ID: 917995937

View in Genome Browser
Species Human (GRCh38)
Location 1:180438332-180438354
Sequence CCTACTCTATTTAAGGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917995937 Original CRISPR CCTACTCTATTTAAGGTACA GGG Intronic
903546846 1:24129690-24129712 CCTTCTCTTTTTCAGGCACATGG + Intronic
910024494 1:82633020-82633042 CCTACTCTATTCAGGGTATGGGG - Intergenic
911396154 1:97313531-97313553 CATCTTCTATTTAAGGCACAAGG - Intronic
916696978 1:167248400-167248422 CCTTTTCTATTTAAAGTTCAGGG - Intronic
917413688 1:174785801-174785823 TCTACTGTATTTAAGGCAAAGGG - Intronic
917654251 1:177110589-177110611 CCTACTATGTGCAAGGTACATGG + Intronic
917752292 1:178064932-178064954 TCTTCTCTCTTTAAGCTACAAGG - Intergenic
917995937 1:180438332-180438354 CCTACTCTATTTAAGGTACAGGG + Intronic
918727135 1:187940522-187940544 CTTACTCTATTTAAGTTAGATGG - Intergenic
918867899 1:189926660-189926682 CCCACTTTATTTTAGGTTCAGGG - Intergenic
924117032 1:240757971-240757993 CCGTCTCTACTAAAGGTACAAGG - Intergenic
924749496 1:246872554-246872576 CCTCCTCTATTTAATTTCCAAGG - Intronic
1062833242 10:619863-619885 CCTGGTCTACTTAAAGTACAGGG - Intronic
1063085454 10:2813880-2813902 CATATTCAATTTAAGGCACATGG - Intergenic
1065905238 10:30245165-30245187 CATAATCTATATAAAGTACATGG + Intergenic
1068448981 10:57162419-57162441 CCTAATCTGTTTGAGTTACAAGG - Intergenic
1068625156 10:59237058-59237080 CCTTCTCTATTTCAGGTGAATGG + Intronic
1069253926 10:66308925-66308947 CTTACTCTACTTAAGGGAAATGG + Intronic
1071124164 10:82315099-82315121 CATACTGTATTTATGGTCCATGG + Intronic
1071143240 10:82537491-82537513 CAAACTCTATTAAAGGTGCAAGG - Intronic
1071213090 10:83366968-83366990 CCTACTTTGTTTAAGCTAGAAGG + Intergenic
1071800111 10:89050355-89050377 CCTACTTTATTCAAGGCACAAGG - Intergenic
1071800257 10:89052142-89052164 CCTACTTGATTCAAGGCACAAGG - Intergenic
1072889953 10:99315022-99315044 CCTACTCTTGCTAAGGTGCATGG - Intergenic
1075315689 10:121451336-121451358 TCTATACTATTTAAGGGACATGG - Intergenic
1079967158 11:26993975-26993997 TCTCCACTATTAAAGGTACAGGG - Intergenic
1081041206 11:38216443-38216465 CTTACTCTGTGTAAGGAACAAGG + Intergenic
1086852656 11:91828662-91828684 CATACACTATTTAGAGTACATGG + Intergenic
1088096562 11:106107595-106107617 CCTAGTATATTCAAGGAACAGGG - Intergenic
1088466444 11:110145446-110145468 CCTACTCAGTTTCAGGTAAAAGG - Intronic
1088610606 11:111572683-111572705 CCAACACTACTTAAGGGACAAGG + Intergenic
1093583557 12:20810012-20810034 CCTACTATATCTCAGGCACATGG - Intergenic
1095226369 12:39681764-39681786 CCTACTCTGTTCCAGGTACTAGG - Intronic
1097997625 12:65907053-65907075 CCCACTCGTTTTCAGGTACAGGG - Intronic
1098084014 12:66821951-66821973 CCTATTCTATTTCTGGTCCAAGG - Intergenic
1100009133 12:89932961-89932983 CCTACTATGTGTAAGGCACATGG - Intergenic
1100169771 12:91960865-91960887 CCAAGTCTATTTAAAGTAGATGG + Intergenic
1102415886 12:112762334-112762356 CCTCCTCCATTTAAGGCTCAGGG + Intronic
1104849420 12:131864224-131864246 CCTACTCTGTTCCAGGCACAGGG + Intergenic
1106047450 13:26156545-26156567 TCTTCTCTATTAAGGGTACAGGG - Intronic
1107462094 13:40614078-40614100 GCTACTCTATTTCAGGAATAAGG + Intronic
