTTTAAAATGTAACTGG + Intergenic
1096970102 12:55658710-55658732 TTTCTTTTTTTAAATGTTGAGGG - Intergenic
1097113865 12:56682705-56682727 TTTTTTCTTTTAAATGGAGACGG - Intronic
1097546526 12:61009463-61009485 CTTTATGTTTAAAATGCTTAGGG + Intergenic
1097562828 12:61229657-61229679 TTTTATTTTTATAATTTTGTGGG + Intergenic
1097734362 12:63165821-63165843 GTTGATCTTTCTAATGTTGACGG + Intergenic
1097978237 12:65710474-65710496 TTTTCTGACTAAAATGTTGAAGG + Intergenic
1098070105 12:66664828-66664850 TTTTCTCTTTTTAATGTTAATGG + Intronic
1098538895 12:71629078-71629100 TTTTTTTTTTAACATTTTGAAGG + Intronic
1098620199 12:72587082-72587104 TTTTATCCATGACATGTTGAGGG + Intronic
1098684640 12:73403186-73403208 TTTTATATTTAAAAAATGGAGGG + Intergenic
1098685765 12:73418166-73418188 GTTTTTGTTTAAAATGTGGATGG - Intergenic
1098867023 12:75774737-75774759 TTTTATCTTTATTATCTTAAAGG + Intergenic
1099209939 12:79771940-79771962 TTTCATTTTTAAAAAGCTGAAGG - Intergenic
1099595766 12:84663260-84663282 TTTTTTTTTTAACAAGTTGAAGG - Intergenic
1099633655 12:85183126-85183148 TTTTATTCTACAAATGTTGAAGG - Intronic
1099796287 12:87404444-87404466 TTTTATCTTGAAAATATTTGAGG + Intergenic
1099960690 12:89394350-89394372 TTTTGTATTTAAAATATTGCAGG + Intergenic
1099980545 12:89596740-89596762 TTTCAAATTTAAAATTTTGAGGG + Intronic
1100052461 12:90465394-90465416 TTGTATCTTTACTCTGTTGATGG + Intergenic
1100228466 12:92582973-92582995 TTTTTTCTTTTAAATTCTGAGGG + Intergenic
1100342446 12:93692568-93692590 TGATATGTTCAAAATGTTGATGG + Intronic
1100459254 12:94782644-94782666 TTTTATTTTGAAAATGTGAAAGG + Intergenic
1100569508 12:95834077-95834099 TTTTCTCCTTAAAATGGTCAAGG + Intergenic
1100668139 12:96778001-96778023 TTTTATTTTTAAAATTTGTACGG - Intronic
1101152108 12:101892562-101892584 TTTCATCTTTAAAATGGTAATGG + Intronic
1102101930 12:110285925-110285947 TTTTTTTTTTTAAATGTAGATGG + Intronic
1102725768 12:115063276-115063298 TTTTATTTGTAAAATGGGGATGG + Intergenic
1102806344 12:115784044-115784066 TTCTAACTTTAAAATGTACAGGG + Intergenic
1102886660 12:116527099-116527121 TTTTATTTTTATAATTTTGTAGG - Intergenic
1103399593 12:120634234-120634256 TTTTATTTTAAAAATCTTGGAGG + Intergenic
1103897618 12:124283930-124283952 TTTTTTTTTTTAAATGTTCAAGG - Intronic
1103925125 12:124419557-124419579 CTTCATGTTTAAAATGTTAATGG - Intronic
1104410813 12:128556188-128556210 TTTGATGTTTGAAATGGTGAAGG + Intronic
1105461771 13:20597193-20597215 TTTTATTTTTAAAATCTTACTGG + Intronic
1105983497 13:25543048-25543070 CTTTTTCTATAAAATGTTGCAGG - Intronic
1106006092 13:25771482-25771504 CTTTTTCTTTAAAATGTCTAGGG + Intronic
1106704895 13:32269685-32269707 TTTTTTTTTTAAAATGGAGATGG - Intronic
1107063492 13:36187209-36187231 TTTTCTTTTTAAAATTTTAATGG - Intronic
1107092814 13:36500662-36500684 TTTTCTATTCAACATGTTGATGG + Intergenic
1107211512 13:37861996-37862018 TTTAATCTTGAAAATGAAGAAGG - Intronic
1107228092 13:38075528-38075550 TTGTATCTTTGAAAAGTTTATGG - Intergenic
1107345471 13:39455438-39455460 TTTTATGCTAAAAATATTGATGG - Intronic
1107413340 13:40177799-40177821 GCTTCTCTCTAAAATGTTGAGGG - Intergenic
1108040036 13:46331334-46331356 TTTTTACTTTACAATATTGATGG - Intergenic
1108250436 13:48561863-48561885 TTTAATTTTTAAAATATTTAAGG + Intergenic
1108416752 13:50205317-50205339 TTTTATTATTAAAATGCTTATGG - Intronic
1108808060 13:54184591-54184613 TTTGATGTTGATAATGTTGATGG - Intergenic
1108932603 13:55846460-55846482 TTTTTTCTCTAAAATGTAGATGG + Intergenic
1109149507 13:58827502-58827524 TTATCTCTTTAGAATTTTGATGG - Intergenic
1109274406 13:60287419-60287441 ATTTTTATTTGAAATGTTGAGGG + Intergenic
1109374226 13:61468867-61468889 TTCTATTTTTGACATGTTGAAGG + Intergenic
1109563546 13:64080522-64080544 TTTTATCTTTTAAATTTTCCAGG + Intergenic
1109571453 13:64196326-64196348 TTTTATCTTTAAAAAGCTACTGG - Intergenic
1109653279 13:65355647-65355669 TAATACATTTAAAATGTTGAAGG + Intergenic
1109677057 13:65690852-65690874 TTTTAAATTTCAAATGTAGAAGG - Intergenic
1109777592 13:67062295-67062317 TTTTTCCTGTAATATGTTGAGGG - Intronic
1109828869 13:67759516-67759538 TTTTATTTTTAAAATTTATAAGG - Intergenic
1109878888 13:68444718-68444740 TTTGATTTTTAAAAGGTAGATGG - Intergenic
1109887361 13:68559324-68559346 TTTTAGCATTAAAATGAGGAAGG - Intergenic
1109895356 13:68680279-68680301 TCTTATTTTTAAAATAATGAAGG + Intergenic
1110097214 13:71542769-71542791 TTTTCTCTATAACATGTGGATGG - Intronic
1110213147 13:72996256-72996278 TTTTTTTTTTAATATATTGAAGG - Intronic
1110248997 13:73360279-73360301 TTACATTTTTAAATTGTTGAGGG - Intergenic
1110552810 13:76827544-76827566 TTCCATCTCTAAAATGGTGAAGG + Intergenic
1110577107 13:77070175-77070197 TAAAATCTTTAAAATGATGAAGG + Intronic
1110659330 13:78040797-78040819 TATTATTTTTAAAAGCTTGATGG + Intergenic
1110965018 13:81683739-81683761 TTTCATCCTTAAAATGTTCCAGG - Intergenic
1111009833 13:82297359-82297381 TTTTATCTATGAAATGTTTGTGG + Intergenic
1111074495 13:83215722-83215744 AGTTAACTTTAAAATGTTTAAGG + Intergenic
1111090771 13:83443839-83443861 TATTCTGTTTAAAATATTGATGG + Intergenic
1111091905 13:83457907-83457929 TTATTTCTTTAAAATTTGGATGG - Intergenic
1111123414 13:83881793-83881815 TGTTATTTTTAAAGTGTTGTGGG - Exonic
1111151346 13:84257154-84257176 TGTTATGTTAAAAATGTTTAAGG - Intergenic
1111329397 13:86744130-86744152 TTTTATATTTCACATGCTGAAGG - Intergenic
1111426767 13:88094966-88094988 TTATTACTTTAAAATGTTCATGG + Intergenic
1111463988 13:88583638-88583660 TTTTATTTTTAAATTTTTCAGGG + Intergenic
1111546946 13:89750767-89750789 TTTTATCTTTTACATCTTCATGG + Intergenic
1111858638 13:93672520-93672542 TTTTCTCTTAAAAATGTATAAGG + Intronic
1112027589 13:95425942-95425964 TTTTAACTTTATACTGTTAAAGG + Intergenic
1112059346 13:95722015-95722037 TTTTATTTTTAAAAGATTGATGG + Intronic
1112292381 13:98156068-98156090 TTTTATTTTTAAAATATGGGAGG - Intronic
1112405539 13:99116847-99116869 TTTTTTAATTAGAATGTTGAAGG - Intergenic
1112513117 13:100027762-100027784 TTTTATTTGTAAAGTGCTGAAGG + Intergenic
1112547431 13:100384835-100384857 TATTCTCTTTAAAATGCTCAGGG - Intronic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1112865294 13:103888758-103888780 TTTTATTTATAAAGTGTTGTTGG + Intergenic
1113284701 13:108833883-108833905 TTTCTTTTTTAAAATGTTTATGG + Intronic
1113409792 13:110074793-110074815 TTTTTACTTAAAAATATTGAGGG + Intergenic
1113587587 13:111475890-111475912 TTTAAACTTCAAAATATTGATGG - Intergenic
1113730826 13:112640247-112640269 TTTTATTTTGATAATGTGGATGG - Intergenic
1114128651 14:19762259-19762281 TTTAATCATCAAAATGTTAATGG - Intronic
1114185495 14:20398451-20398473 ATTTATCTTTCAATTGTAGATGG - Intronic
1114299086 14:21358162-21358184 TTTTTTCTTGAAAATGTTTAAGG - Intronic
1114440476 14:22742657-22742679 TTTTTTCTTTTAAATGGAGACGG - Intergenic
1114539897 14:23447195-23447217 TCTTATCTGTAAAATGTGGATGG + Intergenic
1114978763 14:28135322-28135344 TTTTAAAATTAAAATGTTGTGGG - Intergenic
1115171330 14:30510925-30510947 TTTATTTTTTAAAATGTTTATGG - Intergenic
1115232811 14:31179795-31179817 TTATTCCATTAAAATGTTGAGGG - Intronic
1115505547 14:34090479-34090501 TTTCATTTGTAAAGTGTTGAGGG + Intronic
1115735905 14:36329456-36329478 TTCTATCTGTAAATTGTTTAGGG - Intergenic
1115890449 14:38021553-38021575 TCTTGTCTCTAAAATGTGGATGG + Intronic
1116162149 14:41281639-41281661 TTTTGTCTTAAAAATGTGAATGG - Intergenic
1116328822 14:43569959-43569981 TTTTATATTTAAAATTTTAATGG + Intergenic
1116333102 14:43620258-43620280 TTCTATCTTTAACATGGTAATGG - Intergenic
1116358417 14:43961301-43961323 TTAAAACTTTAAAGTGTTGAGGG - Intergenic
1116535316 14:46020271-46020293 TTTTATTTTTAAAATGTTTTGGG + Intergenic
1116989083 14:51254158-51254180 TTTTATTTTTATAATATTCATGG + Intronic
1117296870 14:54388438-54388460 TTTAATCTTAAATATGTTAATGG - Intergenic
1117388994 14:55244978-55245000 TTTTATTTTTTAAATCTTGAAGG + Intergenic
1117492621 14:56266302-56266324 TTTTGACTTTAAAGTGTTGTGGG - Intronic
1117760589 14:59023375-59023397 ATTTAACATTAAAATGATGAGGG + Intergenic
1117871365 14:60204537-60204559 TTTCCTCTTTAAAGTATTGAAGG + Intergenic
1118016579 14:61667194-61667216 CTTTCTCTTTTAAATGTTCAGGG - Intergenic
1118145187 14:63127008-63127030 TTCTATCTTTATAATGTTTGAGG + Intergenic
1118174391 14:63423422-63423444 GTTTATGTTTTAAATGTTGTTGG + Intronic
1118508778 14:66446562-66446584 TAATATTTTTTAAATGTTGAAGG + Intergenic
1118602242 14:67479103-67479125 TTTCATCTTAAAAATGCTTATGG + Intronic
1118825753 14:69379242-69379264 TTTTAGCTTTAAAATTTGGTTGG + Intergenic
1119380067 14:74222881-74222903 ATTTATCTTTAATATTTTAATGG - Intergenic
1119436554 14:74601242-74601264 TTTCTTCTTTAAAATTATGAGGG + Intronic
1119493251 14:75055939-75055961 TTTTATCTTTGTAAGGTTGGTGG - Intronic
1119574389 14:75705578-75705600 TTTAATCTATAAAATGTGGATGG + Intronic
1120115985 14:80617973-80617995 TTTCATCTATAAAATGGGGATGG + Intronic
1120137103 14:80883186-80883208 TTTTTTATTTAAAATTTTGCGGG - Intronic
1120572239 14:86134783-86134805 TTTTACCTTTACAATGTGGTGGG - Intergenic
1120721852 14:87897935-87897957 TTTTCTCTTTAAAATATCTATGG - Intronic
1120788351 14:88557061-88557083 TTTTATGTCTAATATTTTGAAGG - Intergenic
