ID: 917990760

View in Genome Browser
Species Human (GRCh38)
Location 1:180376207-180376229
Sequence GCTCTCTTATGAACTGGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 86}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917990760 Original CRISPR GCTCTCTTATGAACTGGTAG TGG Intronic
900900923 1:5515324-5515346 GCTCTCATGGGAACTAGTAGAGG + Intergenic
907624283 1:56012843-56012865 GCTTTTGTATTAACTGGTAGTGG - Intergenic
908690321 1:66772359-66772381 GCTCTCATGTGAACTAATAGAGG + Intronic
908691978 1:66791863-66791885 GCTCTCTTATAAATTTCTAGTGG + Intergenic
909252115 1:73371431-73371453 GAACTCCTCTGAACTGGTAGTGG - Intergenic
910286377 1:85558999-85559021 GCACTTTTCTAAACTGGTAGTGG + Intronic
917990760 1:180376207-180376229 GCTCTCTTATGAACTGGTAGTGG + Intronic
919711188 1:200730729-200730751 TTTCTCTTATGAAATGATAGTGG - Intergenic
1074193919 10:111162678-111162700 GATCTCTTATGGGGTGGTAGGGG - Intergenic
1074577553 10:114684605-114684627 GGTCTCTTTAGAAGTGGTAGGGG - Intronic
1078870541 11:15340051-15340073 GGTTTTTTATTAACTGGTAGTGG + Intergenic
1086861208 11:91926562-91926584 ACTCTCTTAGGTACTGGAAGGGG - Intergenic
1088098642 11:106129760-106129782 TCACTCTAATGAACTGGTTGGGG + Intergenic
1090098006 11:123762899-123762921 GCTCTCATGTGAACTGATAGAGG + Intergenic
1094349859 12:29512233-29512255 GGTCTCCTGTGAACTAGTAGCGG - Intronic
1095871724 12:47035531-47035553 GTTCTCTTGTAAACAGGTAGTGG - Intergenic
1099149601 12:79093170-79093192 TCTCTCTTTTGTACTGCTAGGGG + Intronic
1105811260 13:23997775-23997797 GCTCTCTTCTGAACTAATAGAGG + Intronic
1112651282 13:101401298-101401320 TTTCTCTGATGTACTGGTAGTGG + Intronic
1113602950 13:111584036-111584058 GCGCTCTGCTGAACTGGGAGAGG - Intergenic
1114325001 14:21580011-21580033 GCTTCCTTATGAACTGGGGGAGG + Intergenic
1115023123 14:28707353-28707375 GCTCTCTTAAGTATTGGTTGGGG - Intergenic
1121226977 14:92328267-92328289 GCTCTATTGTGGACAGGTAGTGG + Intronic
1127391561 15:58509009-58509031 GCTCTTTTAAGAACTGCTAAAGG + Intronic
1128285892 15:66436775-66436797 GCTCCCTTATGATCTGGTTCCGG - Exonic
1128668034 15:69552905-69552927 GGTTTCTTATGAAGTGGGAGTGG + Intergenic
1135906148 16:26513638-26513660 GGACTCTTAGGAACTGGAAGTGG + Intergenic
1136653962 16:31698154-31698176 GCACTCTTATGATCTGATTGAGG + Intergenic
1146765222 17:35514805-35514827 AGTCTCTGATTAACTGGTAGGGG + Intronic
1149521144 17:57319069-57319091 GCTCTCTTCTGAGCTGGTGATGG + Intronic
1152509417 17:80775281-80775303 TTTCTCTTTTGAACAGGTAGCGG + Intronic
1154943059 18:21133162-21133184 GTTCTCTTAAGAACTGGTCACGG - Intergenic
1163825154 19:19519374-19519396 GCTCTGTGGTGAACTGGGAGAGG - Intronic
930806489 2:55495813-55495835 GCAGTCATATGAACTGATAGTGG + Intergenic
932561310 2:72873097-72873119 GATCTCTTGTGTACTGTTAGTGG - Intergenic
933776275 2:85773169-85773191 GCTCTCTGATGAGCTGATGGGGG - Intronic
934716805 2:96549392-96549414 GCTCCTTCATGAACTTGTAGAGG - Exonic
937234794 2:120424278-120424300 GCTCTCTTAAGGACTGGAATTGG - Intergenic
938096067 2:128465088-128465110 ACTATGTTATGAACTGGTTGGGG + Intergenic
940760364 2:157732178-157732200 GCTGTGTTATGAATTGGGAGAGG - Intergenic
942437066 2:175990269-175990291 GCTCTCTCAGGAACTAATAGAGG - Intronic
943339813 2:186666508-186666530 GCTCTCTTATGGATTGGTCCAGG + Intronic
945747823 2:213740386-213740408 GATGTCTTATGAAATGGGAGTGG + Intronic
1170884192 20:20324679-20324701 GCTCTCTTCTGTCCTGTTAGTGG - Intronic
1180747946 22:18104509-18104531 GTTCTTTTAGGAGCTGGTAGCGG + Exonic