1111785122 13:92776806-92776828 CCTACTATAATTGAGGTACAAGG - Intronic
1118645921 14:67840132-67840154 CCTATTTTATTTTAGGTTCAGGG + Intronic
1119846323 14:77832968-77832990 CCTGCTCTGTGTCAGGTACAGGG + Intronic
1120844768 14:89116105-89116127 CCTACTCTGTCTCAGCTACATGG + Intergenic
1125018654 15:34962981-34963003 CTCACTCTCTTTAAGGGACAGGG + Intronic
1125118454 15:36123451-36123473 CCATCTCTATTTAAGGTTTATGG + Intergenic
1128440805 15:67706792-67706814 CCTAATCTATTTGGGGTCCAGGG + Intronic
1128616288 15:69112998-69113020 CCTATTGTCTTAAAGGTACAGGG + Intergenic
1130286156 15:82556366-82556388 CATATTCTATTTAGGGAACAAGG + Intronic
1130362386 15:83202231-83202253 CCTACTGTATGTAAGGCACAGGG - Intronic
1133898734 16:9953355-9953377 GCTACTGTATGTCAGGTACAAGG - Intronic
1134197865 16:12172752-12172774 CATTCTCGATTTAAGGGACATGG + Intronic
1135645532 16:24158327-24158349 CCTACTATATGTGAGGCACAAGG + Intronic
1142279388 16:89139897-89139919 CCCCCTCTTTTTAACGTACAGGG + Intronic
1143691969 17:8575790-8575812 CCTACTCTATCCAAGGTATCTGG + Intronic
1157142532 18:45124383-45124405 GTTACTCTATTTAAGGCCCATGG - Intergenic
1157283529 18:46361685-46361707 CCTACCCTACTCAAGGTGCAGGG + Intronic
1157404441 18:47411166-47411188 TCTACTTTCATTAAGGTACAAGG + Intergenic
1158253795 18:55521675-55521697 CATACTCTATCAAAGGTAAAAGG - Intronic
1158826920 18:61231958-61231980 CCTACTGTCTTTAAGGTAGCTGG + Intergenic
1162154731 19:8669843-8669865 CCTACTGTATGCCAGGTACATGG - Intergenic
1164827101 19:31291824-31291846 CTTAATCCATTTAAGCTACAGGG + Intronic
1166639495 19:44483239-44483261 ATTACTCAATTTAAGGTTCATGG + Intronic
932991339 2:76791575-76791597 CCTACTCCATTTACAGGACAAGG + Intronic
934515810 2:94985714-94985736 CCTCCTCTATTTGATGGACAGGG + Intergenic
937030903 2:118739528-118739550 CCTGCTCTATTTTAGGCACTAGG + Intergenic
940971236 2:159899169-159899191 CCCACTCTTTTTAAGCTGCAGGG + Intronic
943453005 2:188069442-188069464 CAAACTCTATTTTAGGTTCAAGG + Intergenic
943532435 2:189100059-189100081 CTAAGTTTATTTAAGGTACAAGG + Intronic
944226159 2:197350614-197350636 CCTACTCTTTGTAAGGCACTCGG + Intergenic
1169638219 20:7719100-7719122 CCTACTTTAGTAAAGGTACTAGG - Intergenic
1181830326 22:25555368-25555390 CCTACTGTATGTGAGGTACCGGG - Intergenic
1184076896 22:42185974-42185996 GCTACTCAAGTTATGGTACATGG + Intronic
949753962 3:7387521-7387543 CCTAGTCAATTAATGGTACAAGG - Intronic
951755239 3:26083961-26083983 CCTGCTCAATTTAGGATACAAGG - Intergenic
955370316 3:58345742-58345764 CCTACTCTATTCTAGGTTAAAGG + Intronic
955385325 3:58474721-58474743 CCTTCCTTATTTAAGGGACAAGG - Intergenic
958032047 3:88123157-88123179 ACTATTCTATTTAAGGAACGAGG + Intronic
958541999 3:95489701-95489723 CCTGCTATATTTAATGAACAGGG - Intergenic
959027221 3:101253823-101253845 CCTATTGTATTTGAGGTGCAGGG + Intronic
963845261 3:150149141-150149163 CCTACTGTATTTCAGGTATTAGG + Intergenic
964209953 3:154215459-154215481 CCTACTATGTTTCAGGTACTAGG - Intronic
965933314 3:174073898-174073920 AATACTATATTTAAGGTACTAGG + Intronic
967823929 3:193863581-193863603 CCTATTCTTTTTAATGTATAAGG - Intergenic
970307363 4:14747581-14747603 CCTTCTCTGTTTCAGGAACATGG + Intergenic
971571895 4:28222966-28222988 CCTGCACTGTTTAAAGTACAGGG + Intergenic