1121231340 14:92361010-92361032 TTTAATCTTTAAAAAGGAGAGGG + Intronic
1121804285 14:96802136-96802158 ATTTATCTTTCATATGTTGCTGG + Intronic
1121916198 14:97838649-97838671 TTTCATTTGTAAAATGATGAAGG + Intergenic
1121953170 14:98189896-98189918 TTTTTTCTGCAAAATGTTGTAGG + Intergenic
1122168284 14:99848656-99848678 TTCTGTCTTTAAAAGTTTGAAGG + Intronic
1123181887 14:106479163-106479185 TTCTATCTTAATAATGGTGATGG - Intergenic
1202945018 14_KI270726v1_random:17566-17588 TTCTATCTTAATAATGGTGATGG + Intergenic
1123793224 15:23745196-23745218 TTTTATTTTTAAAATTTTTGAGG + Intergenic
1123956195 15:25337059-25337081 TTTTTTCTCTAAAATTTTAAGGG + Intronic
1124940843 15:34216350-34216372 TTATACAGTTAAAATGTTGATGG - Intergenic
1125271868 15:37948383-37948405 TTTTATGTTAAACATTTTGATGG - Intronic
1125765577 15:42133299-42133321 TAATTTTTTTAAAATGTTGAGGG + Intergenic
1126241023 15:46443571-46443593 TTTTCTGTTTAAATTGTTCATGG + Intergenic
1126511366 15:49478725-49478747 CTTTATATTTAAAGTTTTGAAGG - Intronic
1126601143 15:50428715-50428737 TTTTATCTGCAAAATTATGAAGG - Intronic
1126738306 15:51752942-51752964 TTTTGTCTTTAATTTGCTGAAGG + Intronic
1126876526 15:53047817-53047839 TTTTGTTTTTAAAATTTTCAAGG + Intergenic
1126909725 15:53404907-53404929 TCTTATCTGTAAAATGCAGATGG + Intergenic
1126975065 15:54168225-54168247 TGTTGTCTTTAAAAAGTTGCTGG + Intronic
1127024676 15:54790910-54790932 TTTGATCCTTAACATGATGATGG - Intergenic
1127345657 15:58095220-58095242 TCTTATCTATAAAATGGTAATGG - Intronic
1127447143 15:59075236-59075258 TTTTATTTTTAATAAATTGAAGG - Intronic
1127838980 15:62813522-62813544 TTTTATCTTTAAAATATATTTGG - Intronic
1127886975 15:63210039-63210061 TTTTATCTTTAAAAGATAAATGG - Intronic
1127957781 15:63868121-63868143 TTTTATGTTTAATTTTTTGAGGG + Intergenic
1128006696 15:64249114-64249136 TATTATTTTTAAAATTTAGATGG - Intronic
1128099105 15:64983674-64983696 TTTCTTCTTTAAAATATTGTTGG - Intronic
1128287175 15:66446849-66446871 TTATATCTTGACAATGGTGATGG + Intronic
1128629880 15:69253874-69253896 TTTTCTTTCTAAAATGTTGTAGG - Intronic
1128837311 15:70820342-70820364 TTTCATTTTTCAAATATTGATGG - Intergenic
1129427511 15:75474675-75474697 TTTTACCTTTGAAATGTTTTTGG + Intronic
1129792607 15:78351398-78351420 TTTTATCTGGAAAATGCAGAAGG - Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130316462 15:82800876-82800898 TTTTAGCATTAAAATGAAGAAGG - Intronic
1130754846 15:86752392-86752414 CTTTGTCTTTAAAATCTGGATGG - Intronic
1131188755 15:90295895-90295917 TTTTATTTGTAAAAAGTTAAAGG + Intronic
1131327929 15:91466912-91466934 TTATATTTTAAAAATTTTGATGG + Intergenic
1131949986 15:97671706-97671728 TTTAATTTTTAAAATTTTTATGG + Intergenic
1132334792 15:101039858-101039880 TTTTCTGTTAAATATGTTGATGG + Intronic
1133189149 16:4120566-4120588 TTTTCTCTTTCAACTGATGAGGG + Intergenic
1134324021 16:13190336-13190358 TTTAGTCTTTAGAATGATGATGG + Intronic
1134351662 16:13443427-13443449 TGTTATCTATAAAATGGGGATGG + Intergenic
1134354503 16:13468485-13468507 TATTATATTTAAAAAGTTGGAGG - Intergenic
1134784356 16:16927606-16927628 TTTCATCAGTAAAATGTGGATGG + Intergenic
1135177667 16:20245193-20245215 TTTTATCATTAAAATGAGGGTGG - Intergenic
1137316980 16:47335967-47335989 ATTTATCTGTAAACTGTTGAGGG - Intronic
1137571666 16:49570332-49570354 TCTTATCTGTAAAATGGGGATGG - Intronic
1137864652 16:51880679-51880701 TGTTCTCTGTAAAATGTAGATGG - Intergenic
1138218731 16:55230415-55230437 TTTTATATTTAATGTGTTGCTGG - Intergenic
1138323620 16:56141721-56141743 TTATATTTTTAAAAGGTTTAAGG - Intergenic
1138914076 16:61441396-61441418 ATCTATGTTTAAAATGTTAAGGG + Intergenic
1139005073 16:62559792-62559814 TTTAATTTTAAAAATCTTGAAGG - Intergenic
1139328779 16:66171687-66171709 TTTTTTTTTTTAAGTGTTGAAGG + Intergenic
1139384142 16:66553291-66553313 TTTTTTCTTTCAAATCTTGTGGG - Intronic
1139787197 16:69403395-69403417 TTTTATTTTTAAAATTTTTTTGG - Intronic
1140113172 16:72020859-72020881 TTTTATTTTTAAAATTTTCATGG - Intronic
1140465441 16:75177545-75177567 TAATAGCTATAAAATGTTGAGGG + Intergenic
1140574859 16:76155944-76155966 TTTTCTCCTTAAAATTTTGGGGG + Intergenic
1140620523 16:76725546-76725568 TTTCATATTTAAAATGTTCAAGG + Intergenic
1141088762 16:81115549-81115571 TTTTCTCTTTTAAGTATTGAAGG - Intergenic
1141910531 16:87055585-87055607 TTTTCTTCTTAGAATGTTGAAGG - Intergenic
1142317888 16:89360483-89360505 TTTAATCTTTTAAATTTTGTAGG - Intronic
1143077669 17:4358458-4358480 TTTTTTTTTTAAACTGTTGAGGG + Intronic
1143600302 17:7941184-7941206 TTTTATGTATAAAATGTGTAAGG + Intronic
1143687480 17:8529711-8529733 AGTTATATTTAAAATGTTAAAGG - Intronic
1143865891 17:9923205-9923227 TTTTGTTTTTAAAATAGTGAAGG - Intronic
1144417338 17:15062238-15062260 TTTGATTTTTAATATTTTGATGG - Intergenic
1144467840 17:15510754-15510776 TTTTATTTTTAAAAAGATAATGG + Intronic
1144604762 17:16654986-16655008 TATTACATTTAAAATGTTTAAGG + Intergenic
1144992662 17:19244481-19244503 TTGTAACTTGAAAAGGTTGAGGG + Intronic
1146581512 17:34042328-34042350 GTTTATCATTCACATGTTGATGG - Intronic
1146711295 17:35043970-35043992 CTTTATCTTTAGAAGGTTGGGGG - Intronic
1147019023 17:37516075-37516097 TTTTGCCTTTAAAATTTTTATGG - Exonic
1147678794 17:42225903-42225925 TTTTATCTTTAAAAAGCAGGGGG + Intronic
1149021893 17:51977417-51977439 TTTTTTCTTTAATATTTTAATGG - Intronic
1149029899 17:52070750-52070772 TTCTTTCTTTAAAGTGTTCAAGG - Intronic
1149180969 17:53935621-53935643 TATTATAATTAAAATGTTAAAGG + Intergenic
1149201712 17:54194242-54194264 TACTATCATTAAAATGCTGAAGG - Intergenic
1149334951 17:55626154-55626176 TTTCATATTTGAAAGGTTGATGG - Intergenic
1149920213 17:60650950-60650972 TTTTATTTTTAAAGAGATGAGGG - Intronic
1149930255 17:60745325-60745347 ATTTATTTTTAAAATGTAAATGG + Intronic
1150403387 17:64877913-64877935 TTTTTTTTTTAAAATGGTGCTGG + Intronic
1150769472 17:68029116-68029138 TTTTCTTTTTAAAATGGAGACGG - Intergenic
1151736271 17:75942463-75942485 TTTTTATTTTAAAATATTGATGG - Exonic
1151900772 17:77012211-77012233 TTGTATCTTTAAACTTTTGATGG - Intergenic
1151931140 17:77232247-77232269 TTTTTTAATTAAAATTTTGATGG + Intergenic
1152381411 17:79944272-79944294 TTTTTTTTTTAAAAGGCTGATGG + Intronic
1153186083 18:2487857-2487879 TTTTGTCTTCAAACTCTTGAAGG - Intergenic
1153196215 18:2599910-2599932 TTTTATCTCTAATATGTAGCTGG - Intronic
1153519972 18:5942417-5942439 TTTTCTCTTTAAAATATAAAAGG + Intergenic
1153545113 18:6197008-6197030 TTTTATCTGTAAGCTGTTCAGGG - Intronic
1153670639 18:7408780-7408802 TTCTATTTTTAATATTTTGAGGG + Intergenic
1153899843 18:9608229-9608251 TTCTACCTTTAAAATGTTGATGG - Intronic
1154222473 18:12468692-12468714 TTTTATCTAGAAAATGTGGTTGG + Intronic
1154238853 18:12633061-12633083 TCTTATCTATAAAATGTTAATGG - Intronic
1154275480 18:12956015-12956037 TTTTAACTTTAAACTCTTAAGGG + Intronic
1154288984 18:13088733-13088755 TTTTGTTTTTAATTTGTTGAGGG + Intronic
1154488089 18:14894475-14894497 CTTTATGTTTAAAGTTTTGAAGG + Intergenic
1155266189 18:24096231-24096253 TTTTTTCTTTAACAAATTGAAGG - Intronic
1155703133 18:28774274-28774296 TTTTATGTTTAAAATCTTATAGG + Intergenic
1155767832 18:29657777-29657799 TTTTATCATTGATATTTTGATGG - Intergenic
1155862149 18:30915509-30915531 TTTAATCATTAACCTGTTGAAGG - Intergenic
1155929808 18:31694878-31694900 ATTTGTCTTTAAACTGTTAATGG + Intergenic
1156092190 18:33485672-33485694 GTTTATCTCTAAAGTGTTTATGG - Intergenic
1156092467 18:33488045-33488067 TTTTAACTGTAAAATATTGTGGG + Intergenic
1156210928 18:34941669-34941691 TTTTATCTTGAGCATGGTGATGG + Intergenic
1156381944 18:36570456-36570478 TTTTATCTTTAAATGTTTGGTGG - Intronic
1156770943 18:40724174-40724196 TTTTATTTTCTAAATGTTAAAGG - Intergenic
1156854092 18:41762117-41762139 TTTTGTGTTTAACATCTTGAGGG - Intergenic
1156914144 18:42445766-42445788 TTTTATTTTTAAAAAATTGTAGG - Intergenic
1156956635 18:42973873-42973895 TTTTATTTTTAGAAAATTGAGGG + Intronic
1157165382 18:45354036-45354058 CTTCATCTGTAAAATATTGAAGG + Intronic
1157380256 18:47208073-47208095 TCTTATCTATAAAATGTGGATGG - Intergenic
1157577993 18:48756386-48756408 TTTTATCTGTGAAAAATTGAGGG - Intronic
1157858586 18:51122108-51122130 ATGTATCCTTAACATGTTGAGGG - Intergenic
1158479850 18:57812291-57812313 TTTTTTCCTTAGAATTTTGAAGG + Intergenic
1159030948 18:63231187-63231209 TTTTATTTTTAAATTGTGAATGG - Intronic
1159185778 18:64971773-64971795 TTATTTCTTTAAAATCTTGGAGG + Intergenic
1159318375 18:66811544-66811566 TTTTTTCTGTAATTTGTTGAAGG + Intergenic
1159533782 18:69689051-69689073 TTTTATTTTTAATTTTTTGATGG - Intronic
1159575903 18:70177037-70177059 TTGTATTTTTAAAATGTAGGTGG - Intronic
1159617970 18:70603591-70603613 TTTTATATTTAAAATAATTAAGG - Intergenic
1159937530 18:74381138-74381160 TTTTATTTTTCACATGTTGATGG - Intergenic
1162434654 19:10650347-10650369 TTAAAGCTTTAAATTGTTGAAGG - Intergenic
1163813537 19:19449494-19449516 TTTTATTTTTAAAACGTTGATGG + Intronic
1164061706 19:21681076-21681098 ATTTTTCTTTTAATTGTTGAAGG - Intergenic
1164370025 19:27636100-27636122 TTTTCTCATTAGAATGCTGAAGG + Intergenic
1164407506 19:27965164-27965186 TCTTATCTGTAAAATGGTGTTGG + Intergenic
