ID: 918005825

View in Genome Browser
Species Human (GRCh38)
Location 1:180541317-180541339
Sequence GAAGCACTTAGAACAATGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918005822_918005825 28 Left 918005822 1:180541266-180541288 CCTGAAAATCTCCCAATGAATTT No data
Right 918005825 1:180541317-180541339 GAAGCACTTAGAACAATGCCTGG No data
918005820_918005825 30 Left 918005820 1:180541264-180541286 CCCCTGAAAATCTCCCAATGAAT No data
Right 918005825 1:180541317-180541339 GAAGCACTTAGAACAATGCCTGG No data
918005821_918005825 29 Left 918005821 1:180541265-180541287 CCCTGAAAATCTCCCAATGAATT No data
Right 918005825 1:180541317-180541339 GAAGCACTTAGAACAATGCCTGG No data
918005823_918005825 17 Left 918005823 1:180541277-180541299 CCCAATGAATTTATCTTTTTAAA No data
Right 918005825 1:180541317-180541339 GAAGCACTTAGAACAATGCCTGG No data
918005824_918005825 16 Left 918005824 1:180541278-180541300 CCAATGAATTTATCTTTTTAAAA No data
Right 918005825 1:180541317-180541339 GAAGCACTTAGAACAATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918005825 Original CRISPR GAAGCACTTAGAACAATGCC TGG Intergenic
No off target data available for this crispr