ID: 918011123

View in Genome Browser
Species Human (GRCh38)
Location 1:180587320-180587342
Sequence GGAGCCTTAACTAGACCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918011120_918011123 -2 Left 918011120 1:180587299-180587321 CCATTCCTGGAGGGAGGTGGAGG No data
Right 918011123 1:180587320-180587342 GGAGCCTTAACTAGACCAGAAGG No data
918011118_918011123 1 Left 918011118 1:180587296-180587318 CCTCCATTCCTGGAGGGAGGTGG No data
Right 918011123 1:180587320-180587342 GGAGCCTTAACTAGACCAGAAGG No data
918011112_918011123 14 Left 918011112 1:180587283-180587305 CCACTGTGTCCGGCCTCCATTCC No data
Right 918011123 1:180587320-180587342 GGAGCCTTAACTAGACCAGAAGG No data
918011122_918011123 -7 Left 918011122 1:180587304-180587326 CCTGGAGGGAGGTGGAGGAGCCT No data
Right 918011123 1:180587320-180587342 GGAGCCTTAACTAGACCAGAAGG No data
918011116_918011123 5 Left 918011116 1:180587292-180587314 CCGGCCTCCATTCCTGGAGGGAG No data
Right 918011123 1:180587320-180587342 GGAGCCTTAACTAGACCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918011123 Original CRISPR GGAGCCTTAACTAGACCAGA AGG Intergenic