1164505454 19:28856989-28857011 TATTATCTTTATAAGGTGGACGG - Intergenic
1164823356 19:31266728-31266750 ATTTATCTCTAAAATGGTAATGG + Intergenic
1165670372 19:37673365-37673387 TTTTATCTTAATTATGGTGATGG + Intronic
1166883905 19:45947006-45947028 TTTTATTTTGAAAATGTTTAAGG - Intronic
1167863714 19:52306922-52306944 CTTTTTCTTCAAAATGATGAGGG + Intronic
1168685040 19:58344070-58344092 TTTTATCTTTAAAATATGGCTGG + Intergenic
925341340 2:3139788-3139810 TATCATCTTAAAAGTGTTGAGGG - Intergenic
926020289 2:9488851-9488873 TTTTAACTTGTAAATTTTGAGGG - Exonic
926164576 2:10512492-10512514 TTTTTTCTTAAAAATGTGAAAGG - Intergenic
926370425 2:12173145-12173167 ATTTATTTTTCACATGTTGAGGG + Intergenic
926506856 2:13726823-13726845 TCTTATCTTAGAAATGGTGAAGG + Intergenic
926752926 2:16212896-16212918 TTTTTCCATTCAAATGTTGAAGG + Intergenic
926943759 2:18166277-18166299 TTGTTTCTTCATAATGTTGATGG + Intronic
927060539 2:19415137-19415159 TTTTAGCTTTAAAATTTTTCTGG + Intergenic
927181648 2:20450726-20450748 TTTTGTCTTTAAAATGAAAAAGG - Intergenic
927352296 2:22130757-22130779 TTCTATTTTTAGAATTTTGAAGG - Intergenic
927725282 2:25417446-25417468 TTTAATTTTTAAAATTTTTATGG - Intronic
928409791 2:31046116-31046138 TTTTATATGTAAAATGTGGATGG - Intronic
928464548 2:31511114-31511136 TTTATTCTTTCACATGTTGACGG - Intergenic
928472504 2:31588469-31588491 TGATATATTTAAAATGCTGAAGG + Intergenic
928560320 2:32476886-32476908 TTTACTTTTTAAAATTTTGAGGG + Intronic
928695433 2:33844538-33844560 TTTTATCTTTAGAATTTCTAAGG + Intergenic
928826861 2:35433196-35433218 TATTCTCTTTACAATTTTGAGGG + Intergenic
928938024 2:36700869-36700891 TTTCATCTGTATAATGGTGATGG - Intronic
929019214 2:37533892-37533914 TGTTAACTTTAAAATGTGTAAGG - Intergenic
929102418 2:38328993-38329015 TTTTATTTTTTTAATGTTCAAGG - Intronic
929630559 2:43456761-43456783 TCTCATCTTTAAAGTGCTGAGGG - Intronic
929666269 2:43836487-43836509 TTTTAACCTTAAAATGTAGATGG + Intronic
929834502 2:45382684-45382706 TTTCTTCTTTAAAATATTTAAGG + Intergenic
929839542 2:45443437-45443459 TTTTAATTTTAAAATTTTGGTGG + Intronic
930043767 2:47150656-47150678 TTTTTTTTTTAAAGAGTTGAGGG + Intronic
930170133 2:48243337-48243359 TTTTGCCTTTAGAATGTTGAAGG - Intergenic
930173255 2:48273640-48273662 TTTTGACTTTAAGATGTTAAGGG - Intergenic
930271880 2:49266932-49266954 TGTTTTATTTAAAATGTTGTAGG + Intergenic
930357223 2:50336405-50336427 TTTGATTTTTAAAATCTTCAAGG + Intronic
930416328 2:51094769-51094791 TTTGAATTTTAAAATGTTCAAGG - Intergenic
930477426 2:51901095-51901117 TATTATCTTGAAGATATTGATGG + Intergenic
930507524 2:52303159-52303181 TTTTACCTTTCACCTGTTGATGG + Intergenic
931015484 2:57975119-57975141 TTTTACTTTAAAAATGTTAAGGG - Intronic
931291154 2:60874949-60874971 TTTTATCATAAAAATGTTTGGGG - Intergenic
931296385 2:60930052-60930074 TTATATCTTTAATTTATTGAAGG + Exonic
931568823 2:63646703-63646725 TGATATATTTAAAATGCTGAAGG - Intronic
931652398 2:64480299-64480321 TGTTTTCTTGAAAATGATGACGG - Intergenic
931992861 2:67808842-67808864 TTTTTACTTTAAATTATTGAAGG - Intergenic
932155442 2:69412683-69412705 TTTTATTTTTAAAATTTTTTTGG - Intronic
932195001 2:69775746-69775768 TTTTAGCCTTAAAATGAGGAAGG + Intronic
932259067 2:70311782-70311804 TTTTATATTTAAAATACAGATGG - Intergenic
932627120 2:73306502-73306524 TTTTATGCTTAAATTGTTGAGGG - Intergenic
932716982 2:74108116-74108138 TGGTATCTTTAAAATATTGTGGG + Exonic
933097237 2:78201835-78201857 TATTGTTTTTAAAATGTAGAAGG + Intergenic
933117114 2:78487910-78487932 TTCTTGTTTTAAAATGTTGAAGG + Intergenic
933383438 2:81580888-81580910 TTTTATTTTTAAGTTGTTCATGG + Intergenic
933915229 2:86984882-86984904 TTTTCTTTTTAAATTGTTTAGGG + Intronic
934007764 2:87785019-87785041 TTTTCTTTTTAAATTGTTTAGGG - Intronic
934021269 2:87955811-87955833 TTTTATATTAAAAATTTTGTTGG + Intergenic
934479734 2:94624748-94624770 TTTTATCTTTAATATCTAAATGG - Intergenic
935123984 2:100206649-100206671 TTTTATTTATATAATTTTGATGG - Intergenic
935189936 2:100768931-100768953 TTTTAATTTGAAACTGTTGATGG - Intergenic
935281041 2:101518126-101518148 TTTTTTTTTTTAAATGATGAAGG + Intergenic
935352486 2:102164757-102164779 ATTTATCTTTAAAAGGAAGAAGG - Exonic
935452629 2:103227678-103227700 TTTTAATTTTAAAATGGTGTTGG + Intergenic
935722715 2:105993904-105993926 TTTTAGCTTCACAATATTGAGGG - Intergenic
936130455 2:109835125-109835147 TTTTCTTTTTAAATTGTTTAGGG + Intronic
936214242 2:110536360-110536382 TTTTCTTTTTAAATTGTTTAGGG - Intronic
936250556 2:110865208-110865230 TTTTCACTTGCAAATGTTGAAGG + Intronic
936423379 2:112390919-112390941 TTTTCTTTTTAAATTGTTTAGGG - Intronic
937590692 2:123610008-123610030 TTTTATTTTTAAAAGGAAGAAGG - Intergenic
937795611 2:126015258-126015280 TTTTATTTTTTAAATTTTAATGG - Intergenic
938388616 2:130886190-130886212 TTTTATTCTTACTATGTTGATGG + Intronic
938880640 2:135582804-135582826 TTTTTTCTTTACAATGTTACAGG - Intronic
939580310 2:143938674-143938696 TTTTATTTTTGAAATGCTGTTGG - Exonic
939601349 2:144194905-144194927 TTTACTTTTTAAAATGTGGAGGG - Intronic
940073715 2:149717977-149717999 TTTTATCTCTAAAAAATTGCTGG + Intergenic
940278401 2:151963416-151963438 TTTCATCTTTGATATGATGAGGG + Intronic
940438409 2:153683457-153683479 TTTTATCTTGAGAAAGTTCAAGG + Intergenic
940863561 2:158794783-158794805 TTTTCTTTTTAAAATATTGATGG - Intergenic
941418053 2:165246396-165246418 TTTTATCTTGAAACTCTTCATGG + Intronic
941428230 2:165377762-165377784 TTTTATCCTTATAATATAGATGG - Intronic
941522740 2:166568170-166568192 TAATATCTTCAAAGTGTTGAGGG + Intergenic
941634570 2:167922810-167922832 TTTTATATTTAAATCTTTGACGG - Intergenic
941872402 2:170399605-170399627 ATTTAACTTTAAAATGTTCTAGG + Intronic
941889310 2:170561540-170561562 TTTTATGTGCAAAATGTTGCCGG - Intronic
942030921 2:171958116-171958138 TTTTATTATTTAAATTTTGAGGG + Intronic
942813912 2:180029049-180029071 TTTTATCTGAAGAATGTTGTTGG + Intergenic
943007673 2:182405595-182405617 TTTTATTCTTAAAATTTTTAGGG - Intronic
943334132 2:186593063-186593085 TTTTTTCTTTTAAAAGTTTATGG - Intronic
943444040 2:187960855-187960877 TTTTAATTTTAAAATGTGAAGGG - Intergenic
944322401 2:198363209-198363231 TTTTTTTTTTAAGATCTTGAGGG - Intronic
944633062 2:201647194-201647216 TCTCATCTGTAAAATGATGATGG - Intronic
944717817 2:202392681-202392703 TTCTAGCTTTAAAAAGTTAAGGG + Intronic
944822879 2:203449102-203449124 TTGTTTCTTTGAAATGTAGAAGG - Intronic
944824120 2:203463658-203463680 CTTTATTTTTAAAATGGAGAGGG + Intronic
944861984 2:203823863-203823885 TTTTATCTCTCAAACGTTGGGGG - Intergenic
944900136 2:204205552-204205574 GTATATTTTTAAAATGTGGAGGG + Intergenic
944932851 2:204538044-204538066 TTTTATTTCTTAAATGATGACGG + Intergenic
944965271 2:204925272-204925294 TTTTATCTTTCCTATGATGATGG + Intronic
945103411 2:206285031-206285053 TTTTTTCTTTTATCTGTTGATGG + Intronic
945282543 2:208049332-208049354 TTTTTTTTCTCAAATGTTGATGG + Intergenic
945695371 2:213095601-213095623 TTTAATCTTTAAAATGTTTATGG - Intronic
946697108 2:222370951-222370973 TAATATCTTCAAAATGTTGAAGG + Intergenic
946890879 2:224275073-224275095 TTTTGGATTTAAAATATTGATGG - Intergenic
946949092 2:224852758-224852780 TTTTATCTTAGAAGTGTTTAAGG - Intronic
947127431 2:226884651-226884673 TGTTATCTTTAACACGTTTATGG - Intronic
947661650 2:231873998-231874020 TTCTATGTTTAATATTTTGAGGG - Intergenic
947673021 2:231952820-231952842 TTTAATATTGAAAATGTTAATGG + Intergenic
947803534 2:232948647-232948669 TTTTCTTTTTAAAAAGTTGGAGG + Intronic
949074936 2:242049360-242049382 TTTTATCCTTAAAAAGATGTTGG - Intergenic
1169277927 20:4246022-4246044 TTTTATCTATAAAATAGAGATGG - Intronic
1169470006 20:5877067-5877089 GGTTAATTTTAAAATGTTGAGGG + Intergenic
1169534176 20:6519357-6519379 TTAACTTTTTAAAATGTTGATGG + Intergenic
1169587536 20:7102883-7102905 TTTTATCGTTCATCTGTTGATGG - Intergenic
1169732321 20:8799649-8799671 TTTTCCCTTTAAAATATTGAAGG - Intronic
1169891675 20:10460211-10460233 AATTATCTTTAAACTGTTGTTGG - Intronic
1170048895 20:12118371-12118393 TATAATCTTTATTATGTTGAGGG - Intergenic
1170054855 20:12190680-12190702 TATTATCTTTATAATGTCCATGG + Intergenic
1170067484 20:12329263-12329285 TGTTATTTTTTATATGTTGATGG + Intergenic
1170153775 20:13251300-13251322 TTTTATTGTAAAAATGTTTATGG + Intronic
1170172158 20:13427236-13427258 TTTTATCTTTTTAATGTTCCAGG + Intronic
1170420946 20:16192731-16192753 TTTTTTCTGTGAAATCTTGATGG + Intergenic
1170993335 20:21326087-21326109 TTTTATCTGTAGAAAGTGGATGG - Intronic
1171095828 20:22331658-22331680 TTTTGTCATTAAAATGTAAATGG - Intergenic
1171147521 20:22798525-22798547 TTTCAACTTTAAAATATTAAAGG - Intergenic
1171232868 20:23501261-23501283 TTTTCTCTTTACAGAGTTGAGGG + Intergenic
1171432672 20:25093716-25093738 TATTATCTTTTTAATGTTCATGG - Intergenic
1171720480 20:28557447-28557469 TATTATTTTAAAAATGTTGAAGG + Intergenic
1171784792 20:29452892-29452914 TATTATTTTAAAAATGTTGAAGG + Intergenic
1171863591 20:30424747-30424769 TATTATTTTAAAAATGTTGAAGG - Intergenic
1172533024 20:35647000-35647022 TTTTTTAATTAAAATGTTAAAGG - Intronic
1172561672 20:35894287-35894309 TTTTATATTTGAAATGATAATGG + Intronic
