ID: 918011908

View in Genome Browser
Species Human (GRCh38)
Location 1:180594758-180594780
Sequence CCTTCCTGCTTGGCTAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918011908_918011912 -7 Left 918011908 1:180594758-180594780 CCTCTTTTAGCCAAGCAGGAAGG No data
Right 918011912 1:180594774-180594796 AGGAAGGGTTTCCTGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918011908 Original CRISPR CCTTCCTGCTTGGCTAAAAG AGG (reversed) Intergenic
No off target data available for this crispr