ID: 918009045

View in Genome Browser
Species Human (GRCh38)
Location 1:180569470-180569492
Sequence CACTCCCTCCAGAGGCTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918009045_918009053 30 Left 918009045 1:180569470-180569492 CCCTAGAGCCTCTGGAGGGAGTG No data
Right 918009053 1:180569523-180569545 TAATATTGGTTTCAGACTCCTGG No data
918009045_918009050 16 Left 918009045 1:180569470-180569492 CCCTAGAGCCTCTGGAGGGAGTG No data
Right 918009050 1:180569509-180569531 TAATTTCATCCCATTAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918009045 Original CRISPR CACTCCCTCCAGAGGCTCTA GGG (reversed) Intergenic
No off target data available for this crispr