ID: 918011912

View in Genome Browser
Species Human (GRCh38)
Location 1:180594774-180594796
Sequence AGGAAGGGTTTCCTGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918011908_918011912 -7 Left 918011908 1:180594758-180594780 CCTCTTTTAGCCAAGCAGGAAGG No data
Right 918011912 1:180594774-180594796 AGGAAGGGTTTCCTGCAGCCAGG No data
918011905_918011912 29 Left 918011905 1:180594722-180594744 CCGCTCGCATTAAATCTATGTGC No data
Right 918011912 1:180594774-180594796 AGGAAGGGTTTCCTGCAGCCAGG No data
918011904_918011912 30 Left 918011904 1:180594721-180594743 CCCGCTCGCATTAAATCTATGTG No data
Right 918011912 1:180594774-180594796 AGGAAGGGTTTCCTGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918011912 Original CRISPR AGGAAGGGTTTCCTGCAGCC AGG Intergenic
No off target data available for this crispr