1172879205 20:38187574-38187596 TTTCATCTTTAAAAAGATGGTGG - Intergenic
1173642575 20:44614321-44614343 CATGTTCTTTAAAATGTTGATGG + Intronic
1173699753 20:45058564-45058586 TTTTAGCTTTCAAATTTTGCTGG + Intronic
1174792054 20:53488151-53488173 TTTTTTCATTAAAACTTTGAGGG + Exonic
1174894682 20:54436087-54436109 ATTTATCCTTACAATGTTGAAGG + Intergenic
1174959281 20:55136750-55136772 TGTTAGCTTTAAAATGGAGATGG + Intergenic
1175300362 20:57938575-57938597 CTTTATCTGTAAAATGGGGATGG + Intergenic
1176793187 21:13344859-13344881 CTTTATATTTAAAGTTTTGAAGG - Intergenic
1177053703 21:16272580-16272602 GTTTATGTTTAAAATTTTTAGGG + Intergenic
1177186565 21:17803893-17803915 TTTTCTCTTTAAAATATTTGTGG - Intronic
1177244553 21:18506026-18506048 TTTTATTTTTAATTTCTTGAGGG + Intergenic
1177255388 21:18654918-18654940 TTTTGACATTAAAATGTGGAAGG - Intergenic
1177515475 21:22146335-22146357 TTTAATTTTTAAAATTTTCATGG + Intergenic
1177792659 21:25736678-25736700 TTTTATATATAAAGAGTTGAGGG - Intronic
1178126642 21:29523007-29523029 TTTAATCTTTATTATGTTAAGGG + Intronic
1178198511 21:30376001-30376023 TTTTTTATTTTAAATGTTTATGG + Intronic
1178372487 21:32037876-32037898 TTTTAGCATTAAAATGAGGATGG - Intronic
1178755065 21:35341042-35341064 TTTTATCCTAAAAAAGTTCATGG + Intronic
1178784430 21:35639645-35639667 TTTAATCATTCAATTGTTGAAGG + Intronic
1178809625 21:35869510-35869532 ATTTATATTTCAAATGTTTATGG + Intronic
1178984743 21:37293257-37293279 ATTAATCTTTAAAATATAGAAGG + Intergenic
1179197565 21:39179803-39179825 TTATTTCTTTAAAATATTGTGGG - Intronic
1179237696 21:39562127-39562149 CTTCATCTATAAAATGATGATGG + Intronic
1179280079 21:39926449-39926471 TTTTAAATGTAAAATGTTGCTGG - Intronic
1179445980 21:41430725-41430747 ATTCATTTTTAAAATGTTGTAGG - Intronic
1179542330 21:42091569-42091591 TTCTATCTCTAAAATGTTGCCGG - Intronic
1180607760 22:17073337-17073359 TTATATCTATAAAATGTTTTTGG - Intergenic
1180663668 22:17491743-17491765 ATGTATCTTTAAAATGATAAAGG - Intronic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1182893251 22:33836753-33836775 TTTTATCTGTAAAATAGGGATGG + Intronic
1183502012 22:38186150-38186172 TTTTATAATTAAAAAGTTGGAGG + Intronic
1183687829 22:39371890-39371912 TCTTATCTGCAAAATGCTGATGG + Intronic
1183848720 22:40564955-40564977 TTCTAACTTTATAATGCTGAGGG + Intronic
1184271066 22:43384379-43384401 TTTTTTCTTTAAGCTGTTAATGG - Intergenic
1184850727 22:47118278-47118300 TTTTATTTTGGAAATGTTTATGG - Intronic
1185305142 22:50111211-50111233 TTTTCTCTTTTAAATATTGAAGG - Intronic
1185353015 22:50347900-50347922 TTTTTACTTTAAAATGTTGTGGG + Intronic
949102973 3:168209-168231 TTTTATCTACAAAATGGTGAAGG - Intergenic
949391717 3:3569621-3569643 TTTTTTTTTTAACAAGTTGAAGG + Intergenic
949471531 3:4401626-4401648 ATTTAGCTTTAAAATGTCGTGGG - Intronic
949626328 3:5870686-5870708 TATTGTCTGTAAAATGTTCAGGG - Intergenic
949984678 3:9531316-9531338 TTGTATTTTTAATATATTGAAGG - Intronic
950226856 3:11242726-11242748 TTTTAACTATAAAGTGTTCAGGG + Intronic
950293147 3:11804054-11804076 TTTAATTTTTAAAACGTTTAAGG - Intronic
950322312 3:12068281-12068303 ATTTTTCCTTAGAATGTTGAAGG + Intronic
950647963 3:14388976-14388998 TTTTATCTTTAAAATTATTTGGG + Intergenic
951714631 3:25627296-25627318 TTTTATTTTTAAAATTGTGCAGG - Exonic
951723596 3:25729408-25729430 TTTTTTCTTTTCAATTTTGAAGG - Intronic
951743049 3:25945297-25945319 TTTTATTTTTTAAATGTTTCTGG + Intergenic
952090783 3:29882814-29882836 TGTTTTCTTTAAAATGTCTATGG + Intronic
952320616 3:32274401-32274423 TTTTATTTTAAAAAAGTTCAAGG + Intronic
952355179 3:32577420-32577442 TTATATTTTTAAAATGGTTAAGG - Intergenic
953038361 3:39233182-39233204 TTTTAGCATTAAAATGAGGAAGG - Intergenic
953402303 3:42635401-42635423 TGTTATATTTTAAATGTTAAAGG + Intronic
953494496 3:43374400-43374422 TTTTTTCTTTAAAATCATAATGG - Intronic
955181017 3:56669699-56669721 TGTTATTTTTAAAATAATGAAGG - Exonic
955633952 3:61005276-61005298 TTTTATTTTTATCACGTTGAGGG + Intronic
955991664 3:64634247-64634269 TTCAATGTTTAAAATGTAGAAGG + Intronic
956024475 3:64968085-64968107 TGATATGTTTAAAATGCTGAAGG - Intergenic
956170271 3:66428021-66428043 TTTTTTCTTTCTATTGTTGACGG + Intronic
956240254 3:67122272-67122294 TTTTATCATTAAAATTATAAAGG - Intergenic
956599483 3:71004195-71004217 TTTTGTTTTTAAAATGATCACGG + Intronic
956930250 3:74035205-74035227 GTTTTTCCTTAAAATGATGAAGG - Intergenic
957286908 3:78228787-78228809 TTTTATTTTTCAAATGTAAATGG - Intergenic
957436876 3:80188700-80188722 TTCAATCTTTAAAATGATGCTGG - Intergenic
957622102 3:82606399-82606421 TGATATATTTAAAATGCTGAAGG + Intergenic
957710846 3:83857766-83857788 TTTCATATGTAAAATGTGGATGG - Intergenic
957920367 3:86739965-86739987 ATTTATATTCAAAATGTTCAAGG - Intergenic
958268348 3:91466845-91466867 TTTTCTCTTTGAAAAATTGAAGG - Intergenic
958468911 3:94493996-94494018 TCTGATCTTTAATATGTTGGAGG - Intergenic
958608526 3:96392772-96392794 TTTTATTTTTTAAATTTTTATGG + Intergenic
959118304 3:102204397-102204419 TGATATATTTAAGATGTTGAAGG - Intronic
959346635 3:105203506-105203528 TATTATTTTTAAATTGTTGTAGG + Intergenic
959772374 3:110114421-110114443 TTGCATCCTTAAAATGCTGATGG + Intergenic
959773826 3:110133234-110133256 TTTTATTTTTAAAATTTTCTAGG + Intergenic
959874928 3:111371880-111371902 TTCTATATTTAAAGTGCTGAAGG + Intronic
959882405 3:111459759-111459781 TTTTATTTTAAAAATGTTTTTGG + Intronic
959935978 3:112028738-112028760 TTTTCTTAATAAAATGTTGAGGG - Intergenic
960090713 3:113635558-113635580 ATTTTTCTTTAAAATGTTTTGGG - Intergenic
960103314 3:113767624-113767646 TTTTATTTGTAAAAATTTGAAGG + Intronic
960174953 3:114506256-114506278 TTTCATCATCAAAATTTTGAAGG - Intronic
960193746 3:114739676-114739698 TTTTGTTATTAAAATGTTGGGGG + Intronic
960279544 3:115765949-115765971 TTTTCTCATAACAATGTTGAAGG + Intergenic
960288882 3:115860373-115860395 TTTTATCATTAGAATGCTGAAGG + Intronic
960963248 3:123087022-123087044 TTTTTTCTTTGAAATGGTTAGGG + Intronic
961025750 3:123555458-123555480 TTTTAACTTTAAAATTTTGGTGG - Intronic
961070537 3:123919956-123919978 TCTTCTCTTTAAAATGTTCAGGG + Intronic
961245317 3:125446704-125446726 TTATATGTTTTAAATGTTGCTGG - Exonic
962265309 3:133940338-133940360 ATTTATCTTTAAATCGTTGTGGG + Intronic
962450518 3:135512576-135512598 CTATCTCTTTAAAATGTTGCTGG - Intergenic
962662983 3:137623871-137623893 TTTTAGCATTAAAATGAGGAAGG - Intergenic
962699884 3:137987329-137987351 TTTGATTTTTGAAATCTTGATGG - Intergenic
962726682 3:138235222-138235244 TTTTATCAGTAAAATGTTATAGG + Intronic
962786147 3:138769871-138769893 TCTTATCTTTAAAATGGGTAGGG - Intronic
962793117 3:138829244-138829266 TTTTATTTTTAAAATAGAGATGG - Intronic
962993283 3:140599587-140599609 ATTTTTCTTCATAATGTTGAGGG + Intergenic
963428533 3:145164241-145164263 TGTTATCTTTAAAAAGCTGGAGG - Intergenic
963455273 3:145538649-145538671 TTTTACCTTTAGTATTTTGATGG - Intergenic
963543062 3:146619006-146619028 TTTTACATTTAAAATTTTGGGGG - Intergenic
963747373 3:149138435-149138457 TTTAATCTTTAGAATTTTGCGGG - Intronic
963896108 3:150686690-150686712 TTCTATCTGTAAAATTGTGAAGG - Intronic
964052590 3:152414295-152414317 ATTTATCTTTGAAAAGTTAAAGG + Intronic
964095964 3:152932005-152932027 TTTGCTATTTAAAATGTTAATGG - Intergenic
964170618 3:153766034-153766056 TTTTATTAGTAAAATGTTCATGG - Intergenic
964828057 3:160851343-160851365 TATTTTCTTTGAAAAGTTGAGGG + Intronic
964854712 3:161134219-161134241 TTTTATCATTCATCTGTTGATGG + Intronic
964963171 3:162454263-162454285 ATTTATTGCTAAAATGTTGAAGG - Intergenic
965303406 3:167032894-167032916 TTTTATCTTGAAAATGATTTGGG + Intergenic
965358888 3:167711860-167711882 TGATATATTTAAAATGCTGAAGG + Intronic
965361106 3:167739150-167739172 TTTAGTCTTTAAAATTTGGAAGG + Intronic
965690234 3:171348348-171348370 TTATATCCTTAAAATTTAGATGG - Intronic
965772160 3:172192682-172192704 TCTTATTTTATAAATGTTGACGG + Intronic
965828801 3:172759154-172759176 TTTTATTTTTAAAATATTGAAGG + Intronic
966251815 3:177874727-177874749 TTTTTTTTTTGAAATCTTGAAGG + Intergenic
966474405 3:180326881-180326903 TGTTTTCTTTAAAATGTGAAGGG + Intergenic
966729170 3:183136221-183136243 TTTTATCTCTAAAATTTTGGAGG - Intronic
966779491 3:183571647-183571669 TTTTAAATTTAAAATGTTTGAGG + Intergenic
966785801 3:183621427-183621449 TTTTATGTTTAAGATGATTAAGG - Intergenic
966999406 3:185317949-185317971 TTTTTTCTTTAAAGTTTTAATGG - Intronic
967410951 3:189166045-189166067 TTTCATCTTTATTATGTTGTTGG - Intronic
967464445 3:189787594-189787616 TTTCATCTTTCAAATCTTGCTGG + Intronic
967895172 3:194389506-194389528 TTGTCTCTTTACGATGTTGATGG + Intergenic
968178527 3:196571858-196571880 TTTTATCCTCAAAATATTCAAGG - Intronic
969976723 4:11110261-11110283 TTTTATTTTAAAAATGGGGATGG + Intergenic
970057064 4:11986772-11986794 AATTATCATTAAAATGTTTATGG + Intergenic
970063679 4:12066333-12066355 TTTTCTCTCTAAAATGTGCAAGG - Intergenic
970115456 4:12689993-12690015 CTCTATCTTTAAAATATTGCTGG + Intergenic
970157775 4:13158794-13158816 TTTCCTCTTTAAAATGTTCTCGG - Intergenic
970342673 4:15122824-15122846 TTTTATTTTTAAATTTTTGTGGG + Intergenic
970428210 4:15964653-15964675 TTTTAAATTTAAAATTTTTAGGG + Intronic
