ID: 918013672

View in Genome Browser
Species Human (GRCh38)
Location 1:180611481-180611503
Sequence CCTCTTTAGCAGCTGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918013672_918013676 1 Left 918013672 1:180611481-180611503 CCTGCCTTCAGCTGCTAAAGAGG No data
Right 918013676 1:180611505-180611527 AGTGACATGGAGAAGCAGAGAGG No data
918013672_918013677 4 Left 918013672 1:180611481-180611503 CCTGCCTTCAGCTGCTAAAGAGG No data
Right 918013677 1:180611508-180611530 GACATGGAGAAGCAGAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918013672 Original CRISPR CCTCTTTAGCAGCTGAAGGC AGG (reversed) Intergenic
No off target data available for this crispr