ID: 918013649

View in Genome Browser
Species Human (GRCh38)
Location 1:180611213-180611235
Sequence CTGCTGTTGCTGGGGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918013649_918013655 -8 Left 918013649 1:180611213-180611235 CCTTTCTTCCCCAGCAACAGCAG No data
Right 918013655 1:180611228-180611250 AACAGCAGCAAATATGTGGGTGG No data
918013649_918013656 0 Left 918013649 1:180611213-180611235 CCTTTCTTCCCCAGCAACAGCAG No data
Right 918013656 1:180611236-180611258 CAAATATGTGGGTGGCTATTTGG No data
918013649_918013657 25 Left 918013649 1:180611213-180611235 CCTTTCTTCCCCAGCAACAGCAG No data
Right 918013657 1:180611261-180611283 GCAGCTCTATGTAGCTATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918013649 Original CRISPR CTGCTGTTGCTGGGGAAGAA AGG (reversed) Intergenic
No off target data available for this crispr