ID: 918014523

View in Genome Browser
Species Human (GRCh38)
Location 1:180620174-180620196
Sequence TCCCAATGGCAGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918014523_918014530 11 Left 918014523 1:180620174-180620196 CCTTCCACCTTCTGCCATTGGGA No data
Right 918014530 1:180620208-180620230 AGATGCCAGCAGCATGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918014523 Original CRISPR TCCCAATGGCAGAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr