ID: 918008153

View in Genome Browser
Species Human (GRCh38)
Location 1:180561406-180561428
Sequence CAGGTGGTGTTGCAGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918008150_918008153 -10 Left 918008150 1:180561393-180561415 CCAGTCAGGGTAACAGGTGGTGT No data
Right 918008153 1:180561406-180561428 CAGGTGGTGTTGCAGGAGATGGG No data
918008145_918008153 14 Left 918008145 1:180561369-180561391 CCTGGCATTTGCTGTCAGAACAA No data
Right 918008153 1:180561406-180561428 CAGGTGGTGTTGCAGGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918008153 Original CRISPR CAGGTGGTGTTGCAGGAGAT GGG Intergenic
No off target data available for this crispr