ID: 918003452

View in Genome Browser
Species Human (GRCh38)
Location 1:180520103-180520125
Sequence CTGGGCTAGCTCCCATCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918003452_918003461 30 Left 918003452 1:180520103-180520125 CCTGGAGATGGGAGCTAGCCCAG No data
Right 918003461 1:180520156-180520178 GAGAGAGATGGGCATTTGGCAGG No data
918003452_918003459 19 Left 918003452 1:180520103-180520125 CCTGGAGATGGGAGCTAGCCCAG No data
Right 918003459 1:180520145-180520167 CAGAAAAAAGTGAGAGAGATGGG No data
918003452_918003458 18 Left 918003452 1:180520103-180520125 CCTGGAGATGGGAGCTAGCCCAG No data
Right 918003458 1:180520144-180520166 ACAGAAAAAAGTGAGAGAGATGG No data
918003452_918003460 26 Left 918003452 1:180520103-180520125 CCTGGAGATGGGAGCTAGCCCAG No data
Right 918003460 1:180520152-180520174 AAGTGAGAGAGATGGGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918003452 Original CRISPR CTGGGCTAGCTCCCATCTCC AGG (reversed) Intergenic
No off target data available for this crispr