970768392 4:19579430-19579452 TTTTATTTTTCAAATTTTCATGG - Intergenic
971295248 4:25383110-25383132 TTTAGTTTTTAAAATATTGAAGG + Intronic
971558472 4:28043514-28043536 TTTTATCTTTTTAATTTTGGGGG + Intergenic
971577815 4:28299212-28299234 TAAAATGTTTAAAATGTTGAGGG - Intergenic
971587675 4:28425315-28425337 TCATATCTTAAAGATGTTGAGGG + Intergenic
971664085 4:29459395-29459417 TATCATGTTTAAACTGTTGAAGG + Intergenic
971925730 4:33007164-33007186 TTTTAGCATTAAAATGAGGAAGG - Intergenic
971928414 4:33045806-33045828 TTTTCTCTTTTAATTTTTGAAGG - Intergenic
972012638 4:34204242-34204264 TTGCATCTTTAAAATGTGCATGG + Intergenic
972072074 4:35033419-35033441 GTTTATATTTAAAAGCTTGATGG - Intergenic
972106898 4:35499462-35499484 TTTTATCTTTAAATTTCTGAAGG - Intergenic
972191523 4:36597794-36597816 CTTTAGTTTTAAAATGCTGAAGG + Intergenic
972329076 4:38047130-38047152 TTTTATTTTTAAAATGCTCATGG + Intronic
972396279 4:38662560-38662582 CTTCATCTTTAAAATGTAAAGGG - Intergenic
972621832 4:40754456-40754478 TTTTACTTTTAAAATATTGGAGG + Intronic
973063501 4:45760249-45760271 TTTTATTTTAAAAATATTAATGG - Intergenic
973177962 4:47231366-47231388 TTTCATCTGTAAAATGAGGAGGG + Intronic
973242782 4:47975082-47975104 TTGTCTCTTTAACAAGTTGATGG - Intronic
973789750 4:54367006-54367028 ATTTATAATTAAAATATTGACGG + Intergenic
973830313 4:54752795-54752817 TTTTATTTTTTAAAAGGTGAAGG - Intergenic
973849382 4:54946221-54946243 TTTCATCTTTAAAATGTAATTGG + Intergenic
974283248 4:59826801-59826823 TTTTAACTTTAAAAAGTATAGGG + Intergenic
974514036 4:62884853-62884875 TTTTATTTTTAAAATGAAAATGG + Intergenic
974573941 4:63691646-63691668 GTTTATCTTTTAAGTTTTGAAGG - Intergenic
974881232 4:67759840-67759862 TTGTATTTTTAAAATATTTAAGG + Intergenic
975117839 4:70698630-70698652 GTTTATCTTAATAATGTTGCTGG - Intergenic
975354797 4:73389259-73389281 TTTATTCTTTAATATATTGAAGG + Intergenic
975369283 4:73566457-73566479 TTACATATTTAAAATGCTGAAGG - Intergenic
975567736 4:75776877-75776899 ATTTAACTTTAAAATGCTTAAGG - Intronic
975793487 4:77982901-77982923 TTTCTTCTTTAGGATGTTGAGGG - Intergenic
975932995 4:79549176-79549198 TTTTTTCTTTATACTGTTGTTGG - Intergenic
976058184 4:81094031-81094053 TTTTATCTTTTACAAATTGAAGG - Intronic
976064785 4:81173056-81173078 TTTTATCTTGAAATTGGTTATGG + Intronic
976662585 4:87555175-87555197 TTTTATCTCTAACTTTTTGAGGG + Intergenic
976800099 4:88980301-88980323 TTTTATCTTTATACTGTGGGGGG + Intronic
976860443 4:89659362-89659384 ATTTACCTTTAAAGTGCTGAGGG + Intergenic
976972326 4:91119978-91120000 TATTATCTTTAAAATTATGGAGG - Intronic
976990812 4:91362956-91362978 TTGTTTGTTTAAAATGTTAAGGG - Intronic
977144335 4:93417838-93417860 ATTTATCTTTTCCATGTTGATGG + Intronic
977377911 4:96231550-96231572 TTTTATCATTTTAATGTTGATGG - Intergenic
977501187 4:97840080-97840102 TTTAATTTTTAAAATTTGGATGG - Intronic
977544751 4:98364336-98364358 TTTTATCTGTAAAATTTGGCAGG - Intronic
977546761 4:98392214-98392236 TTTACTTTTTAAAATATTGATGG - Intronic
977634903 4:99286123-99286145 TTTTACCTATAAAATGTTATGGG - Intronic
977796922 4:101177029-101177051 TTTTGTCTTTAAAATATAGCAGG - Intronic
977936397 4:102810901-102810923 TGTTAGTTTGAAAATGTTGAAGG - Intronic
978002608 4:103574525-103574547 GTTTATCCTTAAAATATTTATGG - Intergenic
978591401 4:110328588-110328610 ATTTTTCCTCAAAATGTTGATGG + Intergenic
978667722 4:111205958-111205980 TTTTTTCTATGAAATCTTGATGG - Intergenic
978760174 4:112348830-112348852 TTTTATACTTAAAATGTCAAAGG - Intronic
978766052 4:112406073-112406095 TTTTATGTTTAATTTTTTGAGGG - Intronic
978889459 4:113805887-113805909 TTTTAAATCTAAAATGTTAAAGG + Intergenic
979040232 4:115781855-115781877 TTTTAGCATTAAAATGAGGAAGG + Intergenic
979084832 4:116394858-116394880 TGTTCTATTTAATATGTTGAAGG + Intergenic
979419954 4:120491352-120491374 TTTTATTTTTGAAATGTAGACGG - Intergenic
979662236 4:123270283-123270305 TTTTATCTTTTACATTTTCATGG - Intronic
979756304 4:124344190-124344212 TTTTATGTTTAAGATGTACATGG + Intergenic
979840453 4:125433196-125433218 ATTTATTTGTAAAATGTTTATGG - Intronic
980145293 4:128975337-128975359 TTTTATTTTTAAAAAGTTGTTGG - Intronic
980162843 4:129186590-129186612 TTTTATGTTAACAATGTTTATGG - Intergenic
980169577 4:129273027-129273049 TTTTTTCTTTAGAATGTTTGTGG + Intergenic
980205017 4:129706831-129706853 TTATACCTTTAAAAAGCTGAAGG - Intergenic
980394679 4:132195682-132195704 TTTTTTCTTTATAATTTTTAGGG + Intergenic
980409234 4:132393168-132393190 TTTTATAATTAAAATGTTCTGGG + Intergenic
980485251 4:133449414-133449436 TTTTAAATTTAAAATATTGAGGG - Intergenic
980548290 4:134298693-134298715 TTTTACATTTGAAATGTTGTTGG + Intergenic
980582011 4:134767680-134767702 TACTATCTTTTAAATGTTGTTGG + Intergenic
980606854 4:135103444-135103466 CTTTATCAATAAAATGTTGCAGG - Intergenic
980777278 4:137453344-137453366 TTTTATTCATAAAATGTTTAAGG - Intergenic
980914720 4:139023436-139023458 GTTTATCTTTCAAATCTTGTAGG + Intronic
981154510 4:141417863-141417885 TTTTATTTTTTAAATTTTGTGGG + Intergenic
981488390 4:145313128-145313150 TTTTTTCTCTAAGATATTGAAGG + Intergenic
981599668 4:146472073-146472095 GTTTATTTTTAAGATGCTGAAGG - Intronic
981608077 4:146561776-146561798 GTTTATCATTAAAATGTAGGAGG - Intergenic
981735717 4:147948214-147948236 TATTATCTTTAAAAAGTGGCAGG - Intronic
981858887 4:149330397-149330419 TTTTATCTGTCATCTGTTGATGG + Intergenic
981892097 4:149750704-149750726 TGTTATTTATAAAATGTTAATGG - Intergenic
982015158 4:151146150-151146172 TTTTTTCTTTAAGCTGTTCAGGG - Intronic
982145846 4:152390661-152390683 TGTTATGTTTAAACTGTTTATGG - Intronic
982338625 4:154269652-154269674 ATTTATCTTCAAAAATTTGAAGG + Intronic
982346318 4:154364526-154364548 TCTGATCTTTGAAATGTTAAAGG + Intronic
982431546 4:155327473-155327495 TTTTATGTTTAAAAAGATGTAGG - Intergenic
982447436 4:155509449-155509471 TTTTTACTTTAAAACGTTGTAGG - Intergenic
982470548 4:155784715-155784737 GTTTTTCTTTAAAACGTTCAAGG + Intronic
982667324 4:158281488-158281510 TTTTTTTTTTTAAATGTTGAGGG - Intergenic
982675917 4:158375597-158375619 GTTTATCTTTAAAAAATGGATGG - Intronic
982717859 4:158827686-158827708 CTTTATCTTTAGCGTGTTGAGGG + Intronic
982774589 4:159428642-159428664 TTATACTTTTAAAATGTTAAAGG + Intergenic
982881661 4:160726630-160726652 ATATATCTCTAAAATATTGAGGG + Intergenic
983074734 4:163312193-163312215 TTTAACCTTTCATATGTTGATGG - Intergenic
983329810 4:166311076-166311098 TTTTATTTTTTAAATTTTTATGG - Intergenic
983444025 4:167825745-167825767 TTTTAACATTTAAATATTGAGGG - Intergenic
983689962 4:170456466-170456488 TTTTCTGTTTACTATGTTGATGG - Intergenic
984011603 4:174378289-174378311 TTGAATCTTTAAAATGTAGCAGG - Intergenic
984637547 4:182127614-182127636 TGTTTTATTTAAAATGTTAATGG - Intergenic
984639994 4:182153043-182153065 TTTTATCTTTTATATGTTTCAGG + Intronic
985343784 4:188979748-188979770 TTTTTTATGTATAATGTTGATGG + Intergenic
985369766 4:189273839-189273861 TATTATTTTAAAAATGTTGAAGG + Intergenic
986475966 5:8133096-8133118 TTTACTCTTTAAAGTTTTGATGG + Intergenic
986944981 5:13006440-13006462 TGTCATATTTAAAATTTTGAGGG + Intergenic
987051230 5:14147882-14147904 TTCTATTTTTGAAATATTGAGGG - Intronic
987210418 5:15676371-15676393 TTTGATCTTTAAAATGCAGCAGG + Intronic
987465624 5:18268787-18268809 CTTTATTTTGAAAATATTGAAGG + Intergenic
987571366 5:19665593-19665615 TTTGATCTTAAAAATGTTGAAGG + Intronic
987912522 5:24167062-24167084 TTTTATTTTCAAGCTGTTGAGGG - Intronic
988304547 5:29478393-29478415 TTTTATTTTTACAATGATTAGGG + Intergenic
988420821 5:31004005-31004027 TTATATTTTTAAAATGCTGTTGG + Intergenic
988663456 5:33299040-33299062 TTTTATGTTTAAATTGATAAAGG + Intergenic
989482398 5:41947252-41947274 TTTTATCTCTTAATTGATGAAGG - Intergenic
989553519 5:42763864-42763886 TTTTATTTTTATAATGGAGAAGG + Intronic
989735425 5:44697774-44697796 TTTTATTTTTACAAGGTTGCAGG + Intergenic
990222870 5:53614405-53614427 TTCTATATTTAAATTGTTTAAGG + Intronic
990430893 5:55734218-55734240 TTTTATCTTTCAAATACTGTAGG - Intronic
990642183 5:57799280-57799302 ATTTATCTATAAAATCTAGATGG - Intergenic
990765825 5:59181438-59181460 TTATATTTCAAAAATGTTGATGG - Intronic
990818277 5:59809402-59809424 TTTAATTTTTAAAGTGTCGAAGG + Intronic
991013329 5:61906626-61906648 TGTTATCTTTTAGATGTTGATGG - Intergenic
991114382 5:62937507-62937529 TTTCATAATTAAAATTTTGAAGG + Intergenic
991726192 5:69538012-69538034 TTTTTTTTTTAATAAGTTGAAGG + Intronic
991868764 5:71089862-71089884 TTTTTTTTTTAATAAGTTGAAGG - Intergenic
991981952 5:72241435-72241457 GTTTATCTTTTTAATGCTGATGG - Intronic
991984632 5:72272092-72272114 CTTGATCTTTAAAATGTGGCAGG - Intronic
992040027 5:72821437-72821459 TCTTATCTTTAAAATCTTGTTGG - Intronic
992475011 5:77093405-77093427 TTTTATTTCTATAAGGTTGATGG + Intergenic
993187327 5:84636289-84636311 TTTTTTCTTGATAAAGTTGAAGG - Intergenic
993222270 5:85114571-85114593 ATTTAATTTTAAAATGATGATGG - Intergenic
993266754 5:85735678-85735700 GTTTACCTTTAAAATGATGTTGG - Intergenic
993473365 5:88333780-88333802 TTTTATTTTTAAAATAGAGATGG + Intergenic
993524826 5:88952234-88952256 TCTTACCTTTAAAATCTTCAAGG + Intergenic