951104301 3:18725007-18725029 GATCTTTCATGAACTGGTGGAGG - Intergenic
955171443 3:56569454-56569476 GCTCTCATGTGAACTGACAGAGG + Intronic
955819280 3:62878686-62878708 GCTCTACTATTAAGTGGTAGAGG - Intergenic
959126454 3:102295237-102295259 TCTCTGTTATCACCTGGTAGTGG + Intronic
964927049 3:161972251-161972273 GCTCTCTTGTGAAATGGTGGAGG + Intergenic
966963510 3:184966215-184966237 GCTCTCATGTAAACTGATAGAGG + Intronic
967434904 3:189432146-189432168 TCACTCTCATGACCTGGTAGGGG + Intergenic
967555321 3:190850100-190850122 TCTCTCTTTTGAAATGATAGAGG + Intergenic
972549225 4:40112414-40112436 GGTCTTTTATGAAAAGGTAGTGG + Intronic
972888953 4:43530527-43530549 GCACTCTTATTAACTTTTAGTGG + Intergenic
974715013 4:65657987-65658009 GCTCTCTTCTGAACTGAGAATGG - Intronic
977200636 4:94111357-94111379 TCTCTCTTATGAACTGTTGGTGG - Intergenic
977390272 4:96400406-96400428 ACTCTCTTAAGATCAGGTAGTGG + Intergenic
978261376 4:106764348-106764370 CTTATCTTATGAACTGGTAAAGG - Intergenic
984811746 4:183801554-183801576 TCTGTCTTGTGAGCTGGTAGGGG + Intergenic
985815498 5:2125229-2125251 GCTCTGATATGAAGTGGAAGAGG + Intergenic
989056814 5:37373828-37373850 ACTATCTTATGTACTGGAAGAGG + Intergenic
991038492 5:62152281-62152303 GCCCTAATATGAACTGGAAGGGG - Intergenic
992167346 5:74067635-74067657 CCTTTCTTAGGAACTGCTAGAGG - Intergenic
992208308 5:74452470-74452492 GCTCTCGAATGAACTAATAGAGG - Intergenic
993207011 5:84894997-84895019 GCACTCTCATGGGCTGGTAGTGG - Intergenic
993263999 5:85698097-85698119 GAACACTTATGAACTGTTAGTGG + Intergenic
998010190 5:138688724-138688746 TCTCTCTTATTTTCTGGTAGTGG - Intronic
1004894724 6:20137206-20137228 GAACTCTTATGTACTGCTAGTGG - Intronic
1009523545 6:64714876-64714898 GTTCTCCTAGCAACTGGTAGAGG - Intronic
1011220836 6:85052972-85052994 GCTCTCTTGTGAACTAACAGAGG + Intergenic
1012902654 6:105024592-105024614 GCTCTCTGATGAAATGTTGGGGG - Intronic
1016200380 6:141399645-141399667 ACTCTCTTATGAACTGACAGGGG + Intergenic
1020516500 7:9127615-9127637 GATCTCTTATGCACTGTTGGTGG + Intergenic
1026156182 7:67827722-67827744 GATCTGTTGGGAACTGGTAGTGG + Intergenic
1028757302 7:94452513-94452535 ACTCTCTCAGGAACTGGAAGAGG + Intergenic
1031382265 7:121101801-121101823 GCTCTCCTGTGAACTAATAGAGG + Intronic
1036675468 8:10828416-10828438 GCTCTCTTATGGAGTGGCTGTGG - Intronic
1038720171 8:30028037-30028059 GCTCCCTTATGATCTGGTTCCGG - Intergenic
1042273348 8:66978015-66978037 GCTCTCTTATACACTGTTAGTGG - Intronic
1043482665 8:80668856-80668878 GCTCTCTGATGCACTGGGAGAGG - Intronic
1044176470 8:89130175-89130197 GAGCTCTTATATACTGGTAGTGG + Intergenic
1045245727 8:100440300-100440322 GCCCTCTTATGAACTCTTTGGGG - Intergenic
1050124001 9:2337593-2337615 GCTCTATTATGAACTGAGAAGGG + Intergenic
1051253221 9:15183759-15183781 GCTCTCATGTGAGCTGGGAGAGG + Intronic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1054946396 9:70800529-70800551 GCTGTCTCATGAAGTGGCAGAGG - Intronic
1054964755 9:71010656-71010678 GAACTCTTATGAACTGTTGGTGG + Intronic
1056014492 9:82368911-82368933 GTTCTCTTTTGAACTGTTACAGG + Intergenic
1058799695 9:108533351-108533373 GCTCTCTCCACAACTGGTAGAGG - Intergenic
1186474319 X:9845455-9845477 GCTCACTTTTGAAATGGCAGGGG + Intronic
1186551346 X:10509044-10509066 GTTTTCTTCTGAAATGGTAGTGG + Intronic
1189190288 X:39095667-39095689 GATCCCTTATGCACTGTTAGTGG + Intergenic
1201460499 Y:14217456-14217478 AATCTCTCATGAACTGGCAGTGG + Intergenic