971610136 4:28713560-28713582 CCTAATATGTTTAAGGTACTTGG + Intergenic
973305564 4:48645191-48645213 CCTACTGCAGGTAAGGTACAGGG + Intronic
973983764 4:56329403-56329425 CATCCTTTATTTAAGGTACATGG - Intergenic
974045860 4:56897989-56898011 CCTTCTCTGTTTAAGGTGCAAGG - Intergenic
975300528 4:72785035-72785057 GCTACTCTATTTGATTTACATGG - Intergenic
978513423 4:109546437-109546459 CCTACTATATGTCAGGTATAGGG - Intergenic
978881977 4:113716005-113716027 CCTAGTTTATTTCAGGTACTAGG + Intronic
981997900 4:150994451-150994473 CCTACTACATGTTAGGTACAAGG + Intronic
984368065 4:178823545-178823567 TCTACTCTATTTAACGTCTATGG + Intergenic
988790526 5:34603449-34603471 CCTACTCTAGCTAATATACAAGG + Intergenic
995101073 5:108306446-108306468 GCTAGTATATTTCAGGTACAAGG - Intronic
997071254 5:130625103-130625125 CCTTCTGTATTCAAGGTTCAAGG - Intergenic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999448438 5:151659938-151659960 CCTCCTCAATGAAAGGTACAGGG + Intergenic
1005594032 6:27361140-27361162 CCTACTCCCTTTCAGGTAGAAGG - Intergenic
1008492102 6:52097167-52097189 CCTACTCTATATAAGGTACAGGG - Intergenic
1010041360 6:71388647-71388669 GCTACTCAACTTTAGGTACAAGG + Intergenic
1014648217 6:124002608-124002630 TTTACTCTATTTAAGGTAGTTGG + Intronic
1014863471 6:126498679-126498701 GATACTCTATTTAAAGTACTTGG - Intergenic
1018023789 6:159788997-159789019 CCTACTCTTTTTCTGGTAAATGG + Intronic
1018491631 6:164299657-164299679 CCTTCTCTATTAGAGGTAGAGGG - Intergenic
1023473928 7:40555981-40556003 CATACTTTATGTAGGGTACATGG - Intronic
1024568601 7:50705589-50705611 CATACTCTATTTGAGTCACATGG + Intronic
1027626780 7:80554784-80554806 CCTAGTCTATAAAAGGTACTGGG - Intronic
1027981654 7:85232019-85232041 CCCACTCTATTTAATGGACTAGG + Intergenic
1028979223 7:96948594-96948616 CATACTGTATTTAAGTTACTGGG + Intergenic
1034670996 7:152858457-152858479 CCTCCTCAATTTAGGCTACATGG - Intergenic
1036135472 8:6156884-6156906 CCTAGTTTATTATAGGTACATGG + Intergenic
1037254176 8:16933713-16933735 CTTACTCTGTTTCAGGTACATGG - Intergenic
1039800199 8:40947816-40947838 CCTTCTCTAGTTATGGCACATGG - Intergenic
1040786000 8:51163915-51163937 CCTTTTCTATTTAAGCTAGAAGG + Intergenic
1041942414 8:63403217-63403239 CCTACTCTATTTCATGAGCAGGG - Intergenic
1043150632 8:76711024-76711046 CCTTTTATATTTAAGGTAGAAGG + Intronic
1043982265 8:86656905-86656927 CCTCCTCTATGTATGATACAGGG + Intronic
1045946536 8:107802622-107802644 CCTTCCCTATTCAAGGGACATGG - Intergenic
1047860797 8:128964641-128964663 CCTACTCTATATCAGGCACTGGG - Intergenic
1048592165 8:135830665-135830687 TCTACTCTATTGCAGGCACAGGG - Intergenic
1048674002 8:136756322-136756344 CCTACTCTGTTTTATTTACATGG - Intergenic
1052463162 9:28793888-28793910 TCTACACTATTTAAGGAACTGGG + Intergenic
1052671641 9:31565172-31565194 CCTACTTTATTTAAAGCAAAAGG + Intergenic
1060289419 9:122286704-122286726 CCTTGTTTATTTAAGATACAAGG - Intronic
1062016289 9:134292871-134292893 CCTACTCCATGTAGGTTACAAGG + Intergenic
1186247985 X:7634743-7634765 CCTAATATATTTTAGATACAGGG - Intergenic
1186473618 X:9839965-9839987 CCTACTCTATTTGAGGTCATCGG + Intronic
1196881832 X:120205909-120205931 CTTCCTCTGTGTAAGGTACATGG + Intergenic