993624277 5:90205288-90205310 TTTTATTTTTTGATTGTTGAAGG - Intergenic
993722016 5:91330983-91331005 TTTCATCATTAAAAAATTGATGG - Intergenic
993820423 5:92608161-92608183 TTTAATCTGTAAAATGGGGATGG + Intergenic
993834864 5:92806673-92806695 TTTCATCCTGAAAATCTTGATGG - Intergenic
993932002 5:93952464-93952486 TGATATATTTAAAGTGTTGATGG - Intronic
993993697 5:94692331-94692353 TTTTATGTTTAAAATCTGTAAGG + Intronic
994000086 5:94768991-94769013 TTTATTCATTAAAATGTTGATGG - Intronic
994057820 5:95439286-95439308 TTTCTTCTTTAAAATGTTGTAGG + Intronic
994504466 5:100624064-100624086 TTTTATATTTATAATGATGTTGG + Intergenic
994640901 5:102408565-102408587 TGATATCTTTTAAATGTTGGTGG + Intronic
994739434 5:103599561-103599583 TTTTGTCATAAAAATGTTGATGG - Intergenic
994803095 5:104405047-104405069 ATTTATATTTAAAATGTGTAAGG + Intergenic
994877474 5:105444157-105444179 TTTTTTCATTAAAATGATGTAGG - Intergenic
994916442 5:105986297-105986319 GTTTATTTTTAAAATTTTGATGG - Intergenic
994946173 5:106395002-106395024 TTTAATCTATAATTTGTTGATGG + Intergenic
995030091 5:107470668-107470690 GTTAATCTTTAAAATATTAAAGG - Intronic
995071474 5:107927157-107927179 TTAAATATTTAAAATGTTAAAGG + Intronic
995150472 5:108838795-108838817 TATTATTTTTAGAATGTTTAAGG - Intronic
995269267 5:110202930-110202952 TTTTATCTCTAAAATGTAGATGG + Intergenic
995563001 5:113403357-113403379 TTTTAAATATAAAACGTTGATGG - Intronic
995638242 5:114220280-114220302 TGCTATCTTGAAAGTGTTGAAGG - Intergenic
995648264 5:114338485-114338507 TTTTATCTATAAAGTGAGGATGG - Intergenic
995907224 5:117140128-117140150 TTTTCTCTTTGAATTGCTGATGG - Intergenic
995985547 5:118166623-118166645 TTTTTTCTTTAAATCGTTTATGG - Intergenic
996290782 5:121850747-121850769 TACTATTGTTAAAATGTTGATGG - Intergenic
996297126 5:121932948-121932970 ATTTATCATTAAAATTTTGTAGG - Intergenic
996401438 5:123067605-123067627 TTCTATCTTTAACTTTTTGAGGG + Intergenic
996424348 5:123296870-123296892 GTTTATTTTTAATATGTTTATGG + Intergenic
996645249 5:125806662-125806684 AAATATCTTTAAAATGTTTAAGG - Intergenic
996710820 5:126541995-126542017 TTCTAGATTTAAAATGTTGTAGG - Exonic
997313471 5:132911144-132911166 TGTTATTTTTATAATGCTGATGG - Intronic
997338432 5:133123865-133123887 TTTTCTCTGAAGAATGTTGAGGG + Intergenic
998158714 5:139800902-139800924 TTTTATCTTAAAAATGGTTCTGG + Intronic
998302184 5:141033636-141033658 TTTGATCTTTAAAAGTTTGAGGG - Intergenic
998491825 5:142553510-142553532 TTAAATCTTTAAAATGTTGAGGG + Intergenic
999013864 5:148074627-148074649 TTTTATCTCTAACATGTATATGG - Intronic
999580039 5:153028132-153028154 CTTTATCTTTTTAATGTTCATGG - Intergenic
999582461 5:153054469-153054491 TATTATTTTTAAATTGTTGGTGG + Intergenic
999838095 5:155396150-155396172 TTTTATGTTTAAAATATTTTTGG + Intergenic
1000467772 5:161601030-161601052 TTTAAAATTTAAAATGGTGAGGG + Intronic
1000575215 5:162967968-162967990 TTATAATTCTAAAATGTTGAGGG - Intergenic
1000656164 5:163880771-163880793 CTTTATCTTTAAAATATAAATGG - Intergenic
1000766696 5:165300163-165300185 TTTTATATTTAAAAATTAGATGG + Intergenic
1000820905 5:165982175-165982197 ATTTTTCTTCAGAATGTTGAAGG + Intergenic
1001320104 5:170673832-170673854 TTTAATCTGTAAAATGGTGGTGG + Intronic
1001551378 5:172604523-172604545 GTTACTCTTTAAAATATTGATGG + Intergenic
1001893291 5:175357197-175357219 ATTTTTCTTTAGAATTTTGAAGG - Intergenic
1002346337 5:178550250-178550272 TTTTAAGCTTAAAATGTTCAAGG + Intronic
1002717589 5:181237782-181237804 TTTTAACTTGAGAATCTTGAGGG - Intronic
1002973086 6:2044700-2044722 TTTTAACTTTTAAAAGTTCAGGG - Intronic
1003209006 6:4042418-4042440 CTTTAACTTTAAAATGTATAAGG + Intronic
1003683678 6:8280085-8280107 GTATTTGTTTAAAATGTTGATGG + Intergenic
1003867404 6:10375880-10375902 TTTTATTTTTCAAATTTTGGTGG + Intergenic
1003927753 6:10892961-10892983 TTTTATAGTTTAAATGTTTAAGG + Intronic
1004476321 6:15976194-15976216 TCATGTCTTTAAAATATTGAGGG - Intergenic
1004756265 6:18613968-18613990 TATTATTTTTAAAATAATGATGG + Intergenic
1004979029 6:21002000-21002022 TTTTATCTTTATTTGGTTGAGGG + Intronic
1005139876 6:22617678-22617700 TTTTACTTTTAAAATGTTTTTGG - Intergenic
1005238121 6:23790091-23790113 CATTATATTTAAAATGTGGAAGG - Intergenic
1005252158 6:23959716-23959738 TTTTATCATTGTAATGTTAAAGG + Intergenic
1005327490 6:24717027-24717049 TTTAGTCTTTCAAATATTGATGG - Intronic
1005695526 6:28349358-28349380 TTCTATTTTTATAATTTTGATGG + Intronic
1006489789 6:34377464-34377486 TTTAATGTTTTAAATGTTGGGGG - Intronic
1006590814 6:35155558-35155580 TCTTATATGTAAAATGGTGAAGG - Intergenic
1007187807 6:39987340-39987362 TTTAACCTGTTAAATGTTGAAGG + Intergenic
1007633369 6:43284716-43284738 TTTCATCTTTAAAATTCTCATGG - Intronic
1007644759 6:43371162-43371184 TTTTTTCATTAAAATGTTATTGG - Intergenic
1008477562 6:51948770-51948792 TTCTAGCCTTTAAATGTTGATGG - Intronic
1008910117 6:56722944-56722966 TTTTATATTTGAAATTTTTAAGG - Intronic
1008986854 6:57554741-57554763 TTTTCTCTTTGAAAAATTGAAGG + Intronic
1009174814 6:60447302-60447324 TTTTCTCTTTGAAAAATTGAAGG + Intergenic
1009354216 6:62721062-62721084 TTTTACTGTTAAAATGCTGAAGG + Intergenic
1009671992 6:66766028-66766050 TTTTATGTTTAAATTCTTCAGGG - Intergenic
1009728965 6:67574237-67574259 TTTTATAGTTAAAATATTAAAGG + Intergenic
1009802550 6:68558375-68558397 TTTTTTCTTTATTATGTTGTAGG - Intergenic
1009856418 6:69270879-69270901 TTTTCCCTTTAAAATATTGCTGG - Intronic
1009990164 6:70833193-70833215 TTTTATTTTTAAAACATTTAAGG - Intronic
1009998502 6:70924146-70924168 TTTTATTTTTTAAATTTTGGGGG - Intronic
1010044769 6:71428789-71428811 TCTTATCCTTAAAATATTGAAGG + Intergenic
1010137037 6:72567219-72567241 TTATACTTTTAAAATGTTGTTGG - Intergenic
1010339831 6:74736357-74736379 TTTACTCATTGAAATGTTGATGG + Intergenic
1010669257 6:78667490-78667512 TTTTATCCTCAAAACTTTGATGG - Intergenic
1011036943 6:82987477-82987499 TTTTATCTTTAACATTGTGTTGG - Intronic
1011135323 6:84093771-84093793 TTTTAGCATTAAAATGAGGAAGG + Intergenic
1011286569 6:85730946-85730968 TTTTCCCCTTTAAATGTTGAAGG - Intergenic
1011486960 6:87852754-87852776 TTTTATCTTTAAAATATTTCTGG - Intergenic
1011796825 6:90963350-90963372 TTTTATTTTTAAATTTTTGTGGG + Intergenic
1012106871 6:95172971-95172993 TTTTTTCTTTAAAATTATGATGG + Intergenic
1012115752 6:95296021-95296043 TTATAACTTAAAAATTTTGAAGG - Intergenic
1012185611 6:96211984-96212006 TTTTATCTGAAAAATTTTAAGGG + Exonic
1012424825 6:99102414-99102436 TTTTAATTTAAAAATTTTGAAGG - Intergenic
1012538747 6:100333844-100333866 TTTTTTCATTAAAATGTCAATGG + Intergenic
1012771317 6:103438191-103438213 TGTTATCTTTTAATTGTTGGTGG - Intergenic
1012958647 6:105598287-105598309 TTTTATTTTTAATTTTTTGAGGG + Intergenic
1013402326 6:109810751-109810773 TTTTATATTTAATAAGATGAGGG - Intronic
1013516640 6:110893097-110893119 TTTGATTTTTAAAATCTTAAAGG + Intronic
1013547030 6:111168278-111168300 TTTTATCTTAAAAATGCAAACGG - Intronic
1013744278 6:113326557-113326579 TTTTAACATTTAAATTTTGAAGG + Intergenic
1013848461 6:114483980-114484002 TTGTCTCTTTACACTGTTGATGG - Intergenic
1014371246 6:120610627-120610649 TCTTTTCTCTAAAATGTTGAAGG - Intergenic
1014450381 6:121574602-121574624 ATTTATTTTTAAAATGCTTATGG + Intergenic
1014459339 6:121676915-121676937 TTTTTTCTTTTAAATGAAGATGG + Intergenic
1014966640 6:127761486-127761508 TTTTAGCATTAAAATGAGGAAGG - Intronic
1015036766 6:128665302-128665324 TTTTATTTTCTAAATCTTGATGG + Intergenic
1015156280 6:130100228-130100250 TTTCATCTGTAAAATGAGGATGG - Intronic
1015362614 6:132357783-132357805 TTTTATATTTCATATTTTGAAGG + Intronic
1016280177 6:142408135-142408157 TTTTTTCTTTAAAAGGATGTAGG + Exonic
1016491940 6:144614939-144614961 TTGTGCCTTTGAAATGTTGAGGG - Intronic
1016851174 6:148620533-148620555 TTTTATCTTTAAAGTCCTCAAGG + Intergenic
1016972859 6:149780739-149780761 ATTTATCTATTAACTGTTGAGGG + Intronic
1017510020 6:155105753-155105775 TGTTATTTTTAAAATGATGAAGG + Intronic
1017601474 6:156087403-156087425 TTTTATACTAAAAATGCTGAGGG + Intergenic
1017655627 6:156626211-156626233 TAATATCTTAAAAGTGTTGAAGG - Intergenic
1017964032 6:159248218-159248240 TTTTCTTTTTCAAATGTTAAAGG + Intronic
1018975118 6:168558563-168558585 TCTCATCTTTAAAATGGTAATGG + Intronic
1019902439 7:4032153-4032175 TTTTATCTTAAGAGTGTTGATGG + Intronic
1020503837 7:8958133-8958155 TTTTATACTTACAATGTTTATGG + Intergenic
1020551956 7:9618311-9618333 TTTTCTCTTTAAAATGCTGATGG - Intergenic
1020615105 7:10449492-10449514 TTTTATTTTTAATTTTTTGAGGG - Intergenic
1020983205 7:15097409-15097431 TATTGTTTGTAAAATGTTGACGG + Intergenic
1021007402 7:15415779-15415801 TTTTAACTTAAAACTGTGGAAGG - Intronic
1021398264 7:20178410-20178432 TAATGTCTTCAAAATGTTGAAGG - Intronic
1021460572 7:20882393-20882415 TTCTATATTTTAAATGTTTAAGG + Intergenic
1021486599 7:21174951-21174973 ATTTAACTTTAAAATCGTGATGG + Intergenic
1022448799 7:30494457-30494479 TTTTATCTTTTACATTTTTAAGG + Intergenic
1023060953 7:36326250-36326272 TTATTTCTTTTATATGTTGAGGG - Exonic
1023320309 7:38989891-38989913 TCATATCTTTAAAATGCTGATGG + Intronic
1023715063 7:43035470-43035492 TATCATCTTTAAAATATAGAAGG - Intergenic
1024474089 7:49792288-49792310 TTTTATCTGTAAAATGAGGATGG - Intronic
1024728343 7:52226561-52226583 TTTTACATTTAAATTTTTGAGGG - Intergenic
1024945311 7:54802132-54802154 CTTTTTCTTTAAAATATTCAAGG + Intergenic
1025577754 7:62669413-62669435 ATTGATCTGTATAATGTTGATGG - Intergenic
1025754399 7:64322857-64322879 TTATAGAATTAAAATGTTGATGG - Intronic
1026032324 7:66805047-66805069 TTTTATCTCTAAAGTTATGAAGG - Intronic
1026339250 7:69421269-69421291 TTAGATTTTTAAAATGGTGATGG - Intergenic
1026731980 7:72919838-72919860 CTTGATCTTTAAAGTGCTGAAGG - Intronic
1027111990 7:75447524-75447546 CTTGATCTTTAAAGTGCTGAAGG + Intronic
1027284220 7:76632055-76632077 CTTGATCTTTAAAGTGCTGAAGG + Intergenic
1027335839 7:77149344-77149366 TTCTATTTTTAAAAAGCTGACGG - Intronic
1027536469 7:79408894-79408916 TTTTATCTGGATAATGTTCAAGG - Intronic
1027670067 7:81085508-81085530 TTTTATCTTCAGTATGTAGATGG + Intergenic
1027703376 7:81497337-81497359 TTTTATTTTTTACATGTGGACGG - Intergenic
1027790183 7:82631281-82631303 TTTCATCTTTATTATGTTAATGG + Intergenic
1028059059 7:86286859-86286881 TTGTATCCTAAAAATGTTGCTGG + Intergenic
1028247658 7:88500700-88500722 GTCTATCTTTTAAATGTTAATGG - Intergenic
1028486274 7:91361016-91361038 TATTATCTTCAAAATGCTTAGGG + Intergenic
1028579595 7:92394142-92394164 TCTCATCTTTACAATGTGGATGG + Intronic
1028642369 7:93056962-93056984 TGTTATCCTGAAAATGTTCAAGG - Intergenic
1028739406 7:94255552-94255574 TCTTTTCTTGAAAATGTTAAAGG + Intergenic
1028780480 7:94729619-94729641 TGTTATATTTAAAGTGCTGAAGG + Intergenic
1028998934 7:97132227-97132249 TTTTGCCTTTAAAATTTTGTAGG + Intronic
1029321743 7:99768193-99768215 TTTAAAGTTTAAAATGATGATGG + Intronic
1029840515 7:103358153-103358175 TTTTCCCTTCAAAATTTTGAAGG + Intronic
1029910386 7:104139460-104139482 TTTTCCCTTTAAAATGGTAATGG - Intronic
1030174520 7:106637816-106637838 TATTATCCTTTTAATGTTGATGG - Intergenic
1030476319 7:110037350-110037372 TTTTATTTTTAATATTTTGTGGG + Intergenic
1030587730 7:111441708-111441730 TTTTTTTTTTAACAAGTTGAAGG - Intronic
1030697646 7:112603681-112603703 CTTTATCTGTAAAATGGGGATGG - Intergenic
1031027890 7:116700459-116700481 TTATATCTTTAAAATGTAAATGG + Intronic
1031148109 7:118019911-118019933 TTATATTTTTAATATGTTGTTGG - Intergenic
1031312934 7:120221616-120221638 TTTTCTCTTTAAAGTGTGAAGGG - Intergenic
1031345787 7:120664550-120664572 CATTATCTTTTAAATGTTGATGG - Intronic
1031583266 7:123503941-123503963 CTTTATTTTTTAAATGTTTATGG - Intronic
1031657124 7:124370763-124370785 TTGTCTCTTAAAAATGTTAAAGG + Intergenic
1031671079 7:124546628-124546650 ATATATTTTTAAAATCTTGATGG + Intergenic
1031719484 7:125153353-125153375 TTTTTTCATTTAAAAGTTGATGG - Intergenic
1031725778 7:125236551-125236573 TTTTAATTTTAAAATGTTTTTGG + Intergenic
1031798113 7:126204174-126204196 TTTTATATTTAACACGATGATGG + Intergenic
1031897451 7:127367658-127367680 TTTTATCTTCTCAATATTGATGG - Intronic
1031933837 7:127715044-127715066 TTGTATTTTTAAGTTGTTGAGGG + Intronic
1032160818 7:129508942-129508964 TTTAATCTTTAAAATGGTTTGGG - Intronic
1032341483 7:131078077-131078099 TTATATTTTTAAGATGCTGAAGG + Intergenic
1032560519 7:132886988-132887010 TTTTATTTTTAACATGCTGCAGG - Intronic
1033296904 7:140147105-140147127 GTGTATCAGTAAAATGTTGAAGG - Intronic
1033298723 7:140165892-140165914 TTCTATCTATAAAATTGTGAAGG + Intronic
1033803890 7:144933032-144933054 AATTATCTTTAAAATACTGAAGG - Intergenic
1033937089 7:146599544-146599566 TTTTATCTATAAGATGATCAGGG - Intronic
1033944747 7:146702826-146702848 TATGATCTTTAACATGTTAAAGG - Intronic
1034210116 7:149356064-149356086 TTCTATCTTTGAAGTGTTGCAGG - Intergenic
1034851164 7:154495300-154495322 TTTTATTTCTTAAATGATGAGGG + Intronic
1035613821 8:987823-987845 TTTTATCTGTCATATGTTGGGGG - Intergenic
1035974692 8:4296009-4296031 TTTCATTTTTAAGATGTTGTTGG - Intronic
1036041095 8:5082659-5082681 TTTTATCTTTAAACTAATGTTGG - Intergenic
1036067574 8:5399718-5399740 TTTTCAATTTAAAATGTGGAAGG - Intergenic
1036400952 8:8407770-8407792 TTTTATCTTTCAAAATATGAAGG - Intergenic
1036487991 8:9196924-9196946 TTTTATCTTTAGAACTTTGAAGG + Intergenic
1036718985 8:11154780-11154802 TTTTCTCTTAAAAGAGTTGAAGG - Intronic
1037009490 8:13823000-13823022 TTCTCTCTTTAAAATGTTTAAGG + Intergenic
1037120890 8:15285442-15285464 TATTATTTTTAAAAATTTGAAGG - Intergenic
1037140863 8:15519135-15519157 TTTTTTAATTAAATTGTTGAAGG + Intronic
1037532363 8:19790439-19790461 TTTTCACTTAAAAATGTAGATGG + Intergenic
1037732239 8:21536286-21536308 GCATATCTTTAAAATGCTGAAGG + Intergenic
1038845670 8:31227210-31227232 TTTTTTCCTTAAAATTTTGAAGG + Intergenic
1038884788 8:31651417-31651439 ATTTATTTTTACAATGTAGATGG + Intronic
1038952395 8:32429852-32429874 TTTTTTCTTAAAAATGTACATGG - Intronic
1039081443 8:33737946-33737968 TTTGATCTTTGAATTCTTGAAGG + Intergenic
1039644983 8:39271626-39271648 TTTTATTTTTAAATTGTTTAGGG + Intronic
1039662497 8:39482525-39482547 GTTTATCTTTAGAATCTTTATGG - Intergenic
1039805986 8:40999014-40999036 TTTTATTTCTGTAATGTTGATGG + Intergenic
1040061046 8:43103032-43103054 TTATTTCTTAAAACTGTTGAGGG + Intronic
1040770427 8:50969107-50969129 TTTTATCTCTAAAGTGTTTCTGG + Intergenic
1040787163 8:51179326-51179348 TTTAATCATTCAACTGTTGAAGG - Intergenic
1040839341 8:51768625-51768647 TTTTTTCTTTAAATTATTCATGG - Intronic
1040884311 8:52243226-52243248 TTTTAATTTTAAAAAGTTCATGG + Intronic
1041552133 8:59115014-59115036 TTTTATCATTGAAATGAGGAAGG - Intronic
1041654373 8:60334088-60334110 TTAAAACTTTTAAATGTTGATGG - Intergenic
1041679672 8:60575972-60575994 TTTTATCTTCAAAAAATTTAAGG + Intronic
1041874519 8:62672547-62672569 TTTTATATTTCAAATATTTATGG + Intronic
1042148439 8:65756894-65756916 GTTTATTTTTAAAATTTTGCTGG + Intronic
1042586260 8:70342415-70342437 TTTTATGTTTTAAATTTTGAGGG - Intronic
1043697212 8:83235251-83235273 TCATATATTTAAAATGTTGAGGG - Intergenic
1043729681 8:83660294-83660316 TTCTATCTAATAAATGTTGAGGG - Intergenic
1043941973 8:86206128-86206150 TTTTTTCTTCAAAATTTTAAAGG - Intergenic
1044049212 8:87479094-87479116 TTTTGTCTTTAAAATATATAAGG - Intronic
1044059921 8:87623693-87623715 TTTAATTTTTAAAATGATGCCGG + Intergenic
1044264987 8:90171403-90171425 TTTTATCTTGAAAAAATGGAAGG - Intergenic
1044497733 8:92908883-92908905 ATTTATTCTAAAAATGTTGAAGG - Intronic
1044915439 8:97108393-97108415 TTTTATTTTTAAAGACTTGATGG + Intronic
1045183189 8:99808825-99808847 TCTTACATTTAAAATGTTGAGGG + Intronic
1045261200 8:100575983-100576005 CTTTGTCTGTAAAATGTAGATGG - Intronic
1045369609 8:101509519-101509541 ATTTGTCTTAAAAGTGTTGATGG + Intronic
1045537555 8:103046144-103046166 CTTTATCTTTAAATTGTTAATGG + Intronic
1045630652 8:104117646-104117668 ATTTATCTTTAAAATTTTCCAGG + Intronic
1045811442 8:106224505-106224527 TTTTATCTTTAAATTGGGGCAGG + Intergenic
1046153913 8:110262900-110262922 TTTTGTCTTTAAATATTTGAAGG + Intergenic
1046213219 8:111107158-111107180 TTTGCACTTTAAAATGTTAAGGG - Intergenic
1046423770 8:114018976-114018998 CTTCAACTTAAAAATGTTGAAGG - Intergenic
1046519953 8:115311225-115311247 TTTTACCTTAAAAAGGTTGGAGG - Intergenic
1046656692 8:116902407-116902429 TTTTATTTCCAAAATATTGATGG - Intergenic
1046852468 8:118990638-118990660 TTTTCTCTTCAAAATGAAGATGG - Intergenic
1047329890 8:123877384-123877406 TTTTCTGTATAAAATGGTGAAGG + Intronic
1047441306 8:124880786-124880808 TTTTTTTCTTAATATGTTGATGG + Intergenic
1047488690 8:125356262-125356284 TTTAACTTTTAAAATGTTTATGG + Intronic
1048037435 8:130690783-130690805 TTTTTTTTTTAAACTGTTGTTGG + Intergenic
1048471342 8:134706979-134707001 CTTTATCTTGGAAATGTTGAGGG - Intronic
1048482803 8:134816352-134816374 TTTAATCTCTAAAATATTTAAGG + Intergenic
1048535244 8:135287927-135287949 TTTTTTTTTTTAAATATTGAGGG + Intergenic
1048689883 8:136950384-136950406 TATAATCTTTTAAATCTTGAGGG - Intergenic
1049480971 8:142822492-142822514 TTTTAGCATTAAAATGAGGAAGG + Intergenic
1049939364 9:530307-530329 TATTATTTTTAAAATGTCCAGGG + Intronic
1050247283 9:3703891-3703913 TTCTATCTTTAAAACTTTGTTGG - Intergenic
1050518826 9:6475729-6475751 TTTTATTTTAAAAATATTTATGG + Intronic
1050666437 9:7942863-7942885 TTTTATTCTAAAAATCTTGAAGG - Intergenic
1050730028 9:8698600-8698622 TTTTATCTTTAAACTCAGGAAGG + Intronic
1050870567 9:10563677-10563699 TTTTATCTTTTAAATTTTGGAGG + Intronic
1051033394 9:12712003-12712025 TTTTATCTTTTTAATGTTGGGGG - Intergenic
1051098502 9:13494190-13494212 TTTTTCCTTTAAAATTGTGAAGG + Intergenic
1051133303 9:13888385-13888407 TTTTGTGTGTGAAATGTTGAGGG - Intergenic
1051175036 9:14352125-14352147 TTTTATTTTTAAAATTTTATTGG - Intronic
1051674327 9:19544508-19544530 TTGTTTCTTTATAGTGTTGATGG + Intronic
1051814156 9:21085767-21085789 TTTCTTCTTTAACCTGTTGATGG + Intergenic
1052088639 9:24298754-24298776 TTTTATTTTTAAAGTATGGATGG + Intergenic
1052230002 9:26138499-26138521 TTTTACATTTAAAATGATGAAGG + Intergenic
1052231870 9:26164182-26164204 GTTTAAATTTGAAATGTTGAAGG - Intergenic
1052272825 9:26644354-26644376 TTTTATCTATAGAAAGTTCAGGG + Intergenic
1052375160 9:27710992-27711014 TTTTATCTTTTTAATGTTTTTGG + Intergenic
1052543971 9:29848893-29848915 ATTTATCCTTAAAATCTTGGAGG - Intergenic
1052559708 9:30069631-30069653 TTTTCTTTTTAAAATGTTAGGGG + Intergenic
1052715841 9:32116269-32116291 TTTTATTTTTATAATCTTCATGG + Intergenic
1052721542 9:32176567-32176589 TTCCATCCTTAAAATGCTGAGGG - Intergenic
1052782917 9:32799162-32799184 TTTTAAATTTAAAATTTTTATGG - Intergenic
1053070469 9:35098465-35098487 TTTTATCTTAAAATTCTTCATGG + Intergenic
1053357783 9:37461411-37461433 TCTTAAGTTTAAAATGTTTAGGG - Intronic
1053562867 9:39214033-39214055 TGGTGTCTTTAAAATGTTCAAGG + Intronic
1053828664 9:42051978-42052000 TGGTGTCTTTAAAATGTTCAAGG + Intronic
1053883654 9:42620995-42621017 CTTTATGTTTAAAGTTTTGAAGG - Intergenic
1053889014 9:42673303-42673325 CTTTATGTTTAAAGTTTTGAAGG + Intergenic
1054134280 9:61405019-61405041 TGGTGTCTTTAAAATGTTCAAGG - Intergenic
1054141685 9:61535945-61535967 CTTTGTCTTTTAAATGGTGAGGG + Intergenic
1054222675 9:62428459-62428481 CTTTATGTTTAAAGTTTTGAAGG - Intergenic
1054228035 9:62480717-62480739 CTTTATGTTTAAAGTTTTGAAGG + Intergenic
1054337896 9:63824312-63824334 TATTATTTAAAAAATGTTGAAGG + Intergenic
1054601895 9:67135476-67135498 TGGTGTCTTTAAAATGTTCAAGG - Intergenic
1055098138 9:72435501-72435523 TTTCATATTTTAAATGTGGAAGG - Intergenic
1055119618 9:72643420-72643442 TATTACCTTGAAAGTGTTGATGG - Intronic
1055146444 9:72940673-72940695 TTTTAACTTTAAAACATTAAAGG - Intronic
1055193547 9:73558269-73558291 TTTTCTCTTGAAAATTTTGAAGG - Intergenic
1055259614 9:74417767-74417789 TTTTTTCTTTAAAGTTTTGATGG - Intergenic
1055294041 9:74815987-74816009 TTTTTGCTTTAAAATGTAGTAGG - Intronic
1055375195 9:75641480-75641502 TTTTTGTTTTAAAATATTGAAGG - Intergenic
1055840683 9:80499633-80499655 TATTATTTTTAAACTTTTGATGG - Intergenic
1055848597 9:80597278-80597300 TTTTATCTATAAAATGTAGCTGG - Intergenic
1055876125 9:80943674-80943696 TTGTATCTTGTAACTGTTGAGGG - Intergenic
1055902811 9:81260702-81260724 TTTTATGTTTAAGATGGTGGGGG - Intergenic
1056140485 9:83673593-83673615 TTTTATTTTTAAATAGTTAAGGG + Intronic
1056280045 9:85032328-85032350 TTTTTTCTTAAAATTTTTGAAGG + Intergenic
1056498177 9:87180915-87180937 TTCTATTTTTAAATTTTTGAGGG - Intergenic
1056913170 9:90721767-90721789 TATTATTTTAAAAATATTGATGG - Intergenic
1056948794 9:91025352-91025374 CTTTATCTGTAAAATGTGGATGG + Intergenic
1057014019 9:91634522-91634544 TTTAGTCTTTAATATGTTTATGG - Intronic
1057592228 9:96382694-96382716 TTTGGGCTCTAAAATGTTGATGG + Intronic
1057894667 9:98899215-98899237 TTTTGTCCTAAAAATGTTAATGG - Intergenic
1058457483 9:105151009-105151031 TTTCCTCTTTAAAATTTTCAAGG - Intergenic
1058957940 9:109966629-109966651 TTTTATCTTTTAAATCTGGATGG + Intronic
1059071427 9:111141459-111141481 TTTTATATTTTAAATATTGATGG - Intergenic
1059622094 9:116017682-116017704 TTTTATACCTAAACTGTTGATGG + Intergenic
1059784598 9:117567051-117567073 CATTATCTATAAAATGATGAGGG + Intergenic
1060009535 9:120031535-120031557 TTCTTTCTTTAGGATGTTGAGGG + Intergenic
1060562567 9:124558636-124558658 CCTCATCTGTAAAATGTTGAGGG - Intronic
1060571240 9:124642365-124642387 TATTATCTATAAAATGGGGATGG + Intronic
1060709679 9:125846654-125846676 TTTACTTTTTAAAATGTAGAAGG - Intronic
1061654445 9:132078364-132078386 GTTTCTATTTAAAATGGTGAAGG + Intronic
1062109866 9:134776371-134776393 TGTTTGCTTTAAAATGTTTATGG + Intronic
1202784632 9_KI270718v1_random:36957-36979 TATTATTTAAAAAATGTTGAAGG - Intergenic
1203445584 Un_GL000219v1:52062-52084 TATTATTTTAAAAATGTTGAAGG + Intergenic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1186309864 X:8306128-8306150 TTTAATCTCTTAAATGTTTATGG + Intergenic
1186340567 X:8641450-8641472 TTTTCTTTTTAAAATATTGATGG - Intronic
1186357563 X:8803167-8803189 AATTTTTTTTAAAATGTTGAGGG - Intergenic
1186533737 X:10325931-10325953 ATTTATCTGTGCAATGTTGATGG - Intergenic
1186577082 X:10778039-10778061 TTTTTTCTTTAATAAGTAGAAGG + Intronic
1186681975 X:11884244-11884266 TTTCACCTTTAAAATCATGATGG + Intergenic
1186841872 X:13492647-13492669 TTATATTTTTAAAATTATGATGG + Intergenic
1186939137 X:14485649-14485671 TTTTATCTTTATAATGTGCCTGG + Intergenic
1187312577 X:18159766-18159788 TTTTATCTTTCAAATATAAAAGG - Intergenic
1187433370 X:19244820-19244842 TGATATCATTAAACTGTTGAAGG + Intergenic
1187522254 X:20024154-20024176 TTTTATCATTAAATTGATAAAGG - Intronic
1187760662 X:22580393-22580415 TATTAGCTTGAAAATGTTGCAGG + Intergenic
1187793281 X:22974292-22974314 TTTCATGTTCAAAATATTGATGG + Intergenic
1188380827 X:29489731-29489753 TTTTAACTATAAGATGTTGGTGG - Intronic
1188700620 X:33257212-33257234 TTTTATGTTTAGAATATAGAAGG - Intronic
1188767305 X:34110380-34110402 TGTCATATTTAAAGTGTTGAAGG - Intergenic
1188963057 X:36517213-36517235 AATTTTTTTTAAAATGTTGATGG - Intergenic
1189445769 X:41079826-41079848 TTTTTTCATGAAAATTTTGATGG + Intergenic
1189455329 X:41182638-41182660 TTTGATGTTTAAAAAGGTGAGGG + Intronic
1189844548 X:45121685-45121707 TTTTAGCTTACAAATGTTTAAGG + Intergenic
1189904122 X:45740449-45740471 TTTTATCATTCATCTGTTGATGG + Intergenic
1189949224 X:46211775-46211797 TTTAATCATTCAAAAGTTGATGG + Intergenic
1190021409 X:46881105-46881127 TTTCATGTTTAAAATGTTTTTGG + Exonic
1190166836 X:48080108-48080130 TTTTATTTTTTAAATAGTGATGG - Intergenic
1190406609 X:50094174-50094196 TTTTATCTTTAAAATAATCAAGG + Exonic
1190899245 X:54652815-54652837 TAATATATTTAAAATGCTGAAGG + Intergenic
1191240981 X:58189921-58189943 CTTTATCTTTAAAATGTGGGAGG - Intergenic
1191243237 X:58205787-58205809 CTTTATCATTAGAATGCTGAGGG - Intergenic
1191244366 X:58214264-58214286 TTCTATCATTAAAATGCTGGTGG - Intergenic
1191990078 X:67025817-67025839 TTTTTTCTTAAAAATTTTGTAGG + Intergenic
1192060392 X:67818481-67818503 TGATATATTTAAAATGCTGAAGG + Intergenic
1192070060 X:67929161-67929183 TTTTTCCATTAATATGTTGATGG - Intergenic
1192295500 X:69843623-69843645 CTTTATCTATAAAATGCAGATGG + Intronic
1192597247 X:72424102-72424124 TTTTTCCTTTACAATGTTAAAGG + Intronic
1192962004 X:76141017-76141039 TTTTAGCATATAAATGTTGATGG + Intergenic
1193106286 X:77677834-77677856 TTTTCACAATAAAATGTTGAAGG + Intronic
1193253089 X:79316132-79316154 TTATATTTTTGATATGTTGATGG + Intergenic
1193350514 X:80458185-80458207 TTTTTTTTTTTTAATGTTGATGG - Intergenic
1193357762 X:80541965-80541987 TTTAATCTTTAAATTTTTGGGGG + Intergenic
1193873254 X:86828381-86828403 TTTTTCCTTTGAACTGTTGATGG + Intronic
1193889728 X:87030341-87030363 TTTCATATTCAAAATGTGGAAGG + Intergenic
1194136856 X:90155327-90155349 TATTAGCTCTAAAATGTTGGTGG - Intergenic
1194393029 X:93344861-93344883 TAATATATTTAAAGTGTTGATGG - Intergenic
1194402237 X:93452747-93452769 TTTTATCTTTTAAAAGTTTGTGG + Intergenic
1194551650 X:95308393-95308415 AATTATCTTTAAAATTTTTACGG + Intergenic
1195269756 X:103217659-103217681 TTTAATTTTTAGAATATTGAGGG + Intergenic
1195405213 X:104505161-104505183 TTTAATTGTTAAAATGTTGAAGG + Intergenic
1195502362 X:105616629-105616651 TTTTCTTTTTATTATGTTGAAGG + Intronic
1195768466 X:108321909-108321931 TTTTATCTGTAAAATGATAATGG - Intronic
1196166361 X:112539403-112539425 TTGTATCCTCAAAATGTTAAAGG - Intergenic
1196255131 X:113509227-113509249 ATTTATTTTTTAAATGTAGATGG + Intergenic
1196429788 X:115611287-115611309 TTTTCTAGTTAAAATTTTGATGG - Intronic
1196436024 X:115675450-115675472 TTTTAACTTATAAATTTTGAGGG - Intergenic
1196659081 X:118251148-118251170 GTATATCTTAAAAATGGTGATGG + Intergenic
1196712478 X:118777351-118777373 ATTTATTTTTAAAAATTTGAAGG + Intronic
1197090946 X:122536560-122536582 TCATATCTTTAAAGTATTGAAGG + Intergenic
1197215946 X:123867048-123867070 TGTTAACTATAGAATGTTGAAGG - Intronic
1197529141 X:127601264-127601286 TTTTATTTTTAAATTTTTAAAGG + Intergenic
1197561003 X:128022098-128022120 TTCTATAATTAATATGTTGAGGG - Intergenic
1197939209 X:131771710-131771732 TTCTATGTTTAAATTTTTGAAGG + Intergenic
1198241021 X:134786184-134786206 TTTTTTCTTTAAACTGTTGGGGG - Intronic
1198372932 X:136008911-136008933 TTTAATCATTAAAATGTATAAGG - Intronic
1198758643 X:140007819-140007841 TTTTTCCTTTAAAATTTTAAAGG + Intergenic
1198781613 X:140243331-140243353 TGACATATTTAAAATGTTGAAGG - Intergenic
1199123255 X:144083310-144083332 TTTTATATTAAAAATTTTGTTGG - Intergenic
1199340129 X:146667894-146667916 TTTCTTCTTTTAAATGTTGAAGG + Intergenic
1199343471 X:146709720-146709742 TTTTATCTCTAAATTTTTGTTGG + Intergenic
1199496333 X:148456707-148456729 TTTTATTCTTAAATAGTTGAAGG - Intergenic
1199507341 X:148578810-148578832 TTTTTTCTTTAATGTGTGGAGGG + Intronic
1199927547 X:152483786-152483808 TTTATCCTTTAAACTGTTGATGG - Intergenic
1200341185 X:155397778-155397800 TTTTATATTTATAATGGTGTTGG + Intergenic
1200482598 Y:3725267-3725289 TATTAGCTCTAAAATGTTGGTGG - Intergenic
1201365162 Y:13197111-13197133 TTTTATCTTTTTAATGGTTAAGG - Intergenic
1201622266 Y:15973227-15973249 TTTTATCTGTAAAAATTTTAAGG - Intergenic
1201699957 Y:16869861-16869883 TTTTAGCATTAAAATGGTGATGG + Intergenic
1201902998 Y:19062506-19062528 TTTTATTTTTAAAATAAAGATGG - Intergenic
1202343720 Y:23897619-23897641 TTCTATACTTAAACTGTTGAGGG + Intergenic
1202527048 Y:25772466-25772488 TTCTATACTTAAACTGTTGAGGG - Intergenic